| PCdb_0001 | 33557889 | Gh_A11G3237 | Gh_A11G3237 (Gossypium hirsutum -1,3-glucanase A11G3237) [Source: CottonGen] | GGCATCGGAGATGATCACGA | GGG | Gossypium hirsutum L. | 0.5889 | seed | CRISPR-Cas9 |
| PCdb_0002 | 33346897 | Pp3c27_7830V3.3 (PHY4) | Physcomitrella phytochrome 4 (Pp3c27_7830V3.3, light sensing) | GGCAGCCTATTAGTCTGGCC | GGG | Physcomitrella patens (Hedw.) Bruch & Schimp. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0003 | 30917862 | Glyma.20g148200 | Flavonoid 3'-hydroxylase (Glyma.20g148200) [Source: SoyBase] | GGATTCTCTGGGCATCGCCA | GGG | Glycine max (L.) Merr. | not found | hairy root | CRISPR-Cas9 |
| PCdb_0004 | 27986915 | PpFtsZ2-1 | responsible for chloroplast division, and mutations result in the development of large chloroplasts | GGATTCCGCATCACGCTCGAG | GGG | Physcomitrella patens (Hedw.) Bruch & Schimp. | 0.45 | protoplast | CRISPR-Cas9 |
| PCdb_0005 | 33557889 | Gh_A05G3926 | Gh_A05G3926 (Gossypium hirsutum NAC transcription factor, stress response) [Source: CottonGen] | GGATTCACTTCGCCAGACAG | GGG | Gossypium hirsutum L. | 0.5889 | seed | CRISPR-Cas9 |
| PCdb_0006 | 26842991 | FGS | FGS (Arabidopsis thaliana FATTY ACID ELONGASE9, very-long-chain fatty acid biosynthesis) [Source: TAIR] | GGATTACCTACTAAGTATAC | GGG | Zea mays L. | 0.0296 | protoplast | CRISPR-Cas9 |
| PCdb_0007 | 31394891 | RSZ21 | Zinc finger-containing splicing regulator | GGATCCCCGAGTGACTTCCG | GGG | Oryza sativa L. | not found | callus | CRISPR-Cas9 |
| PCdb_0008 | 33931634 | VvbZIP36 | Vitis vinifera bZIP transcription factor 36 (VvbZIP36, stress signaling) | GGAGGtGAATCGGAAACGAG | GGG | Vitis vinifera L. | not found | calli | CRISPR-Cas9 |
| PCdb_0009 | 34899806 | GmAITR5 | Enhanced Salinity Stress Tolerance | GGAGGGGTTTGGGGGCGATA | GGG | Glycine max (L.) Merr. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0010 | 26842991 | FGS | FGS (Arabidopsis thaliana FATTY ACID ELONGASE89, very-long-chain fatty acid biosynthesis) [Source: TAIR] | GGAGCGGCGCCGCGCCATAT | GGG | Zea mays L. | 0.185 | protoplast | CRISPR-Cas9 |
| PCdb_0011 | 29884615 | PYRABACTIN RESISTANCE1-LIKE (PYL) | PYRABACTIN RESISTANCE1-LIKE ABA receptor (PYL, abscisic acid signaling) | GGAGATTTGGTTCTCTGTTG | GGG | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0012 | 29867128 | AtALS & AtPDS & AtFT & AtLFY | Acetolactate synthase (ALS), Phytoene desaturase (PDS), Flowering locus T (FT), and Leafy (LFY) - Multiple gene targets for plant genetic studies | GGAGATATTCTCGGAGGTGA | GGG | Arabidopsis thaliana (L.) Heynh. | 0.0412 | protoplast | ABE |
| PCdb_0013 | 38925598 | LOC_Os05g49730 | taste quality | GGACGTTCATGGCTTCGACG | GGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_0014 | 39840369 | BnaX.SGT.a | FAE1 gene encodes 3-ketoacyl-CoA synthase (KCS), catalyzing the rate-limiting initial condensation step for elongation of C18-CoA to very-long-chain fatty acids including erucic acid (C22:1) | GGACCCAGAGAACAGCACAG | GGG | Sinapis alba L. | not found | hypocotyl | CRISPR/Cas9 |
| PCdb_0015 | 26842991 | FGS | FGS (Arabidopsis thaliana FATTY ACID ELONGASE63, very-long-chain fatty acid biosynthesis) [Source: TAIR] | GGACAATTGGTGAGGACATA | GGG | Zea mays L. | 0.1759 | protoplast | CRISPR-Cas9 |
| PCdb_0016 | 32327549 | SAR1B | Secretion-associated RAS-related GTPase SAR1B | GGAATCTTAGCTTCGTTA | GGG | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0017 | 35487656 | AhFatB | Arachis hypogaea fatty acyl-ACP thioesterase B, terminates fatty acid synthesis and releases saturated fatty acids | GGAATCCTCGTCGACGA | GGG | Arachis hypogaea L. | 0.0163 | protoplast | CRISPR-Cas9 |
| PCdb_0018 | 38925598 | LOC_Os12g27940 | taste quality | GGAATAGCCTGGGGTCAACG | GGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_0019 | 34077267 | OsRAM2 | Function in Lipid Biosynthesis Is Required for Arbuscular Mycorrhizal Symbiosis in Rice | GGAAGGTGACCACGTATCCG | GGG | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0020 | 36895877 | TaTFL1-5 | decreases tiller and spikelet numbers in common wheat | GGAACCTCTTATTGTGGGGC | GGG | Triticum aestivum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0021 | 36471650 | fdh | fdh (Formate dehydrogenase, EC 1.2.1.2, formate oxidation) [Source: UniProt] | GCTGTGCAGAAAATGCCTTG | GGG | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0022 | 26603121 | GmPDS18 | Phytoene desaturase | GCTGTCCGCCAAGCATAGCT | GGG | Glycine max (L.) Merr. | 0.481 | hairy root | CRISPR-Cas9 |
| PCdb_0023 | 38925598 | LOC_Os11g47870 | taste quality | GCTGGGCGTGGAGGAGAGCA | GGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_0024 | 38925598 | LOC_Os04g40660 | taste quality | GCTGGCGGAGGGGCACCTGC | GGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_0025 | 38925598 | LOC_Os10g12400 | taste quality | GCTGGCCTACTGAAGATAGT | GGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_0026 | 35898225 | CYP92B14 | Piperitol/sesamin oxidase (CYP92B14) | GCTGATGGAGAACTCCGCTT | GGG | Sesamum indicum L. | 0.9333 | protoplast | CRISPR-Cas9 |
| PCdb_0027 | 38925598 | LOC_Os07g40020 | taste quality | GCTGACGCAGCAGATCCTGT | GGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_0028 | 36070109 | TaGW2 | E3 ubiquitin ligase GW2 | GCTCGCGCCCTGCTACCCGG | GGG | Triticum aestivum L. | 0.77 | leaf | not found |
| PCdb_0029 | 30627700 | TaGW2 | Wheat E3 ubiquitin ligase controlling grain width and weight | GCTCGCGCCCTGCTACCCGG | GGG | Triticum aestivum L. | 0.4 | Protoplast | CRISPR-Cas9 |
| PCdb_0030 | 38925598 | LOC_Os08g41030 | taste quality | GCTCACGCCGGGCCACGTCA | GGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_0031 | 38925598 | LOC_Os05g41230 | taste quality | GCTAGGTTTCCGGCCGACGT | GGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_0032 | 31397626 | ZmACD6 | Acyl-CoA dehydrogenase 6 | GCTAGGCCGCCATTTCCAGT | GGG | Zea mays L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0033 | 38925598 | LOC_Os08g23170 | taste quality | GCTAGCTTGTCGTGGCAACT | GGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_0034 | 38925598 | LOC_Os08g43480 | taste quality | GCTACGAGTTTGACGAGGAA | GGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_0035 | 31694550 | PDS | Phytoene desaturase | GCTACAACTTGGAGGCGACG | GGG | Triticum aestivum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0036 | 36903878 | not found | not found | GCGTTGGCGGTAACAAGAAA | GGG | Glycine max (L.) Merr. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0037 | 34899806 | GmAITR1 | Enhanced Salinity Stress Tolerance | GCGTGACAGGCACG TGCATG | GGG | Glycine max (L.) Merr. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0038 | 38925598 | LOC_Os02g50630 | taste quality | GCGTCGGCCGGCGAAGACGA | GGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_0039 | 38925598 | LOC_Os10g40720 | taste quality | GCGTCGCCGGCGCCAGGCCG | GGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_0040 | 31073866 | LSSR1 | Leaf senescence suppressor 1 (chlorophyll degradation) [Source: NCBI] | GCGTCGAGGCCAACAACCCC | GGG | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0041 | 38925598 | LOC_Os01g65770 | taste quality | GCGGGGCCGGGTCCTCTGCG | GGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_0042 | 29884615 | PYRABACTIN RESISTANCE1-LIKE (PYL) | PYRABACTIN RESISTANCE1-LIKE ABA receptor (PYL, abscisic acid signaling) | GCGGAGAGTCTGGAGATCTT | GGG | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0043 | 27007717 | OsROC5 | SBP-box transcription factor Roc5, leaf-rolling regulator (OsROC5) | GCGGAGAACGACAGCCGGTC | GGG | Oryza sativa L. | 0.64 | protoplast | CRISPR-Cas9 |
| PCdb_0044 | 27007717 | OsROC5 | SBP-box transcription factor Roc5, leaf-rolling regulator (OsROC5) | GCGGAGAACGACAGCCGGTC | GGG | Oryza sativa L. | 0.64 | protoplast | CRISPR-Cas9 |
| PCdb_0045 | 32508867 | not found | not found | GCGGAGAACGACAGCCGGTC | GGG | Oryza sativa L. | not found | calli | CRISPR-Cas9 |
| PCdb_0046 | 34984801 | OsSPL4 | Squamosa promoter-binding-like 4 | GCGGAAGGAGAAGCGAGGCA | GGG | Oryza sativa L. | not found | protoplast | CRISPR-Cas9,Base editor |
| PCdb_0047 | 34713232 | not found | not found | GCGCGGGTGAGCTTCGCCAT | GGG | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0048 | 38925598 | LOC_Os03g21650 | taste quality | GCGCGCCCGACGTCGCTGCG | GGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_0049 | 38925598 | LOC_Os01g29507 | taste quality | GCGACGCTGTCGGTCAGCAA | GGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_0050 | 38925598 | LOC_Os10g41550 | taste quality | GCGACGCTGCTGCACCACGG | GGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_0051 | 38925598 | LOC_Os07g46360 | taste quality | GCGACCGACGACCGAGATGG | GGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_0052 | 33015536 | AGO4 & NRPD1a & NRPE1 & RDR2 & RDR4 & RDR6 & CHLI1 & PIE1 | Multi-gene complex: RNA-directed DNA methylation machinery (small RNA biogenesis and chromatin modification) | GCCTTTGATTACATGCTGAA | GGG | Arabidopsis thaliana (L.) Heynh. | 0.48 | seed | CRISPR-Cas9 |
| PCdb_0053 | 38925598 | LOC_Os01g44340 | taste quality | GCCGTGCCGCAGCCACTGCA | GGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_0054 | 38925598 | LOC_Os09g28420 | taste quality | GCCCGGCATGTATCCCTGCG | GGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_0055 | 34630462 | not found | not found | GCCCCGACTTCGCGCCAATG | GGG | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0056 | 34564662 | OfCad | not found | GCCAGCCCAGAGCCCAGCT | GGG | Zea mays L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0057 | 38925598 | LOC_Os01g53930 | taste quality | GCATCTTGAGCGGGGCGTGA | GGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_0058 | 26808139 | Eif4e | eIF4E cap-binding protein: translation initiation factor and virus interaction :contentReference[oaicite:5]{index=5} | GCAGTTGTTAATGTTAGATCT | GGG | Cucumis sativus L. | 0.375 | cotyledon | CRISPR-Cas9 |
| PCdb_0059 | 31996144 | CCD8 | Carotenoid cleavage dioxygenase 8, produces strigolactone hormones that regulate shoot branching | GCAGGGGTGGTCCTGCACCA | GGG | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0060 | 30582653 | OsROC5 | Regulates leaf rolling and drought tolerance in rice | GCAGCTGGCTGAGGGTGCAT | GGG | Oryza sativa L. | 0.03 | protoplast | not found |
| PCdb_0061 | 36903878 | not found | not found | GCAGATATTCGTAATTATGC | GGG | Glycine max (L.) Merr. | 71.43-97.62% | protoplast | CRISPR-Cas9 |
| PCdb_0062 | 36903878 | not found | not found | GCAGATATTCGTAATTATGC | GGG | Glycine max (L.) Merr. | 71.43-97.62% | protoplast | CRISPR-Cas9 |
| PCdb_0063 | 29720392 | not found | not found | GCACCTACCGAGATGACGTC | GGG | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0064 | 38925598 | LOC_Os02g19420 | taste quality | GCACCTAATGACAAAGTTGG | GGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_0065 | 36660867 | OsCKX | Rice cytokinin oxidase/dehydrogenase (cytokinin catabolism enzyme) | gcaccggtgccctgagatag | ggg | Oryza sativa L. | not found | protoplast | CRISPR-Cas9,CRISPR-Cas12 |
| PCdb_0066 | 27033976 | MIR827a | microRNA 827a | GCAAATCGAAAAGCTTCTTA | GGG | Arabidopsis thaliana (L.) Heynh. | 0.24 | seed | not found |
| PCdb_0067 | 27033976 | AtMIR827a | microRNA 827a | GCAAATCGAAAAGCTTCTTA | GGG | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0068 | 29250878 | BnCLV3 | CLAVATA3 peptide ligand | GCAAAGGGTCAGGTCCTGAA | GGG | Brassica napus L. | not found | seed | CRISPR-Cas9 |
| PCdb_0069 | 32841372 | BnCLV3 | regulates seed production | GCAAAGGGTCAGGTCCTGAA | GGG | Brassica napus L. | not found | seed | CRISPR-Cas9 |
| PCdb_0070 | 31694550 | PDS | Phytoene desaturase | GCAAACAAATTCTGTACATT | GGG | Triticum aestivum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0071 | 34697825 | BnF5H | Ferulate 5-hydroxylase | GATTGCTTTGATATTGTCAC | GGG | Brassica napus L. | not found | Cell Wall | CRISPR-Cas9 |
| PCdb_0072 | 32117361 | TFT10 | Flowering locus Tike protein (TFT10) | GATTCACTGGTAGTAGCAGA | GGG | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0073 | 38925598 | LOC_Os05g44760 | taste quality | GATGGAGCGAGGCCTGCGCG | GGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_0074 | 34834905 | FAD2 | FAD2 (Fatty acid desaturase 2, EC 1.14.19.2, linoleic acid biosynthesis) [Source: UniProt] | GATGAAGGAACATCCGAGAA | GGG | Glycine max (L.) Merr. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0075 | 34834905 | FAD2 & FATB | Fatty acid desaturase & Acyl-ACP thioesterase | GATGAAGGAACATCCGAGAA | GGG | Glycine max (L.) Merr. | 0.592 | hairy root | CRISPR-Cas9 |
| PCdb_0076 | 31307375 | GmFAD2 | oleate desaturase (oil unsaturation) | GATGAAGGAACATCCGAGAA | GGG | Glycine max (L.) Merr. | 0.533 | hairy root | CRISPR-Cas9 |
| PCdb_0077 | 36079670 | QTLqHD7b | qHD7b heading date QTL (flowering time regulation) | GATCGGCGCCCCGGC | GGG | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0078 | 33518716 | not found | not found | GATCCGGTAACGACGGTCAC | GGG | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0079 | 29604159 | eIF4G | Eukaryotic translation initiation factor 4G, scaffold protein for translation machinery | GATCACCCAAGTCCTGGAAG | GGG | Oryza sativa L. | 0.656 | immature embryos | cas9 |
| PCdb_0080 | 29604159 | eIF4G | Eukaryotic translation initiation factor 4G, scaffold protein for translation machinery | GATCACCCAAGTCCTGGAAG | GGG | Oryza sativa L. | 0.656 | immature embryos | cas9 |
| PCdb_0081 | 29868058 | LEAFY | LFY encodes a transcription factor that regulates the expression of floral organ identity genes. | GATCACAGAGAGAGAGACAA | GGG | Populus sp. | 0.775 | floral meristem | CRISPR-Cas9 |
| PCdb_0082 | 37528980 | not found | not found | GATCAACAAGGAGAGGCTAC | GGG | Oryza sativa L. | not found | not found | not found |
| PCdb_0083 | 34539694 | 0 sS 40 | Possible typographical entry (function unclear without additional context) | GAGTTGTCCTCCGCGGGCTC | GGG | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0084 | 34073486 | NbPDS | Phytoene desaturase (carotenoid biosynthesis) [Source: SolGenomics] | GAGTTACTGCAAATTGAGTT | GGG | Nicotiana tabacum L. | 0.2289 | leaf | ABE |
| PCdb_0085 | 38925598 | LOC_Os09g31390 | taste quality | GAGGAGGCTAGCCCAGAACA | GGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_0086 | 26842991 | FGS | FGS (Arabidopsis thaliana FATTY ACID ELONGASE45, very-long-chain fatty acid biosynthesis) [Source: TAIR] | GAGCTGCTCACCGTGCTCGA | GGG | Zea mays L. | 0.1227 | protoplast | CRISPR-Cas9 |
| PCdb_0087 | 35410430 | Sb-Lgs1 | during rapid de novo shoot regeneration | GAGCTGCCGTTCTGTATCCC | GGG | Hemisorghum C.E.Hubb. ex Bor | not found | embryo | CRISPR-Cas9 |
| PCdb_0088 | 33152517 | APOBEC3A | the APOBEC family of cytidine deaminases | GAGCTCAAGCTCCGCGCCGC | GGG | Oryza sativa L. | 0.863 | protoplast | CBE |
| PCdb_0089 | 27862889 | FAD2 | Fatty acid desaturase 2 | GAGCGTTTGAAACAATGCGGC | GGG | Arabidopsis thaliana (L.) Heynh. | 0.716 | seed | CRISPR-Cas9 |
| PCdb_0090 | 27862889 | FAD2 | Fatty acid desaturase 2 | GAGCGTTTGAAACAATGCGGC | GGG | Arabidopsis thaliana (L.) Heynh. | 0.716 | seed | CRISPR-Cas9 |
| PCdb_0091 | 34984801 | OsCKX2 | Cytokinin oxidase/dehydrogenase 2 | GAGCFCAAGCTCCGCGCCGC | GGG | Oryza sativa L. | not found | protoplast | CRISPR-Cas9,Base editor |
| PCdb_0092 | 31452351 | Glyma.17G215300 | NAC domain protein (Glyma.17G215300) [Source: SoyBase] | GAGATGAATCTGGGATGGGG | GGG | Glycine max (L.) Merr. | 0.592 | hairy root | CRISPR-Cas9 |
| PCdb_0093 | 38925598 | LOC_Os07g43604 | taste quality | GAGAGAGGAGAGGGTAAGCG | GGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_0094 | 32841372 | BnaEOD3 | regulates seed production | GAGACATGCTTCCCACGAAA | GGG | Brassica napus L. | not found | seed | CRISPR-Cas9 |
| PCdb_0095 | 36510797 | bHLH57 | Basic helix-loop-helix transcription factor 57, regulates various developmental processes | GACTGGCTGGGATAACCGGA | GGG | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0096 | 26842991 | FGS | FGS (Arabidopsis thaliana FATTY ACID ELONGASE16, very-long-chain fatty acid biosynthesis) [Source: TAIR] | GACTCACTATTCTGATCATA | GGG | Zea mays L. | 0.0531 | protoplast | CRISPR-Cas9 |
| PCdb_0097 | 26269544 | MS26 | Male sterility protein 26 (tapetum development) [Source: MaizeGDB] | GACGTACGTGCCCTACTCGAT | ggg | Zea mays L. | not found | embryo | CRISPR-Cas9 |
| PCdb_0098 | 33324433 | TaPDS | Phytoene desaturase | GACGGTGAAGGTGGCGCCG | GGG | Triticum aestivum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0099 | 38925598 | LOC_Os07g42490 | taste quality | GACCCGTCTCCACAGCATGA | GGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_0100 | 34143557 | waxy | wheat grain quality improvement | GACCAGTACAAGGACGCCT | GGG | Triticum aestivum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0101 | 30477421 | waxy | Granule鈥恇ound starch synthase I (waxy) | GACCAGTACAAGGACGCCT | GGG | Triticum aestivum L. | 0.5417 | protoplast | CRISPR-Cas9 |
| PCdb_0102 | 38925598 | LOC_Os02g39890 | taste quality | GACCAAGCTGTCCGCGTACC | GGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_0103 | 29259295 | RLP1 | a negative regulator of the sex pheromone PR-IP in the Closterium peracerosum-strigosum-littorale complex | GACATGTTCATGCCGCAGTG | GGG | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0104 | 31852823 | the maize G protein | controls shoot meristem development and immune responses | GAATTCTTACTGGACACAA | GGG | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0105 | 34905186 | not found | not found | GAATGAGAAATCAGCAATG | GGG | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | not found |
| PCdb_0106 | 30086204 | gTraPDS2 | gTraPDS2 (Guide RNA targeting phytoene desaturase 2) [Source: Benchling] | GAATCTGTTTGGAGAGCTA | GGG | Tragopogon porrifolius L. | 87%- | protoplast | CRISPR-Cas9 |
| PCdb_0107 | 30191180 | PTST | Protein Targeting to Starch (PTST) | GAATATCCTACGGTTGGCGA | GGG | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0108 | 27236699 | not found | not found | GAAGTGAGTAGCATCGAAT | GGG | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0109 | 31450868 | TRY | R3 MYB transcription factor TRIPTYCHON | GAAGTGAGCAGTATCGAAT | GGG | Arabidopsis thaliana (L.) Heynh. | 38.1-100% | seed | CRISPR-Cas9 |
| PCdb_0110 | 33768632 | BdFAR4 | Fatty acyl-CoA reductase 4 | GAAGCTCTTCCTCTTGGTCC | GGG | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0111 | 30455712 | FRI | FRI (FRIGIDA, scaffold protein for vernalization complex) [Source: UniProt] | GAAGCGAAACCTGCCTCGCA | GGG | Brassica oleracea var. capitata L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0112 | 33339449 | miR156g | MicroRNA regulating plant development and phase transition | GAAGAGAGTGAGCACACAGC | GGG | Oryza sativa L. | 0.944 | protoplast | not found |
| PCdb_0113 | 29577545 | FveTAA1 | FveTAA1 (Fragaria vesca tryptophan aminotransferase of Arabidopsis 1, auxin biosynthesis) [Source: UniProt] | GAAGACTTCACCGGACGGTT | GGG | Fragaria vesca L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0114 | 36445461 | not found | not found | GAAGAAAGGCACGGGAAGTTCC | GGG | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0115 | 31684940 | EPSPS | 5-enolpyruvylshikimate-3-phosphate synthase | GAAATAAGTATGAGATCCAT | GGG | Triticum aestivum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0116 | 37346168 | Solyc06g005330 | Tomato protein Solyc06g005330 (uncharacterized) | GAAAGAAACTTCTACGATAC | GGG | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0117 | 34213958 | LOB1 | LATERAL ORGAN BOUNDARIES 1 (transcription factor regulating lateral organ development) [Source: TAIR] | GAAAACGGAA | GGG | Vitis vinifera L. | not found | Vitis L.fruit epicotyls | CRISPR-Cas9 |
| PCdb_0118 | 26808139 | Eif4e | eIF4E cap-binding protein: translation initiation factor and virus interaction :contentReference[oaicite:4]{index=4} | GAAAACCCTAGAGGACGTGG | GGG | Cucumis sativus L. | 0.375 | cotyledon | CRISPR-Cas9 |
| PCdb_0119 | 31452351 | Glyma.15G051500 Glyma.08G180900 | Cytochrome P450 (Glyma.15G051500 & Glyma.08G180900) [Source: SoyBase] | CTTGTCATAATGTCTGGTGG | GGG | Glycine max (L.) Merr. | 0.592 | hairy root | CRISPR-Cas9 |
| PCdb_0120 | 38925598 | LOC_Os08g10560 | taste quality | CTTGGGCAATCTGTGGGCAG | GGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_0121 | 34764970 | FAD2 | Enhances Oleic Acid Production | CTTGGCTTGGCCACTCTATT | GGG | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | Base editor |
| PCdb_0122 | 38925598 | LOC_Os01g52650 | taste quality | CTTGGAGGAGGCTCTGCCAT | GGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_0123 | 31452351 | Glyma.15G234500 | Peroxidase (Glyma.15G234500) [Source: SoyBase] | CTTGCCCTTGCCCCCACCAG | GGG | Glycine max (L.) Merr. | 0.592 | hairy root | CRISPR-Cas9 |
| PCdb_0124 | 31694550 | PDS | Phytoene desaturase | CTTGAGGCAAGAGATGTGTT | GGG | Triticum aestivum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0125 | 30289378 | TYLCVCP | Tomato yellow leaf curl virus coat protein | CTTCGGCGAACCTTCGAGAC | GGG | Solanum lycopersicum L. | not found | cotyledon | CRISPR-Cas9 |
| PCdb_0126 | 29569825 | knl1 | Kinesin family member 11 (chromosome segregation) [Source: WormBase] | CTGTACAGCCTACTCAGCT | GGG | Zea mays L. | 0.66 | calli | CRISPR-Cas9 |
| PCdb_0127 | 37175730 | OsRR | Novel Salinity-Tolerant | ctgggcttctttgcagctga | GGG | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0128 | 31991936 | FWL | FWL (FW2-2-like cell number regulator, plasma membrane-associated) [Source: UniProt] | CTGAAGGACTTACAGTTTCC | GGG | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0129 | 35713092 | SBE | Starch branching enzyme (SBE, starch biosynthesis) | CTCGCTGATCGACCGAGCCCGGG | GGG | Oryza sativa L. | 1 | leaf | CRISPR-Cas9 |
| PCdb_0130 | 30272679 | APOBEC1 | Apolipoprotein B mRNA editing enzyme (cytidine deaminase), RNA-editing protein | CTATCTTAAGCACATCAGCT | GGG | Solanum tuberosum L. | 0.06 | protoplast | PBE |
| PCdb_0131 | 36660867 | OsCKX | Rice cytokinin oxidase/dehydrogenase (cytokinin catabolism enzyme) | ctagcacgttggaaatctgg | ggg | Oryza sativa L. | not found | protoplast | CRISPR-Cas9,CRISPR-Cas12 |
| PCdb_0132 | 31694550 | PDS | Phytoene desaturase | CTACAACTTGGAGGCGACGG | GGG | Triticum aestivum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0133 | 32426943 | TaBRI1 | Brassinosteroid receptor kinase BRI1 | CTAATACATGTGAGTGGCCA | GGG | Triticum aestivum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0134 | 32426943 | TaBRI1 | Brassinosteroid receptor kinase BRI1 | CTAATACATGTGAGTGGCCA | GGG | Zea mays L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0135 | 36070109 | TraesCS5A02G473800 | Wheat protein kinase (TraesCS5A02G473800, signal transduction) | CGTGCCGACGAGAGCACGGG | GGG | Triticum aestivum L. | 0.77 | leaf | not found |
| PCdb_0136 | 28066464 | DIPM | Disease-Interacting Protein Module (likely involved in plant-pathogen interactions) | CGTCGTTTCAGCTCAACCCG | GGG | Vitis vinifera L. | 0.5-6.9% | protoplast | CRISPR-Cas9 |
| PCdb_0137 | 38925598 | LOC_Os01g24880 | taste quality | CGTCGAGGCAGATCGAGCAC | GGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_0138 | 34191398 | eCDAL | Engineered cytidine deaminase-activating enzyme (likely used in base editing systems) | CGTCCTCCGCCGTGCCCGCC | GGG | Oryza sativa L. | 0.8 | calli | CBE |
| PCdb_0139 | 37248636 | OsRLCK278 | Receptor-like cytoplasmic kinase | CGTCAAGTGCCTGAACCAGC | GGG | Oryza sativa L. | not found | protoplast | not found |
| PCdb_0140 | 33557889 | Gh_A12G1590 | Gh_A12G1590 (Gossypium hirsutum lipoxygenase A12G1590) [Source: CottonGen] | CGGATTGTACAAGCGCGGGA | GGG | Gossypium hirsutum L. | 0.5889 | seed | CRISPR-Cas9 |
| PCdb_0141 | 38925598 | LOC_Os11g37270 | taste quality | CGCTCCTCCTGCTCGCCGCC | GGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_0142 | 32209971 | OsINV3 | Control Grain Size in Rice | CGCGACGATCATGGAGACCC | GGG | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0143 | 33015536 | AGO4 & NRPD1a & NRPE1 & RDR2 & RDR4 & RDR6 & CHLI1 & PIE1 | Multi-gene complex: RNA-directed DNA methylation machinery (small RNA biogenesis and chromatin modification) | CGCCGTGTTTTTTTTTGGGG | GGG | Arabidopsis thaliana (L.) Heynh. | 0.05 | seed | CRISPR-Cas9 |
| PCdb_0144 | 38925598 | LOC_Os05g38600 | taste quality | CGCCCGCGACGTGCGTCGTC | GGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_0145 | 34618074 | MIR164b | ncover their functional specialization in development | CGATCGAGATGGAGAAGCA | GGG | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0146 | 31410483 | not found | not found | CGAGGCGGCGTGCTCGCAC | GGG | Oryza sativa L. | not found | seed | CRISPR-Cas9 |
| PCdb_0147 | 38925598 | LOC_Os11g04400 | taste quality | CGAGGACGAGGCATTCCACG | GGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_0148 | 28066464 | DIPM | Disease-Interacting Protein Module (likely involved in plant-pathogen interactions) | CGAGAGCAATTCCAAGGAGC | GGG | Vitis vinifera L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0149 | 31694550 | PDS | Phytoene desaturase | CGACCTGTAATGGTTTACTG | GGG | Triticum aestivum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0150 | 30917862 | Glyma.20g148400 | Isoflavone 2'-hydroxylase (Glyma.20g148400) [Source: SoyBase] | CCTTCTGATGAGGTGGGCGT | GGG | Glycine max (L.) Merr. | 0.058 | hairy root | CRISPR-Cas9 |
| PCdb_0151 | 37346168 | Solyc02g088190 | Tomato protein Solyc02g088190 (uncharacterized) | CCTTAGCCACATGGCTCAGT | GGG | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0152 | 31035443 | not found | not found | CCTGCGATACTCCAATCTCC | GGG | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0153 | 33557889 | Gh_A03G0180 | Gh_A03G0180 (Gossypium hirsutum R2R3-MYB transcription factor, flavonoid biosynthesis) [Source: CottonGen] | CCTCTGCCCAACAAGAAGAT | GGG | Gossypium hirsutum L. | 0.5889 | seed | CRISPR-Cas9 |
| PCdb_0154 | 34191398 | eCDAL | Engineered cytidine deaminase-activating enzyme (likely used in base editing systems) | CCTCCGCCGCCGTCGCCGCG | GGG | Oryza sativa L. | 0.3 | calli | CBE |
| PCdb_0155 | 35322121 | not found | not found | CCTATAACGTGTACGTCATT | GGG | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0156 | 28049122 | CpYGFP | Yellow fluorescent protein marker (likely experimental control/reporter) | CCTAGGTACCGTTGGAGTTG | GGG | Chrysanthemum morifolium聽Ramat. | 0-33.8% | calli | CRISPR-Cas9 |
| PCdb_0157 | 38925598 | LOC_Os04g44470 | taste quality | CCGCCGGTGTACGACACGGA | GGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_0158 | 40606783 | CmACO1 | Enhance fruit shelf-life | CCCTTGATGAGGTCCGGCTT | GGG | Cucumis melo L. | not found | seed | CRISPR/Cas9 |
| PCdb_0159 | 36460630 | not found | not found | CCCTGCAGTGGCATCCAATT | GGG | Rosa hybrida E.H.L.Krause | not found | protoplast | CRISPR-Cas9 |
| PCdb_0160 | 31991936 | FWL | FWL (FW2-2-like cell number regulator, plasma membrane-associated) [Source: UniProt] | CCCGTGCATCACGTTCGGGC | GGG | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0161 | 37762662 | not found | not found | CCCGAGGCGGGGATGATCGT | GGG | Oryza sativa L. | not found | not found | CRISPR-Cas9 |
| PCdb_0162 | 30959555 | SLR1 | SLENDER RICE 1 (SLR1, gibberellin signaling) | CCCCTCGGACCTCTCCTCCT | GGG | Oryza sativa L. | 0.78 | calli | ABE |
| PCdb_0163 | 40040541 | ACS2 | 1-Aminocyclopropane-1-carboxylate synthase catalyzing the rate-limiting step in ethylene biosynthesis, regulating fruit ripening and stress responses. | CCATTTGGATAACTCCGTTG | GGG | Solanum lycopersicum L. | not found | protoplast | CRISPR/Cas9 |
| PCdb_0164 | 37983594 | SSI2 | Stearoyl-ACP desaturase 2, converts stearic acid to oleic acid (18:0鈫?8:1) | CCATTTGGACAAGAGCT | GGG | Arabidopsis thaliana (L.) Heynh. | not found | not found | CRISPR-Cas9 |
| PCdb_0165 | 38925598 | LOC_Os07g01450 | taste quality | CCATTGGTGCCGGTGAGCTA | GGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_0166 | 38925598 | LOC_Os08g25460 | taste quality | CCAGCCCAAGACCTCCCGCG | GGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_0167 | 27148303 | IR and Rep of CABs | Intergenic region and repetitive elements of chloroplast DNA [Source: NCBI] | CCACGTTCTAATATTACCGT | GGG | Gossypium hirsutum L. | not found | germplasm | CRISPR-Cas9 |
| PCdb_0168 | 31694550 | PDS | Phytoene desaturase | CATGCATTTAACAGGAGTGT | GGG | Triticum aestivum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0169 | 33557889 | Gh_A07G0469 | Gh_A07G0469 (Gossypium hirsutum MYB transcription factor, fiber development) [Source: CottonGen] | CATCTACCAGGCGTAATGAT | GGG | Gossypium hirsutum L. | 0.5889 | seed | CRISPR-Cas9 |
| PCdb_0170 | 29036337 | CLE13 | CLE-Peptide-Encoding Genes | CATCGGAAAGCTTTGCCGGC | GGG | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0171 | 38925598 | LOC_Os12g42670 | taste quality | CATCGCCCACACTCGTCGGA | GGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_0172 | 27148303 | IR and Rep of CABs | Intergenic region and repetitive elements of chloroplast DNA [Source: NCBI] | CATCCATTCCCAATATCTCT | GGG | Gossypium hirsutum L. | not found | germplasm | CRISPR-Cas9 |
| PCdb_0173 | 31782599 | ACC | Acetyl-CoA carboxylase (fatty acid biosynthesis) | CATAGCACTCAATGCGGTCT | GGG | Oryza sativa L. | 0.042 | seed | ABE |
| PCdb_0174 | 29807545 | GFP | GFP (Green Fluorescent Protein, Aequorea victoria, transformation control) [Source: Addgene] | CATAGCACTCAATGCGGTCT | GGG | Oryza sativa L. | 0.0062 | protoplast | ABE |
| PCdb_0175 | 31634585 | ACC | Acetyl-CoA carboxylase subunit (fatty acid biosynthesis) | CATAGCACTCAATGCGGTCT | GGG | Oryza sativa L. | 0.78 | calli | ABE |
| PCdb_0176 | 31469505 | OsACC1 | Acetyl-CoA carboxylase involved in fatty acid biosynthesis | CATAGCACTCAATGCGGTCT | GGG | Oryza sativa L. | 0.694 | calli | ABE |
| PCdb_0177 | 30819931 | ACC | Acetyl-CoA carboxylase, rate-limiting enzyme in fatty acid synthesis | CATAGCACTCAATGCGGTCT | GGG | Oryza sativa L. | 0.222 | calli | ABE |
| PCdb_0178 | 34328250 | not found | not found | cagtacaaacaactgtatca | ggg | Oryza sativa L. | not found | protoplast | not found |
| PCdb_0179 | 31694550 | PDS | Phytoene desaturase | CAGGCTCTCCTGGCTCCTGC | GGG | Triticum aestivum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0180 | 37248636 | OsRLCK218 | Receptor-like cytoplasmic kinase | CAGGAGCTGTCGGACGAGAG | GGG | Oryza sativa L. | not found | protoplast | not found |
| PCdb_0181 | 31452351 | Glyma.08G126200 Glyma.05G167800 | Peroxidase (Glyma.08G126200 & Glyma.05G167800) [Source: SoyBase] | CAGCTTTGGAAGAGATTCAG | GGG | Glycine max (L.) Merr. | 0.592 | hairy root | CRISPR-Cas9 |
| PCdb_0182 | 38925598 | LOC_Os01g12580 | taste quality | CAGCTGGTGGACAAGGCGAA | GGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_0183 | 36402381 | BnHOS1 | High expression of osmotically responsive genes 1, negative regulator of cold signaling | CAGAGTACAGTCAAGACATA | ggg | Brassica napus L. | not found | Nuclear Pore | CRISPR-Cas9 |
| PCdb_0184 | 31452351 | Glyma.01G239700 | Auxin response factor (Glyma.01G239700) [Source: SoyBase] | CACTGGAAGTAGGAATTGGG | GGG | Glycine max (L.) Merr. | 0.592 | hairy root | CRISPR-Cas9 |
| PCdb_0185 | 32854250 | OsBHY, OsEHY, OsWaxy | Rice beta-hydroxyacyl-ACP dehydratase, enoyl-ACP reductase, and granule-bound starch synthase (three enzymes involved in fatty acid and starch biosynthesis) | CACGTTCGCGTTGTCGGTGG | GGG | Oryza sativa L. | 1 | protoplast | CRISPR-Cas9 |
| PCdb_0186 | 33916717 | CENH3 | Centromere-specific histone H3 variant, essential for kinetochore assembly and chromosome segregation | CACGTCGACTTGGAGGGAAA | GGG | Cannabis sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0187 | 36304716 | not found | not found | CACGAGCTCGACCTTCTCCA | GGG | Oryza sativa L. | not found | protoplast | not found |
| PCdb_0188 | 33346897 | Pp3c3_23790V1.1 (PHY5a) | Physcomitrella phytochrome 5a (Pp3c3_23790V1.1, light sensing) | CACAAGCTGTACCGAGTGTG | GGG | Physcomitrella patens (Hedw.) Bruch & Schimp. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0189 | 33594101 | MAX1 | Strigolactone biosynthesis monooxygenase | CAAGTTCTCAAAAGAATCCC | GGG | Solanum lycopersicum L. | 0.643 | seed | CRISPR-Cas9 |
| PCdb_0190 | 38925598 | LOC_Os01g58670 | taste quality | CAAGCGAATGCCGATAGTGA | GGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_0191 | 33570447 | TRE1 | Plant drought tolerance provided | C TAT TAC TGG GAT TCT TAT T | GGG | Zea mays L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0192 | 33015536 | AGO4 & NRPD1a & NRPE1 & RDR2 & RDR4 & RDR6 & CHLI1 & PIE1 | Multi-gene complex: RNA-directed DNA methylation machinery (small RNA biogenesis and chromatin modification) | ATTTTGTCAACCCGAAGTGG | GGG | Arabidopsis thaliana (L.) Heynh. | 0.89 | seed | CRISPR-Cas9 |
| PCdb_0193 | 33015536 | AGO4 & NRPD1a & NRPE1 & RDR2 & RDR4 & RDR6 & CHLI1 & PIE1 | Multi-gene complex: RNA-directed DNA methylation machinery (small RNA biogenesis and chromatin modification) | ATTTTGTCAACCCGAAGTGG | GGG | Arabidopsis thaliana (L.) Heynh. | 0.46 | seed | CRISPR-Cas9 |
| PCdb_0194 | 33015536 | AGO4 & NRPD1a & NRPE1 & RDR2 & RDR4 & RDR6 & CHLI1 & PIE1 | Multi-gene complex: RNA-directed DNA methylation machinery (small RNA biogenesis and chromatin modification) | ATTTTGTCAACCCGAAGTGG | GGG | Arabidopsis thaliana (L.) Heynh. | 0.4 | seed | CRISPR-Cas9 |
| PCdb_0195 | 33015536 | AGO4 & NRPD1a & NRPE1 & RDR2 & RDR4 & RDR6 & CHLI1 & PIE1 | Multi-gene complex: RNA-directed DNA methylation machinery (small RNA biogenesis and chromatin modification) | ATTTTGTCAACCCGAAGTGG | GGG | Arabidopsis thaliana (L.) Heynh. | 0.4 | seed | CRISPR-Cas9 |
| PCdb_0196 | 32190101 | NaEAH1 | Ethanolamine ammonia-lyase 1 (lipid metabolism) [Source: UniProt] | ATTTGGGCAAGTACTCAAG | GGG | Nicotiana rustica L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0197 | 29807545 | GFP | GFP (Green Fluorescent Protein, Aequorea victoria, transformation control) [Source: Addgene] | ATTTCAAATGGATCTAAACA | GGG | Oryza sativa L. | 0.0025 | protoplast | ABE |
| PCdb_0198 | 33557889 | Gh_A06G1509 | Gh_A06G1509 (Gossypium hirsutum chitinase, pathogenesis-related) [Source: CottonGen] | ATTGGTGCCTGACCCCCTAG | GGG | Gossypium hirsutum L. | 0.5889 | seed | CRISPR-Cas9 |
| PCdb_0199 | 35713092 | SBE | Starch branching enzyme (SBE, starch biosynthesis) | ATTGAGGAAAATGACTGA | GGG | Oryza sativa L. | 1 | leaf | CRISPR-Cas9 |
| PCdb_0200 | 33557889 | Gh_A03G1792 | Gh_A03G1792 (Gossypium hirsutum calcium-dependent protein kinase, CDPK) [Source: CottonGen] | ATTCTTCATATTCAGCCAGG | GGG | Gossypium hirsutum L. | 0.5889 | seed | CRISPR-Cas9 |
| PCdb_0201 | 35114063 | Ghir_D02G025140 | Ghir_D02G025140 (Gossypium hirsutum MYB transcription factor D02G025140) [Source: CottonGen] | ATTATGGAGCAGACCCAACG | GGG | Gossypium hirsutum L. | not found | microspore,male gametophyte,pollen,POLLEN,tapetum,anthers | CRISPR-Cas9 |
| PCdb_0202 | 33557889 | Gh_A10G0024 | Gh_A10G0024 (Gossypium hirsutum bZIP transcription factor A10G0024) [Source: CottonGen] | ATGTTAGTCCACCGGACTGA | GGG | Gossypium hirsutum L. | 0.5889 | seed | CRISPR-Cas9 |
| PCdb_0203 | 30610631 | not found | not found | ATGGCTCACGAGATGAT | GGG | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0204 | 31273916 | NbPDS | Nicotiana benthamiana phytoene desaturase | ATGGAGTCGCTACTACCAAA | GGG | Triticum aestivum L. | 48-78% | protoplast | CRISPR-Cas9 |
| PCdb_0205 | 26269544 | MS26 | Male sterility protein 26 (tapetum development) [Source: MaizeGDB] | ATGAGCTACCCCGCCTACCTCATG | ggg | Zea mays L. | not found | embryo | CRISPR-Cas9 |
| PCdb_0206 | 37097722 | R2R3-MYB | Purple Rehmannia: Investigation of the activation of R2R3-MYB transcription factors involved in anthocyanin biosynthesis. | ATGAATGCATGCGTTGGTG | GGG | Arabidopsis thaliana (L.) Heynh. | not found | whole plants,plants,corolla | CRISPR-Cas9 |
| PCdb_0207 | 34042262 | OsALS | Acetolactate synthase | ATCTCCATGGACGCGCCGCCC | GGG | Oryza sativa L. | 0.005 | protoplast | CBE |
| PCdb_0208 | 31991936 | FWL | FWL (FW2-2-like cell number regulator, plasma membrane-associated) [Source: UniProt] | ATCGCGGAGATCGTCGACCG | GGG | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0209 | 33015536 | AGO4 & NRPD1a & NRPE1 & RDR2 & RDR4 & RDR6 & CHLI1 & PIE1 | Multi-gene complex: RNA-directed DNA methylation machinery (small RNA biogenesis and chromatin modification) | ATCGAGGTTAGAGTTCCCAC | GGG | Arabidopsis thaliana (L.) Heynh. | 0.46 | seed | CRISPR-Cas9 |
| PCdb_0210 | 37324668 | HT-B | enhanced self-fertility in diploid Solanum tuberosum | ATCATCAGAAGTTATTGCAA | GGG | Solanum tuberosum L. | not found | pollen tube,fruit,ovary | CRISPR-Cas9 |
| PCdb_0211 | 30725309 | TH 1 | Tiller height 1 (TH1, plant architecture) | ATCACATGATGTCGGGCGGC | GGG | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0212 | 28605576 | GW2 | E3 ubiquitin ligase regulating grain width (GW2) | ATCAAAGTGTTGCTCAAAA | GGG | Oryza sativa L. | 0.4432 | protoplast | CRISPR-Cas9 |
| PCdb_0213 | 31109137 | SNF | symbiotic nitrogen fixation | ATAAGCAGAAATAGTCTCTG | GGG | Vigna unguiculata (L.) Walp. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0214 | 37346168 | Solyc01g079620 | Tomato protein Solyc01g079620 (uncharacterized) | ATAAAGTTACATGCAACTTT | GGG | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0215 | 30928637 | OsDEP1 | Oryza sativa Dense and Erect Panicle 1 (OsDEP1, panicle architecture) | AGTTTGCTCGCAGGTTCTGA | GGG | Oryza sativa L. | not found | protoplast | xCas9 |
| PCdb_0216 | 30928637 | OsDEP1 | Oryza sativa Dense and Erect Panicle 1 (OsDEP1, panicle architecture) | AGTTTGCTCGCAGGTTCTGA | GGG | Oryza sativa L. | not found | protoplast | xCas9 |
| PCdb_0217 | 38679667 | OsGS2 | Chloroplastic glutamine synthetase 2 catalyzing ammonia assimilation during photorespiration and nitrogen remobilization in rice. | AGTTGGTGATTATCTGTAGG | GGG | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0218 | 37324705 | OsOLP1 | regulating ABA biosynthesis and lignin accumulation | AGTTGCCGGCCCTCGTGC | GGG | Oryza sativa L. | not found | plants,stomatal,plant | CRISPR-Cas9 |
| PCdb_0219 | 31694550 | PDS | Phytoene desaturase | AGTGCTTCACTGTTCCGTCA | GGG | Triticum aestivum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0220 | 28790350 | BnaRGA | DELLA protein RGA homolog | AGTGAGCGAACTTGAGGTAA | GGG | Brassica napus L. | BnaA9.RGA:96.6%, BnaC9.RGA:86.2%, BnaA6.RGA:96.6%, BnaC7.RGA:93.1% | protoplast | CRISPR-Cas9 |
| PCdb_0221 | 33557889 | Gh_A05G3926 | Gh_A05G3926 (Gossypium hirsutum NAC transcription factor, stress response) [Source: CottonGen] | AGTCGATCGCCGTGTCGTGA | GGG | Gossypium hirsutum L. | 0.5889 | seed | CRISPR-Cas9 |
| PCdb_0222 | 37346168 | Solyc04g078420 | Tomato protein Solyc04g078420 (uncharacterized) | AGTCCGACCCGATAACAAAC | GGG | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0223 | 35898225 | CYP81Q1 | Sesamin synthase (CYP81Q1) | AGTCCGAAGACAACTGGCCG | GGG | Sesamum indicum L. | 0.9063 | protoplast | CRISPR-Cas9 |
| PCdb_0224 | 32841372 | BnALC | regulates seed production | AGGTTGAGCTGTGGGAGTAC | GGG | Brassica napus L. | not found | seed | CRISPR-Cas9 |
| PCdb_0225 | 32782475 | BELL15 | BEL1-like homeodomain protein 15, involved in plant development and differentiation | AGGTTCGACATACTAGGAAC | GGG | Populus sp. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0226 | 25392068 | CDKB2 | Cyclin-dependent kinase B2, regulates cell cycle progression (G2/M transition) | AGGTCGGGGAGGGGACGTAC | GGG | Oryza sativa L. | not found | calli | not found |
| PCdb_0227 | 39725167 | GhFT | Prolongs indeterminate growth and alters plant architecture | AGGGTCACTTATGCTACTA | GGG | Gossypium spp. | not found | seed | CRISPR/Cas9 |
| PCdb_0228 | 31694550 | PDS | Phytoene desaturase | AGGGCGCCGGCAAAGTCTCT | GGG | Triticum aestivum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0229 | 32311214 | GmFT2a | Flowering promoter FT homolog GmFT2a | AGGGATCCTCTCGTTGTTGG | ggg | Glycine max (L.) Merr. | not found | protoplast | CRISPR-Cas9,Base editor |
| PCdb_0230 | 33557889 | Gh_A06G2107 | Gh_A06G2107 (Gossypium hirsutum expansin-like protein, cell wall modification) [Source: CottonGen] | AGGCCCATTGAATTCCTCTG | GGG | Gossypium hirsutum L. | 0.5889 | seed | CRISPR-Cas9 |
| PCdb_0231 | 33557889 | Gh_A05G3926 | Gh_A05G3926 (Gossypium hirsutum NAC transcription factor, stress response) [Source: CottonGen] | AGGATTCACTTCGCCAGACA | GGG | Gossypium hirsutum L. | 0.5889 | seed | CRISPR-Cas9 |
| PCdb_0232 | 33449143 | not found | not found | AGCTTTGTGGCTTGAGTTGG | GGG | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0233 | 35371150 | SlNAC063 | Aluminum Tolerance | AGCTCTGGGAACTTCGATT | GGG | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0234 | 31694550 | PDS | Phytoene desaturase | AGCTACAACTTGGAGGCGAC | GGG | Triticum aestivum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0235 | 33193477 | lox3 | Lipoxygenase 3 (oxylipin metabolism) [Source: TAIR] | AGCGAGTTCCTCGGCAAGG | GGG | Zea mays L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0236 | 30466580 | LAP6 | functional conservation between rice and Arabidopsis | AGCAGGAGCCAATGCTCCAG | GGG | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0237 | 34160845 | Ne 2 | Necrosis gene 2 (plant defense response) | AGCAGCTAGGCGATAAGCTT | GGG | Triticum aestivum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0238 | 31694550 | PDS | Phytoene desaturase | AGCACTTTGCACTTACTGAT | GGG | Triticum aestivum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0239 | 31932727 | OsCDC48 | Rice cell division control protein 48 (AAA+ ATPase involved in protein degradation and cell cycle regulation) | AGCACCCATGACAATGACAT | GGG | Oryza sativa L. | 0.46 | calli | ABE |
| PCdb_0240 | 31932727 | OsCDC48 | Rice cell division control protein 48 (AAA+ ATPase involved in protein degradation and cell cycle regulation) | AGCACCCATGACAATGACAT | GGG | Oryza sativa L. | 0.21 | calli | ABE |
| PCdb_0241 | 31932727 | OsCDC48 | Rice cell division control protein 48 (AAA+ ATPase involved in protein degradation and cell cycle regulation) | AGCACCCATGACAATGACAT | GGG | Oryza sativa L. | 0.019 | calli | ABE |
| PCdb_0242 | 31932727 | OsCDC48 | Rice cell division control protein 48 (AAA+ ATPase involved in protein degradation and cell cycle regulation) | AGCACCCATGACAATGACAT | GGG | Oryza sativa L. | 0.001 | calli | ABE |
| PCdb_0243 | 36070109 | TraesCS5A02G473800 | Wheat protein kinase (TraesCS5A02G473800, signal transduction) | AGCACAGGGCGTACGGCCGG | GGG | Triticum aestivum L. | 0.77 | leaf | not found |
| PCdb_0244 | 27148303 | Rep-A of alphasatellite | Alphasatellite replication-associated protein (Rep-A, viral replication) | AGATGACCGCACTATCTTCT | GGG | Gossypium hirsutum L. | not found | germplasm | CRISPR-Cas9 |
| PCdb_0245 | 36418022 | OsNRAMP5 | a Major Transporter for Lead Uptake in Rice | AGAGAGAGAGCAGAGA | GGG | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0246 | 29807545 | GFP | GFP (Green Fluorescent Protein, Aequorea victoria, transformation control) [Source: Addgene] | AGACAAGCTTGGCCCTCTTT | GGG | Oryza sativa L. | 0.0002 | protoplast | ABE |
| PCdb_0247 | 37175730 | OsRR | Novel Salinity-Tolerant | agacaaagactgtgatgaag | GGG | Oryza sativa L. | not found | protoplast | not found |
| PCdb_0248 | 39942907 | OsPHS3 | 伪-Glucan water dikinase involved in starch phosphorylation and mobilization during rice seed germination. | AGAAGTACGTCATCCCCGG | GGG | Oryza sativa L. | not found | seed | CRISPR/Cas9 |
| PCdb_0249 | 31694550 | PDS | Phytoene desaturase | AGAAGGTGAAGTTTGCTATT | GGG | Triticum aestivum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0250 | 32448919 | BnaFAD2 | Fatty acid desaturase 2 | ACTTAGCCTTCAACGTCTCG | GGG | Brassica napus L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0251 | 38925598 | LOC_Os08g28980 | taste quality | ACTGGAGCTGCGCCCAGTTA | GGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_0252 | 31694550 | PDS | Phytoene desaturase | ACTGCATGGATAACTCGTCA | GGG | Triticum aestivum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0253 | 32508867 | not found | not found | ACTGCAGTGCGTGCTGCGCT | GGG | Oryza sativa L. | not found | calli | CRISPR-Cas9 |
| PCdb_0254 | 27936512 | CsLOB1 | Lateral Organ Boundaries (LOB) domain protein; regulator of citrus canker susceptibility. | ACTATAGGCGGCGGAGAGAG | GGG | Citrus 脳 sinensis (L.) Osbeck | 0.3158 | protoplast | CRISPR-Cas9 |
| PCdb_0255 | 39348559 | BnaA02 | Brassica napus gene located on chromosome A02; function context-dependent and varies by specific locus. | ACTACGCCCTCTGCTGTTAA | GGG | Brassica napus L. | not found | hypocotyl | CRISPR/Cas9 |
| PCdb_0256 | 34608972 | GL2 | GLABRA2 transcription factor | ACGTCCGAAGTACGAGGCT | GGG | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0257 | 38925598 | LOC_Os01g72210 | taste quality | ACGGTATCCAATGTGGCAAG | GGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_0258 | 28066464 | DIPM | Disease-Interacting Protein Module (likely involved in plant-pathogen interactions) | ACGATCGCAACGATTGCGCC | GGG | Vitis vinifera L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0259 | 31694550 | PDS | Phytoene desaturase | ACGACCTGTAATGGTTTACT | GGG | Triticum aestivum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0260 | 38925598 | LOC_Os02g34320 | taste quality | ACGAATGCTCCTAACAACCA | GGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_0261 | 33217139 | OsBADH2 | facilitates development of fragrant rice | ACCTCCGCGCAATCGCGGCCAAGGTA | GGG | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0262 | 30157762 | not found | Gene not detected or not annotated in the database | ACCTACTACCTCGCCGGGCC | GGG | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0263 | 33152517 | APOBEC3A | the APOBEC family of cytidine deaminases | ACCCCCCCACAGGCTCGCGA | GGG | Oryza sativa L. | 0.688 | protoplast | CBE |
| PCdb_0264 | 33557889 | Gh_A11G2112 | Gh_A11G2112 (Gossypium hirsutum DREB transcription factor A11G2112) [Source: CottonGen] | ACCAAACGCAAGAGCGACAA | GGG | Gossypium hirsutum L. | 0.5889 | seed | CRISPR-Cas9 |
| PCdb_0265 | 37346168 | Solyc02g067340 | Tomato protein Solyc02g067340 (uncharacterized) | ACATGGTCCAGGCAATTGGA | GGG | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0266 | 37346168 | Solyc01g009070 | Tomato protein Solyc01g009070 (uncharacterized) | ACATCTTCCGCAGAAGTCCA | GGG | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0267 | 36814841 | OsFTL1 | Flowering locus T-like protein 1 | ACATCTTCAAGATCACTAGT | ggg | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0268 | 38925598 | LOC_Os11g31330 | taste quality | ACATCGGTGATGATCGCACA | GGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_0269 | 31694550 | PDS | Phytoene desaturase | ACAGTTATTTAATCAGCACA | GGG | Triticum aestivum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0270 | 35055026 | Ara h 2 | Ara h 2 allergen, major peanut allergen protein | acaggagcaacagttcaaga | ggg | Arachis hypogaea L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0271 | 36374358 | LFY | LEAFY (floral meristem identity transcription factor) [Source: TAIR] | ACAGATTGACAATTACTTCT | GGG | Solanum tuberosum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0272 | 30096237 | SlCBF1 | C-repeat binding factor 1 | ACACGGCATCCGATATACAG | GGG | Solanum lycopersicum L. | 0.575 | leaf | CRISPR-Cas9 |
| PCdb_0273 | 29807545 | GFP | GFP (Green Fluorescent Protein, Aequorea victoria, transformation control) [Source: Addgene] | ACACACACACTAGTACCTCT | GGG | Oryza sativa L. | 0.0086 | protoplast | ABE |
| PCdb_0274 | 33557889 | Gh_A03G1115 | Gh_A03G1115 (Gossypium hirsutum auxin efflux carrier PIN1) [Source: CottonGen] | AATGGGGCTTTATCTCCTGT | GGG | Gossypium hirsutum L. | 0.5889 | seed | CRISPR-Cas9 |
| PCdb_0275 | 33557889 | Gh_A04G1202 | Gh_A04G1202 (Gossypium hirsutum xyloglucan endotransglucosylase/hydrolase, XTH) [Source: CottonGen] | AATGGGGCTCAATCTCCTGT | GGG | Gossypium hirsutum L. | 0.5889 | seed | CRISPR-Cas9 |
| PCdb_0276 | 31694550 | PDS | Phytoene desaturase | AATGCTCTCTCCGTTGTATT | GGG | Triticum aestivum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0277 | 31109137 | SNF | symbiotic nitrogen fixation | AATCTCAATTTCCAAGTCCT | GGG | Vigna unguiculata (L.) Walp. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0278 | 38925598 | LOC_Os07g41290 | taste quality | AATCAGCAGGAGGGTCACTA | GGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_0279 | 37621889 | P450 | exhibit different roles in triterpenoid biosynthesis in Lotus japonicus | AATAATAACGAGGCTGTAAACGAG | GGG | Lotus japonicus (Regel) K.Larsen | not found | not found | CRISPR-Cas9 |
| PCdb_0280 | 28527115 | not found | not found | AATAAGCCCTCTCCCGTTTC | ggg | Gossypium hirsutum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0281 | 29332168 | F3H | Flavanone 3-hydroxylase | AAGTTTTGTCAGAGGCCAT | GGG | Daucus carota subsp. sativus (Hoffm.) Sch眉bl. & G.Martens | 0.9 | callus | CRISPR-Cas9 |
| PCdb_0282 | 38925598 | LOC_Os05g39690 | taste quality | AAGTGCCTAACCCAACTGCA | GGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_0283 | 28066464 | DIPM | Disease-Interacting Protein Module (likely involved in plant-pathogen interactions) | AAGGTGTACGCGAACAGCGG | GGG | Vitis vinifera L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0284 | 32841372 | BnTT8 | regulates seed production | AAGGCGGTGGTGCAATCTGT | GGG | Brassica napus L. | not found | seed | CRISPR-Cas9 |
| PCdb_0285 | 31637846 | BnTT8 | TT8 bHLH transcription factor homolog | AAGGCGGTGGTGCAATCTGT | GGG | Brassica napus L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0286 | 32167662 | LOB1 | LATERAL ORGAN BOUNDARIES 1 (transcription factor regulating lateral organ development) [Source: TAIR] | AAGGCAAAAGGGGTTTATA | GGG | Citrus 脳 sinensis (L.) Osbeck | not found | leaf | CRISPR-Cas9 |
| PCdb_0287 | 34618139 | SolyA7 | Tomato allergen SolyA7 (pollen protein) | AAGATCTCAGCGCGATGGTT | GGG | Solanum lycopersicum L. | 0.03 | protoplast | Base editor |
| PCdb_0288 | 34768819 | AT5G46510 | Arabidopsis peroxidase (AT5G46510, oxidative stress response) | AAGAGTAGAGAAACTTACAA | GGG | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0289 | 34768819 | ACQOS | Acquired resistance QTL os1 (disease resistance) | AAGAGTAGAGAAACTTACAA | GGG | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0290 | 31452351 | Glyma.20g040500 | Lipoxygenase (Glyma.20g040500) [Source: SoyBase] | AAGACCCTAATTTTGCACAA | GGG | Glycine max (L.) Merr. | 0.592 | hairy root | CRISPR-Cas9 |
| PCdb_0291 | 30157762 | not found | Gene not detected or not annotated in the database | AAGAACCTCACTTTTCCAAT | GGG | Oryza sativa L. | not found | protoplast | not found |
| PCdb_0292 | 30928637 | OsDEP1 | Oryza sativa Dense and Erect Panicle 1 (OsDEP1, panicle architecture) | AACGCAGCCGCCGCCGCCGC | GGG | Oryza sativa L. | not found | protoplast | xCas9 |
| PCdb_0293 | 30928637 | OsDEP1 | Oryza sativa Dense and Erect Panicle 1 (OsDEP1, panicle architecture) | AACGCAGCCGCCGCCGCCGC | GGG | Oryza sativa L. | not found | protoplast | xCas9 |
| PCdb_0294 | 38925598 | LOC_Os04g13480 | taste quality | AACCCAAGGATCCAACCTGA | GGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_0295 | 38925598 | LOC_Os07g39020 | taste quality | AACAATGCCAAGCACTGCAA | GGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_0296 | 31694550 | PDS | Phytoene desaturase | AAATACTTGGCTTCCATGGA | GGG | Triticum aestivum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0297 | 39001586 | Bs5 and Bs5L | Resistance against Xanthomonas | AAAGATGCATACCCACCACCA | GGG | Solanum lycopersicum L. | not found | protoplast | CRISPR/Cas9 |
| PCdb_0298 | 39001586 | Bs5 and Bs5L | Resistance against Xanthomonas | AAAGATGCATACCCACCACCA | GGG | Solanum lycopersicum L. | not found | protoplast | CRISPR/Cas9 |
| PCdb_0299 | 32167662 | LOB1 | LATERAL ORGAN BOUNDARIES 1 (transcription factor regulating lateral organ development) [Source: TAIR] | AAACAAAGTTAAGGCAAAAG | GGG | Citrus 脳 sinensis (L.) Osbeck | not found | leaf | CRISPR-Cas9 |
| PCdb_0300 | 27618611 | EPSPS | 5-enolpyruvylshikimate-3-phosphate synthase | aaaatatgtgtatggaattcat | ggg | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0301 | 31694550 | PDS | Phytoene desaturase | AAAAGGCTGGATAAGTTGGT | GGG | Triticum aestivum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0302 | 31998338 | StPPO2 | Potato polyphenol oxidase 2 (StPPO2, enzymatic browning) | AAAAGCTACATTGTGCACTG | GGG | Solanum tuberosum L. | 0.68 | potato protoplasts | not found |
| PCdb_0303 | 35410430 | Sb-Kaf | during rapid de novo shoot regeneration | TTATATAGTCATTGGGAGAA | GGG | Hemisorghum C.E.Hubb. ex Bor | not found | embryo | CRISPR-Cas9 |
| PCdb_0304 | 38034555 | CENH3 | Centromere-specific histone H3 variant, essential for kinetochore assembly and chromosome segregation | GTGTCTAAATCCGGA CCA | GGG | Zea mays L. | not found | not found | Base editor |
| PCdb_0305 | 26842991 | FGS | FGS (Arabidopsis thaliana FATTY ACID ELONGASE48, very-long-chain fatty acid biosynthesis) [Source: TAIR] | GGGGTGGAGACGACTTCCAT | GGG | Zea mays L. | 0.1214 | protoplast | CRISPR-Cas9 |
| PCdb_0306 | 26842991 | FGS | FGS (Arabidopsis thaliana FATTY ACID ELONGASE27, very-long-chain fatty acid biosynthesis) [Source: TAIR] | GGAGGTCGACCTGCACGCGC | GGG | Zea mays L. | 0.147 | protoplast | CRISPR-Cas9 |
| PCdb_0307 | 26842991 | FGS | FGS (Arabidopsis thaliana FATTY ACID ELONGASE24, very-long-chain fatty acid biosynthesis) [Source: TAIR] | GCCGACGAGGACGAAGTCGA | GGG | Zea mays L. | 0.0417 | protoplast | CRISPR-Cas9 |
| PCdb_0308 | 29036337 | CLE2 | CLE-Peptide-Encoding Genes | ATCAAGCTGCGGGTAGCCAT | GGG | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0309 | 33324433 | TaPDS | Phytoene desaturase | AGAGATTTTAGATTGTGCG | GGG | Triticum aestivum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0310 | 36448213 | Vinv | Vacuolar invertase (Vinv, sugar metabolism) | GGACACATCATATAAC | GGCC | Solanum tuberosum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0311 | 30928637 | OsPDS | Oryza sativa phytoene desaturase (OsPDS, carotenoid biosynthesis) | TTGAGCTTCAACATAAGCTT | GGC | Oryza sativa L. | not found | protoplast | xCas9 |
| PCdb_0312 | 30928637 | OsPDS | Oryza sativa phytoene desaturase (OsPDS, carotenoid biosynthesis) | tgacaacataaaagctccat | GGC | Oryza sativa L. | not found | protoplast | xCas9 |
| PCdb_0313 | 34204013 | SRFR1 | Conserved Opposite Functions in Plant Resistance to Biotrophic and Necrotrophic Pathogens | TCGCAAAACGATATCAGTTA | GGC | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0314 | 34713242 | OsMPK5 | Oryza sativa mitogen-activated protein kinase 5 (OsMPK5, stress signaling) | TCAGGCCGACGATGACGCAC | GGC | Oryza sativa L. | not found | calli | CRISPR-xCas9 |
| PCdb_0315 | 31932727 | OsODEV | Oryza sativa ODEV transcription factor (OsODEV, chloroplast development) | TCACTACTGGCTGAAGAGAG | GGC | Oryza sativa L. | 0.2 | calli | ABE |
| PCdb_0316 | 31932727 | OsODEV | Oryza sativa ODEV transcription factor (OsODEV, chloroplast development) | TCACTACTGGCTGAAGAGAG | GGC | Oryza sativa L. | 0.08 | calli | ABE |
| PCdb_0317 | 33397431 | OsCOI2 | Coronatine insensitive 2 (jasmonate signaling) | GTCGACCCTGCACCAGTGGC | GGC | Oryza sativa L. | 0.02 | calli | ABE |
| PCdb_0318 | 34984801 | OsSPL7 | Squamosa promoter-binding-like 7 | GGGAAGAGGAAGGAGAAGGC | GGC | Oryza sativa L. | not found | protoplast | CRISPR-Cas9,Base editor |
| PCdb_0319 | 33419060 | HOS1 | Reveals Its Role in the Regulation of Secondary Metabolism | GCTCTAGCTATAGAAGAA | GGC | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0320 | 34204013 | SRFR1 | Conserved Opposite Functions in Plant Resistance to Biotrophic and Necrotrophic Pathogens | CGCTACCGCAGCTTTCAATG | GGC | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0321 | 26269544 | MS26 | Male sterility protein 26 (tapetum development) [Source: MaizeGDB] | CGCCCTACCACTGCATGCACG | ggc | Zea mays L. | not found | embryo | CRISPR-Cas9 |
| PCdb_0322 | 26269544 | MS45 | Male sterility protein 45 (pollen wall development) [Source: MaizeGDB] | CACTTCGTGCTCGAGCGCGG | ggc | Zea mays L. | not found | embryo | CRISPR-Cas9 |
| PCdb_0323 | 30928637 | OsPDS | Oryza sativa phytoene desaturase (OsPDS, carotenoid biosynthesis) | CAAACCGGCTGAATTCTCCT | GGC | Oryza sativa L. | not found | protoplast | xCas9 |
| PCdb_0324 | 26294043 | ALS | Acetolactate synthase (branched-chain amino acid biosynthesis) | ATGCATGTTCATGTTCCCTG | GGC | Glycine max (L.) Merr. | 0.76 | protoplast | CRISPR-Cas9 |
| PCdb_0325 | 31882637 | not found | Gene not detected or not annotated in the database | AGCCTCCGAGCCACGAGATG | GgC | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0326 | 34713242 | OsMPK5 | Oryza sativa mitogen-activated protein kinase 5 (OsMPK5, stress signaling) | AGCCGCCCATCATGCCCATT | GGC | Oryza sativa L. | 0.3 | calli | CRISPR-xCas9 |
| PCdb_0327 | 28289885 | TTG1 | TRANSPARENT TESTA GLABRA 1 (TTG1, trichome development) | AGAGAAGAGAAAGCCAT | GGC | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0328 | 35089385 | not found | not found | ACCGAGAAGCACTCTAAGCA | GGC | Daucus carota subsp. sativus (Hoffm.) Sch眉bl. & G.Martens | 0.119 | protoplast | CRISPR-Cas9 |
| PCdb_0329 | 38034555 | CENH3 | Centromere-specific histone H3 variant, essential for kinetochore assembly and chromosome segregation | ACCGA GAAGCACTCTAA GCA | GGC | Daucus carota subsp. sativus (Hoffm.) Sch眉bl. & G.Martens | not found | not found | Base editor |
| PCdb_0330 | 29188477 | PDS | Phytoene desaturase (PDS, carotenoid biosynthesis) | AATGATCGCTTGCAATGGAAGG | GGC | Musa acuminata Colla | 0.59 | mmature male flower buds | CRISPR-Cas9 |
| PCdb_0331 | 30928637 | OsPDS | Oryza sativa phytoene desaturase (OsPDS, carotenoid biosynthesis) | AAACCGGCTGAATTCTCCT | GGC | Oryza sativa L. | not found | protoplast | xCas9 |
| PCdb_0332 | 36009753 | C4H | Cinnamate 4-hydroxylase, key enzyme in phenylpropanoid pathway for lignin/flavonoid biosynthesis | AAACCCATAAGATAAGAAAGTGTGA | GGC | Nicotiana tabacum L. | not found | protoplast | not found |
| PCdb_0333 | 30051586 | OsSPL17 | SQUAMOSA promoter binding protein-like 17, regulates leaf angle and plant architecture. | ACAGAAGAGAGAGAGCACAGC | GGAGT | Oryza sativa L. | 0.45 | leaf | ABE |
| PCdb_0334 | 35838067 | MYC1 | a dual role in the regulation of constitutive and stress-inducible specialized metabolism | TTAGCTCACCACACAACACGTG | GGA | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0335 | 32786122 | Ms26 | Pollen-specific cytochrome P450 fatty acid -hydroxylase (Ms26) | TGTAGCGCCTGGGCCACTTA | GGA | Setaria viridis (L.) P. Beauv. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0336 | 34984801 | OsSPL4 | Squamosa promoter-binding-like 4 | TCAGAAGAAGAGGAGCTGCA | GGA | Oryza sativa L. | not found | protoplast | CRISPR-Cas9,Base editor |
| PCdb_0337 | 33419060 | HOS1 | Reveals Its Role in the Regulation of Secondary Metabolism | TAGACATCTTCATGG | GGA | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0338 | 36643290 | GhPDS | GhPDS (Gossypium hirsutum phytoene desaturase) [Source: CottonGen] | TACTAGTAGATGAGAAATCG | GGA | Gossypium hirsutum L. | 0.3 | hairy root | CRISPR-Cas9 |
| PCdb_0339 | 30928637 | OsPDS | Oryza sativa phytoene desaturase (OsPDS, carotenoid biosynthesis) | gtgagatcatatgcagcgct | GGA | Oryza sativa L. | not found | protoplast | xCas9 |
| PCdb_0340 | 31932727 | OsDEP1 | Oryza sativa Dense and Erect Panicle 1 (OsDEP1, panicle architecture) | GTGAAGCTCATCCTACAAAA | GGA | Oryza sativa L. | 0.26 | calli | ABE |
| PCdb_0341 | 32936726 | HSFA6B | offers ABA and osmotic stress insensitivity | GGGGAACAGGAACTACGAGG | GGA | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0342 | 36312444 | NARK | Nodulation autoregulation receptor kinase (symbiotic nodulation) [Source: UniProt] | GGAGAGTTTGGAGACGGGGT | GGA | Glycine max (L.) Merr. | not found | hairy root | CRISPR-Cas9 |
| PCdb_0343 | 26837606 | PDS | Phytoene desaturase (PDS, carotenoid biosynthesis) | GGACTCTCTGAAACGTACGG | GGA | Petunia hybrida (Hook.) E. Vilm. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0344 | 27097775 | SlPIF4 | Phytochrome-interacting factor 4 homolog | GGAACGTTCTCGAAGAAGGAGTG | GGA | Solanum lycopersicum L. | 0.84 | seed | CRISPR-Cas9 |
| PCdb_0345 | 28049122 | CpYGFP | Yellow fluorescent protein marker (likely experimental control/reporter) | GCTCTAACTCTACTTCTGA | GGA | Chrysanthemum morifolium聽Ramat. | 0-33.8% | calli | CRISPR-Cas9 |
| PCdb_0346 | 30928635 | OsSERK2 | Somatic embryogenesis receptor kinase regulating development | GCCGGACAGCUCCAUUGCCC | GGA | Oryza sativa L. | 0.404 | protoplast | ABE |
| PCdb_0347 | 32786122 | svDrm | Sugarvine dormancy-associated protein (svDrm, bud dormancy) | GCACCCTGGGTTCTGCGTT | GGA | Setaria viridis (L.) P. Beauv. | 73%-100% | protoplast | CRISPR-Cas9 |
| PCdb_0348 | 27968995 | OsSPS1 | Sucrose-phosphate synthase | GAAACATGTATCTGATCGTCGG | GGA | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0349 | 34360533 | Lj尾 CA 1 | Molecular Characterization of Carbonic Anhydrase Genes in Lotus japonicus and Their Potential Roles in Symbiotic Nitrogen Fixation. | CTAGTAACCTGTGTCGGCGA | GGA | Lotus japonicus (Regel) K.Larsen | not found | protoplast | not found |
| PCdb_0350 | 36835599 | CHS7 | Chalcone synthase 7, key enzyme in flavonoid/anthocyanin biosynthesis | CTACTCACGTCCTTCTAACG | GGA | Glycine max (L.) Merr. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0351 | 23929338 | OsPDS | Rice phytoene desaturase | CGTCTCCTTACCCAACCTG | GGA | Triticum aestivum L. | 14.5-20.0% | protoplast | CRISPR-Cas9 |
| PCdb_0352 | 30144341 | SlARF10A | critical for auxin-mediated compound leaf and flower development | CCGAGGGACATACGGTGTGT | GGA | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0353 | 30144341 | ARF10 | critical for auxin-mediated compound leaf and flower development | CCGAGGGACATACGGTGTGT | GGA | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0354 | 34713227 | OsALS | Acetolactate synthase involved in branched-chain amino acid biosynthesis [Source: RiceWiki] | CCAAGTCGCGGCCCATTCAA | GGA | Oryza sativa L. | not found | protoplast | not found |
| PCdb_0355 | 30144341 | SlARF10A | critical for auxin-mediated compound leaf and flower development | CATACGGTAAACGTTTCGAG | GGA | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0356 | 33421132 | APT | Adenine phosphoribosyltransferase, salvages adenine for nucleotide synthesis | CACTAATCCCTTCTCATATC | GGA | Physcomitrella patens (Hedw.) Bruch & Schimp. | 0.55 | protoplast | CRISPR-Cas9 |
| PCdb_0357 | 30928637 | OsPDS | Oryza sativa phytoene desaturase (OsPDS, carotenoid biosynthesis) | AGTGAAATCTCTTGTCTTAA | GGA | Oryza sativa L. | not found | protoplast | xCas9 |
| PCdb_0358 | 30598393 | DSK2B | Ubiquitin receptor DSK2B | AGCAGTTTGAGATCTTCGCC | GGA | Arabidopsis thaliana (L.) Heynh. | not found | Germ Cells | CRISPR-Cas9,ZFN,TALEN |
| PCdb_0359 | 30051586 | OsSPL17 | SQUAMOSA promoter binding protein-like 17, regulates leaf angle and plant architecture. | AGAAGAGAGAGAGCACAGCT | GGA | Oryza sativa L. | 0.743 | leaf | ABE |
| PCdb_0360 | 30051586 | OsSPL16 | SQUAMOSA promoter binding protein-like 16, controls grain width and yield. | AGAAGAGAGAGAGCACAATC | GGA | Oryza sativa L. | 0.3 | leaf | ABE |
| PCdb_0361 | 34713257 | PDS | Multiallelic, Targeted Mutagenesis of Magnesium Chelatase With CRISPR_Cas9 Provides a Rapidly Scorable Phenotype in Highly Polyploid Sugarcane. | ACCCCCACACCTCTAACTGG | GGA | Glycine max (L.) Merr. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0362 | 40093379 | SlH3 and SlH4 | Promote multicellular trichome formation and elongation | AAGTACTCTGGTTGCTTTC | GGA | Solanum lycopersicum L. | not found | calli | CRISPR/Cas9 |
| PCdb_0363 | 32725756 | erf019 | Ethylene response factor 019 | TGAACTCTGGATGCGG | GCG | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0364 | 40093379 | SlH3 and SlH4 | Promote multicellular trichome formation and elongation | TGTTGCGTAGTACTCCTTA | GCC | Solanum lycopersicum L. | not found | calli | CRISPR/Cas9 |
| PCdb_0365 | 26661595 | AT5G46790.1 | Arabidopsis calcium-binding protein (AT5G46790.1, stress signaling) | TCAACCATACACACCTTGA | GCC | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | not found |
| PCdb_0366 | 34499670 | not found | not found | CCAGGTGCTAAGCTCATCAA | GCC | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0367 | 37773156 | Os-GG02 | Oryza sativa GG02 transcription factor (Os-GG02, stress response) | GTGTATATGAATATGAAGTA | GCAAA | Oryza sativa L. | not found | not found | Base editor,CRISPR-Cas9,CRISPRi,CRISPR-Cas12 |
| PCdb_0368 | 34713242 | OsMPK5 | Oryza sativa mitogen-activated protein kinase 5 (OsMPK5, stress signaling) | GCCAAGCGCACGCTCCGGGA | GAT | Oryza sativa L. | 0.75 | calli | CRISPR-xCas9 |
| PCdb_0369 | 30928637 | OsDEP1 | Oryza sativa Dense and Erect Panicle 1 (OsDEP1, panicle architecture) | gtcgccgggccgtctcgagg | GAT | Oryza sativa L. | not found | protoplast | xCas9 |
| PCdb_0370 | 30928637 | OsDEP1 | Oryza sativa Dense and Erect Panicle 1 (OsDEP1, panicle architecture) | gtcgccgggccgtctcgagg | GAT | Oryza sativa L. | not found | protoplast | xCas9 |
| PCdb_0371 | 31545544 | OsMPK5 | Mitogen-activated protein kinase 5 (defense responses) | GCCAAGCGCACGCTCCGGGA | GAT | Oryza sativa L. | 0.143 | seed | CBE |
| PCdb_0372 | 33398158 | OsDEP1 | Dense and erect panicle 1 (panicle architecture control) | GACCTGTGCGGCCGGCGGCG | GAT | Oryza sativa L. | 0.002 | protoplast | not found |
| PCdb_0373 | 28864834 | PDS | Phytoene desaturase (PDS, carotenoid biosynthesis) | GAACTGTCAATGCAATG | GAT | Citrus 脳 sinensis (L.) Osbeck | 0.455 | protoplast | CRISPR-Cas9 |
| PCdb_0374 | 34713242 | OsWaxy | Oryza sativa granule-bound starch synthase (OsWaxy, amylose biosynthesis) | CTGCTCCTTGAAGAGCCTGA | GAT | Oryza sativa L. | 0.05 | calli | CRISPR-xCas9 |
| PCdb_0375 | 31545544 | OsWaxy | Granule-bound starch synthase determining amylose content in endosperm | CTGCTCCTTGAAGAGCCTGA | GAT | Oryza sativa L. | 0.053 | seed | CBE |
| PCdb_0376 | 34713242 | OsWaxy | Oryza sativa granule-bound starch synthase (OsWaxy, amylose biosynthesis) | CTCATGCAGGAGGACGTCCA | GAT | Oryza sativa L. | 0.1 | calli | CRISPR-xCas9 |
| PCdb_0377 | 31545544 | OsWaxy | Granule-bound starch synthase determining amylose content in endosperm | CTCATGCAGGAGGACGTCCA | GAT | Oryza sativa L. | 0.105 | seed | CBE |
| PCdb_0378 | 33397431 | OsGS1 | Glutamine synthetase 1 (nitrogen metabolism) | CACACCAACTACAGGTGAGG | GAT | Oryza sativa L. | 0.917 | calli | ABE |
| PCdb_0379 | 30928637 | OsPDS | Oryza sativa phytoene desaturase (OsPDS, carotenoid biosynthesis) | acaactccagcgctgcatat | GAT | Oryza sativa L. | not found | protoplast | xCas9 |
| PCdb_0380 | 30928636 | OsSPL4 | SQUAMOSA promoter binding protein-like 4 controlling development | AAGAGAGAGAGCACGCTGAA | GAT | Oryza sativa L. | not found | calli | ABE |
| PCdb_0381 | 35991410 | BnaTAA 1 | Tryptophan aminotransferase 1, catalyzes first step in auxin biosynthesis | CCGTCGGAAACGCAGCAACC | GAGGAT | Brassica napus L. | not found | protoplast | CRISPR-Cas9,SaCas9 |
| PCdb_0382 | 33328469 | BrOG1AOE | Brassica rapa overexpressor line 1A (transgenic construct) | CAAGCCGCCTCTGGTCAATG | GAGAGT | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0383 | 33397431 | BSR-K1 | Blast susceptibility-related protein | TTCCTAGAACAAACTACACT | GAG | Oryza sativa L. | 0.021 | calli | ABE |
| PCdb_0384 | 34713242 | OsALS | Acetolactate synthase involved in branched-chain amino acid biosynthesis [Source: RiceWiki] | GCTTCCTCATGAACATTCAG | GAG | Oryza sativa L. | 0.45 | calli | CRISPR-xCas9 |
| PCdb_0385 | 30051586 | OsSPL14 | Transcription factor regulating tillering and plant architecture (e.g., IPA1 allele increases yield). | GAAGAGAGAGAGCACAGCTC | GAG | Oryza sativa L. | 0.043 | leaf | ABE |
| PCdb_0386 | 34713242 | OsWaxy | Oryza sativa granule-bound starch synthase (OsWaxy, amylose biosynthesis) | CGTCATTCCTGGAGAAGGTG | GAG | Oryza sativa L. | 0.65 | calli | CRISPR-xCas9 |
| PCdb_0387 | 31545544 | OsWaxy | Granule-bound starch synthase determining amylose content in endosperm | CGTCATTCCTGGAGAAGGTG | GAG | Oryza sativa L. | 0.722 | seed | CBE |
| PCdb_0388 | 34713242 | OsALS | Acetolactate synthase involved in branched-chain amino acid biosynthesis [Source: RiceWiki] | CCAACCACCTCTTCCGCCAC | GAG | Oryza sativa L. | 0.05 | calli | CRISPR-xCas9 |
| PCdb_0389 | 30051586 | OsSPL16 | SQUAMOSA promoter binding protein-like 16, controls grain width and yield. | AAGAGAGAGAGCACAATCG | GAG | Oryza sativa L. | 0.059 | leaf | ABE |
| PCdb_0390 | 34713242 | OsPDS | Oryza sativa phytoene desaturase (OsPDS, carotenoid biosynthesis) | TCCTGCAGAGGAATGGGTTG | GAC | Oryza sativa L. | not found | calli | CRISPR-xCas9 |
| PCdb_0391 | 34713242 | OsWaxy | Oryza sativa granule-bound starch synthase (OsWaxy, amylose biosynthesis) | TACCGAGGAGAGATCACCAT | GAC | Oryza sativa L. | not found | calli | CRISPR-xCas9 |
| PCdb_0392 | 34713242 | OsNRT1.1B | Oryza sativa nitrate transporter 1.1B (OsNRT1.1B, nitrogen uptake) | GCTTCGGCTCCGACCAGTTC | GAC | Oryza sativa L. | not found | calli | CRISPR-xCas9 |
| PCdb_0393 | 34713242 | OsNRT1.1B | Oryza sativa nitrate transporter 1.1B (OsNRT1.1B, nitrogen uptake) | GCGACCACCATCATGTTCTG | GAC | Oryza sativa L. | not found | calli | CRISPR-xCas9 |
| PCdb_0394 | 31545544 | OsNRT1.1B | Nitrate transporter regulating nitrogen uptake and utilization | GCGACCACCATCATGTTCTG | GAC | Oryza sativa L. | 0.045 | seed | CBE |
| PCdb_0395 | 34713242 | OsWaxy | Oryza sativa granule-bound starch synthase (OsWaxy, amylose biosynthesis) | CCACCGGCTTCGGCATCGCC | GAC | Oryza sativa L. | not found | calli | CRISPR-xCas9 |
| PCdb_0396 | 34713242 | OsGRF4 | Oryza sativa Growth Regulating Factor 4 (OsGRF4, plant growth regulation) | CACTTTCGTTCTTTGGGAAC | GAC | Oryza sativa L. | not found | calli | CRISPR-xCas9 |
| PCdb_0397 | 33397431 | OsGSK4 | Glycogen synthase kinase 4 (brassinosteroid signaling) | ATATAGCTAATAGTCTAGAG | GAC | Oryza sativa L. | 0.513 | calli | ABE |
| PCdb_0398 | 34713242 | OsALS | Acetolactate synthase involved in branched-chain amino acid biosynthesis [Source: RiceWiki] | ACCTTGTCCTTGATGTGGAG | GAC | Oryza sativa L. | not found | calli | CRISPR-xCas9 |
| PCdb_0399 | 34713242 | OsALS | Acetolactate synthase involved in branched-chain amino acid biosynthesis [Source: RiceWiki] | ACCTCGTGTCCGCGCTCGCC | GAC | Oryza sativa L. | not found | calli | CRISPR-xCas9 |
| PCdb_0400 | 33898973 | not found | not found | GCCTGAAAAGTCTGCAGTCT | GAAG | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0401 | 30928637 | OsPDS | Oryza sativa phytoene desaturase (OsPDS, carotenoid biosynthesis) | TGGTCTTTGCTCCTGCAGAG | GAA | Oryza sativa L. | not found | protoplast | xCas9 |
| PCdb_0402 | 30928637 | OsPDS | Oryza sativa phytoene desaturase (OsPDS, carotenoid biosynthesis) | TGGTCTTTGCTCCTGCAGAG | GAA | Oryza sativa L. | not found | protoplast | xCas9 |
| PCdb_0403 | 30928637 | OsPDS | Oryza sativa phytoene desaturase (OsPDS, carotenoid biosynthesis) | GTCCTGGCAAACAACctgca | GAA | Oryza sativa L. | not found | protoplast | xCas9 |
| PCdb_0404 | 30928637 | OsPDS | Oryza sativa phytoene desaturase (OsPDS, carotenoid biosynthesis) | GTCCTGGCAAACAACctgca | GAA | Oryza sativa L. | not found | protoplast | xCas9 |
| PCdb_0405 | 31545544 | OsMPK5 | Mitogen-activated protein kinase 5 (defense responses) | GACGAGCTGGGGTTCATACG | GAA | Oryza sativa L. | 0.286 | seed | CBE |
| PCdb_0406 | 33397431 | OsMPK13 | Mitogen-activated protein kinase 13 (stress response) | CGGACATGGAGTTCTTTACG | GAA | Oryza sativa L. | 0.298 | calli | ABE |
| PCdb_0407 | 34713242 | OsMPK2 | Oryza sativa mitogen-activated protein kinase 2 (OsMPK2, stress signaling) | CCCTTCATGAGATATATGAT | GAA | Oryza sativa L. | 0.294 | calli | CRISPR-xCas9 |
| PCdb_0408 | 31545544 | OsMPK2 | Mitogen-activated protein kinase 2 (stress signaling) | CCCTTCATGAGATATATGAT | GAA | Oryza sativa L. | 0.444 | seed | CBE |
| PCdb_0409 | 34713242 | OsMPK5 | Oryza sativa mitogen-activated protein kinase 5 (OsMPK5, stress signaling) | CACCTTCAACCCGCTGCAGA | GAA | Oryza sativa L. | not found | calli | CRISPR-xCas9 |
| PCdb_0410 | 31545544 | OsMPK5 | Mitogen-activated protein kinase 5 (defense responses) | CACCTTCAACCCGCTGCAGA | GAA | Oryza sativa L. | 0.143 | seed | CBE |
| PCdb_0411 | 30928636 | OsMADS57 | MADS-box transcription factor controlling tillering | AGCAACTGCACAACTTGCAA | GAA | Oryza sativa L. | not found | calli | ABE |
| PCdb_0412 | 34713242 | OsNRT1.1B | Oryza sativa nitrate transporter 1.1B (OsNRT1.1B, nitrogen uptake) | ACCAGGAGGTACAGGTTCAA | GAA | Oryza sativa L. | not found | calli | CRISPR-xCas9 |
| PCdb_0413 | 31545544 | OsNRT1.1B | Nitrate transporter regulating nitrogen uptake and utilization | ACCAGGAGGTACAGGTTCAA | GAA | Oryza sativa L. | 0.05 | seed | CBE |
| PCdb_0414 | 35098208 | not found | not found | AATTTAAATAAACGTGATGAC | cttt | Glycine max (L.) Merr. | not found | protoplast | CRISPR-Cas12 |
| PCdb_0415 | 34539694 | 0 sS 40 | Possible typographical entry (function unclear without additional context) | CCTCGGCCTCCTCAAGC | CTT | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0416 | 30537191 | SLR1 | DELLA protein regulating gibberellin signaling and plant height | CAACCCCTCGGACCTCTCCTC | CTGGGT | Oryza sativa L. | 11%|5% | calli | CBE |
| PCdb_0417 | 32804931 | StDMR 6 -1 | Potato DMR6-1 (StDMR6-1, disease susceptibility) | CATCCAGAACTGAGACCAAGAGAC | CTGGAT | Solanum tuberosum L. | not found | protoplast | CRISPR-Cas9,Prime editor,Base editor,SaCas9 |
| PCdb_0418 | 32804931 | StGBSSI | Potato granule-bound starch synthase I (StGBSSI, amylose synthesis) | CAGAACTGAGACCAAGAGAC | CTGGAT | Solanum tuberosum L. | not found | protoplast | CRISPR-Cas9,Prime editor,Base editor,SaCas9 |
| PCdb_0419 | 37032710 | not found | not found | GTTTCAGGAAAATCAAACCGG | CTGAAT | Oryza sativa L. | not found | protoplast | not found |
| PCdb_0420 | 33837555 | FRIZZY PANICLE | defines a regulatory hub for simultaneously controlling spikelet formation and awn elongation | GAGCGGCCGGCGGCGCGCCGGCAGG | CTG | Triticum aestivum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0421 | 31012023 | Coilin | Scaffold protein for nuclear Cajal bodies (involved in RNA processing) | TATAATGAAGACGGAAT | CTC | Solanum tuberosum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0422 | 30928637 | OsDEP1 | Oryza sativa Dense and Erect Panicle 1 (OsDEP1, panicle architecture) | TTCCTTGAAGGAGCTCAGCC | CGT | Oryza sativa L. | not found | protoplast | xCas9 |
| PCdb_0423 | 31932727 | OsAAT | Amino acid transporter protein | TACAACAAGGATCCCAGCCC | CGT | Oryza sativa L. | 0.04 | calli | ABE |
| PCdb_0424 | 31932727 | OsAAT | Amino acid transporter protein | TACAACAAGGATCCCAGCCC | CGT | Oryza sativa L. | 0.025 | calli | ABE |
| PCdb_0425 | 30928637 | OsPDS | Oryza sativa phytoene desaturase (OsPDS, carotenoid biosynthesis) | GTGAGGTTCGGCTGAATTCT | CGT | Oryza sativa L. | not found | protoplast | xCas9 |
| PCdb_0426 | 30928635 | Os03g02040 | Hypothetical protein Os03g02040, function uncharacterized | GAGAUCUAGAGGUUGGUCUA | CGT | Oryza sativa L. | 0.0417 | protoplast | ABE |
| PCdb_0427 | 34984801 | OsSPL7 | Squamosa promoter-binding-like 7 | GAGAGAGCACCAGCCGACGA | CGT | Oryza sativa L. | not found | protoplast | CRISPR-Cas9,Base editor |
| PCdb_0428 | 30928636 | OsSPL7 | SQUAMOSA promoter binding protein-like 7 regulating copper homeostasis | GAGAGAGCACCAGCCGACGA | CGT | Oryza sativa L. | 0.029 | calli | ABE |
| PCdb_0429 | 30928637 | OsDEP1 | Oryza sativa Dense and Erect Panicle 1 (OsDEP1, panicle architecture) | GAAGGAGGCACAGATCTTGC | CGT | Oryza sativa L. | not found | protoplast | xCas9 |
| PCdb_0430 | 34042262 | OsEPSPS | 5-Enolpyruvylshikimate-3-phosphate synthase | ATGCGACCATTGACAGCAGC | CGT | Oryza sativa L. | 0.013 | protoplast | CBE |
| PCdb_0431 | 33152517 | APOBEC3A | the APOBEC family of cytidine deaminases | ATCAGCGACCGGATCTCCCC | CGT | Oryza sativa L. | 0.827 | protoplast | CBE |
| PCdb_0432 | 30537191 | OsMKK6 | Mitogen-activated protein kinase kinase involved in stress signaling | CTAGCAAGTTCAATGGGTCAG | CGGGAT | Oryza sativa L. | 0.023 | calli | CBE |
| PCdb_0433 | 33328469 | BrOG1AOE | Brassica rapa overexpressor line 1A (transgenic construct) | AGCTTCATGGTCGTTTCCGT | CGGAGT | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0434 | 31469505 | OsSPL16 | Grain width and yield regulator (GW8 ortholog) | ACAGAAGAGAGAGAGCACAAT | CGGAGT | Oryza sativa L. | 0.303 | calli | ABE |
| PCdb_0435 | 31469505 | OsSPL18 | SQUAMOSA promoter binding protein-like 18 (developmental role) | ACAGAAGAGAGAGAGCACAAT | CGGAGT | Oryza sativa L. | 0.394 | calli | ABE |
| PCdb_0436 | 29735370 | St16DOX | Potato 16伪-hydroxylase (St16DOX, steroidal glycoalkaloid biosynthesis) | GTTAGATTCATTGACAATGGCGG | CGG | Solanum tuberosum L. | not found | hairy root | CRISPR-Cas9 |
| PCdb_0437 | 27848933 | MS26 | Male sterility protein 26 (tapetum development) [Source: MaizeGDB] | GCACGTACGTCACCATCCCGC | CGG | Zea mays L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0438 | 31410483 | not found | not found | ATGGTGCTGGCCATGCTCA | CGG | Oryza sativa L. | not found | seed | CRISPR-Cas9 |
| PCdb_0439 | 35410430 | Sb-Mtl | during rapid de novo shoot regeneration | ACTGTAGAAGCTACAGTCAT | CGG | Hemisorghum C.E.Hubb. ex Bor | 0.937 | embryo | CRISPR-Cas9 |
| PCdb_0440 | 31694550 | PDS | Phytoene desaturase | TTTCTGCTTTGTGTAATCGC | CGG | Triticum aestivum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0441 | 33015536 | AGO4 & NRPD1a & NRPE1 & RDR2 & RDR4 & RDR6 & CHLI1 & PIE1 | Multi-gene complex: RNA-directed DNA methylation machinery (small RNA biogenesis and chromatin modification) | TTTCGAATGTATTTACACCC | CGG | Arabidopsis thaliana (L.) Heynh. | 0.54 | seed | CRISPR-Cas9 |
| PCdb_0442 | 37837754 | OsNAC2 | regulates seed dormancy and germination in rice | TTTAACCCGACGGCAGTACA | CGG | Oryza sativa L. | not found | not found | CRISPR-Cas9 |
| PCdb_0443 | 33557889 | Gh_A03G1685 | Gh_A03G1685 (Gossypium hirsutum laccase-17, lignin biosynthesis) [Source: CottonGen] | TTGTTTCCTTACGCTACCGG | CGG | Gossypium hirsutum L. | 0.5889 | seed | CRISPR-Cas9 |
| PCdb_0444 | 37346168 | Solyc04g079360 | Tomato protein Solyc04g079360 (uncharacterized) | TTGTTGAGCGTTACGGAGCT | CGG | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0445 | 37346168 | Solyc09g010820 | Tomato protein Solyc09g010820 (uncharacterized) | TTGTTAAAGGACCCTGGACT | CGG | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0446 | 36660867 | OsCKX | Rice cytokinin oxidase/dehydrogenase (cytokinin catabolism enzyme) | ttgggatcataacccgggct | cgg | Oryza sativa L. | not found | protoplast | CRISPR-Cas9,CRISPR-Cas12 |
| PCdb_0447 | 33339449 | miR171f | MicroRNA involved in shoot and root development | TTGGCATGGTTCAATCAAAC | CGG | Oryza sativa L. | 0.571 | protoplast | not found |
| PCdb_0448 | 38925598 | LOC_Os05g15880 | taste quality | TTGGCAGTACTACTGTCCGC | CGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_0449 | 38925598 | LOC_Os12g16600 | taste quality | TTGCTTCCACTCATATGCGG | CGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_0450 | 33015536 | AGO4 & NRPD1a & NRPE1 & RDR2 & RDR4 & RDR6 & CHLI1 & PIE1 | Multi-gene complex: RNA-directed DNA methylation machinery (small RNA biogenesis and chromatin modification) | TTGACTGGGATGATTAATTG | CGG | Arabidopsis thaliana (L.) Heynh. | 0.03 | seed | CRISPR-Cas9 |
| PCdb_0451 | 38925598 | LOC_Os04g45940 | taste quality | TTCTTCCCCCACCAACGCCG | CGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_0452 | 38925598 | LOC_Os09g16260 | taste quality | TTCTCTATGATGACTAGACC | CGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_0453 | 35979077 | OsPIN9 | Oryza sativa PIN-FORMED 9 auxin transporter (OsPIN9, polar auxin transport) | TTCTCCAACGAGCAGTGCGC | CGG | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0454 | 36733839 | DDTFR10A | (Not well characterized in plants; likely a member of DDT family, possibly involved in transcriptional regulation.) | TTCTCAAACCTCATCGAATT | CGG | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0455 | 33557889 | Gh_A03G1524 | Gh_A03G1524 (Gossypium hirsutum WRKY transcription factor 70, defense response) [Source: CottonGen] | TTCCCGTACTTGTCGAAGAG | CGG | Gossypium hirsutum L. | 0.5889 | seed | CRISPR-Cas9 |
| PCdb_0456 | 31634585 | NRT1.1B | Nitrate transporter regulating nitrogen uptake and utilization | TTCCCCTCCGCCGCCGTCTC | CGG | Oryza sativa L. | 0.27 | calli | ABE |
| PCdb_0457 | 28412227 | ZmTMS5 | Thermosensitive male sterility protein 5 (pollen development) | TTCCCATGTATGTGGCCACG | CGG | Zea mays L. | 0.048 | maize protoplasts | CRISPR-Cas9 |
| PCdb_0458 | 37111880 | PDS | Phytoene desaturase (PDS, carotenoid biosynthesis) | TTCACCGTGTTATCAAGGTC | CGG | Populus 脳 generosa | not found | shoot | CRISPR-Cas9 |
| PCdb_0459 | 36012319 | PYL4 | Regulate ABA Response in Arabidopsis | TTCAATGAACGACCAAAAT | CGG | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0460 | 32849670 | HIS1 | Prevent Volunteer Rice Infestation | TTCAAGGGTATGGAACTGAC | CGG | Oryza sativa L. | not found | calli | CRISPR-Cas9 |
| PCdb_0461 | 33890635 | GRAS | essential for stamen and runner formation in wild Fragaria L. | TTAGGAGACGCTCGCCAGTT | CGG | Fragaria vesca L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0462 | 27148303 | IR and Rep of CABs | Intergenic region and repetitive elements of chloroplast DNA [Source: NCBI] | TTAATATTACCGTGGGCGAG | CGG | Gossypium hirsutum L. | not found | germplasm | CRISPR-Cas9 |
| PCdb_0463 | 30455712 | PDS | Phytoene desaturase (PDS, carotenoid biosynthesis) | TGTGTTTGGGAATGTTTCCG | CGG | Brassica oleracea var. capitata L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0464 | 29890017 | not found | not found | TGTGGCAGATCAAGCCGGTG | CGG | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0465 | 38013635 | MusaENODL3 | Early nodulin-like protein involved in pollen tube guidance and fertilization processes during banana reproductive development. | TGTGGCACCAGTGAAAGTTG | CGG | Musa L. | not found | protoplast | CRISPR/Cas9 |
| PCdb_0466 | 38925598 | LOC_Os05g34310 | taste quality | TGTGCGCCCTAGTCGCTCAG | CGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_0467 | 36041567 | OsHIPP16 | repressing its accumulation in rice crops | TGTCGAGCGACAAGTGCA | CGG | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0468 | 36292566 | BnFAD2 | Fatty acid desaturase 2, converts oleic acid to linoleic acid (omega-6 fatty acid synthesis) | tgtcactcaatcgtctccca | cgg | Brassica napus L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0469 | 32965083 | ZmSRL5 | involved in drought tolerance | TGGTTCATGGCTGCTCTCTC | CGG | Zea mays L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0470 | 38925598 | LOC_Os06g33690 | taste quality | TGGTGGGGCGGGAGGAGCAG | CGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_0471 | 36304716 | not found | not found | TGGTCGACGGCACCCCGAAC | CGG | Oryza sativa L. | not found | protoplast | CRISPR-Cas9,Base editor |
| PCdb_0472 | 38925598 | LOC_Os09g27590 | taste quality | TGGGACGCCACCACCAGCAG | CGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_0473 | 26269544 | LIG | LIGULELESS (ligule and auricle development in maize) [Source: MaizeGDB] | TGGGAATTGTACCGTACGTGCCC | cgg | Zea mays L. | not found | embryo | CRISPR-Cas9 |
| PCdb_0474 | 38925598 | LOC_Os01g39890 | taste quality | TGGCTTGAGAGGATGGAAGA | CGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_0475 | 29492697 | SPL9 | SQUAMOSA PROMOTER BINDING PROTEIN-LIKE 9 (SPL9, developmental transitions) | TGGCGACTCCGTGTTCCC | CGG | Medicago sativa L. | 0.104 | root | CRISPR-Cas9 |
| PCdb_0476 | 32712772 | not found | not found | TGGCGACCATCACCACGCAGCTC | CGG | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0477 | 38925598 | LOC_Os01g74590 | taste quality | TGGCCCACTTGTTCCCGTGG | CGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_0478 | 31823718 | not found | not found | TGGCAAAGAAGGCCAAGG | CGG | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0479 | 38925598 | LOC_Os01g07930 | taste quality | TGCGAGACGTTCGTGACCAG | CGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_0480 | 33339449 | miR399e | MicroRNA regulating phosphate homeostasis | TGCCCAGCAATGCAACTTTG | CGG | Oryza sativa L. | 0.563 | protoplast | not found |
| PCdb_0481 | 38925598 | LOC_Os03g07226 | taste quality | TGCCAGCTCGGAACCACAAT | CGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_0482 | 33557889 | Gh_A10G0024 | Gh_A10G0024 (Gossypium hirsutum bZIP transcription factor A10G0024) [Source: CottonGen] | TGCATTTCGGAGCTCAGCAT | CGG | Gossypium hirsutum L. | 0.5889 | seed | CRISPR-Cas9 |
| PCdb_0483 | 29061908 | SlORRM4 | Organellar RNA recognition motif protein SlORRM4 | TGCAGGATCTCCACGGGAGA | CGG | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0484 | 38925598 | LOC_Os09g28150 | taste quality | TGCAGCTGCAGGGCCAGCGA | CGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_0485 | 31694550 | PDS | Phytoene desaturase | TGATTTCCCAGAGACTTTGC | CGG | Triticum aestivum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0486 | 32429836 | TFL1 | TERMINAL FLOWER 1 floral repressor | TGATCTTGGTCTCCCTGTCG | CGG | Brassica napus L. | not found | calli | CRISPR-Cas9 |
| PCdb_0487 | 33759354 | LHCF | LHCF (light-harvesting complex protein in photosynthetic organisms) | TGATCTCAACGTAACGGAGA | CGG | Phaeodactylum tricornutum Bohlin | 50-70% | protoplast | CRISPR-Cas9 |
| PCdb_0488 | 38925598 | LOC_Os02g36510 | taste quality | TGAGCGCCATGGGGCCCGCG | CGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_0489 | 38925598 | LOC_Os07g02920 | taste quality | TGAGAGCCACCGTGCCAGCG | CGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_0490 | 38925598 | LOC_Os01g33370 | taste quality | TGACTGAGCGTCCTCAACTA | CGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_0491 | 38925598 | LOC_Os02g34990 | taste quality | TGACTGAAGTTCTCATACTC | CGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_0492 | 33872346 | EPSPS | 5-Enolpyruvylshikimate-3-phosphate synthase | TGACAGTGTAAACAACCGTG | CGG | Brassica napus L. | 0.181 | seed | CRISPR-Cas9 |
| PCdb_0493 | 37213679 | CsBPC 2 | BASIC PENTACYSTEINE protein; binds GAGA motifs, involved in seed development and transcriptional regulation. | TCTGTTGTTTCTGAAGCAC | CGG | Cucumis sativus L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0494 | 30610522 | OsMS1 | regulate programmed tapetum development and pollen exine formation in rice | TCTGCCAGCCCGGCTACC | CGG | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0495 | 31694550 | PDS | Phytoene desaturase | TCTGAATACGAGAATTCAGC | CGG | Triticum aestivum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0496 | 38925598 | LOC_Os06g21900 | taste quality | TCTCTTGGTGGGGCACCCGC | CGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_0497 | 34042262 | OsSPL16 | Squamosa-promoter binding-like 16 (grain size regulator) | TCTCTCTCTTCTGTCAGCTC | CGG | Oryza sativa L. | not found | protoplast | CBE |
| PCdb_0498 | 38925598 | LOC_Os10g32720 | taste quality | TCTCGGGAGGAGGAACGTGG | CGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_0499 | 26864017 | BFP | Blue fluorescent protein, commonly used as a reporter gene | TCGTGACCACCTTCACCCA | CGG | Linum usitatissimum L. | not found | protoplast | CRISPR-Cas9,TALEN |
| PCdb_0500 | 35067308 | OsLHY | regulating flowering | TCGTACTGGCCTACAGTAGA | CGG | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0501 | 36534157 | TaGAMYB | regulates flowering time and fertility | TCGTAAGTGGTTAGCCCAG | CGG | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0502 | 31694550 | PDS | Phytoene desaturase | TCGGTGATCGTTGCAGAGGT | CGG | Triticum aestivum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0503 | 26842991 | FGS | FGS (Arabidopsis thaliana FATTY ACID ELONGASE79, very-long-chain fatty acid biosynthesis) [Source: TAIR] | TCGCTTAAGCGACGCATAGA | CGG | Zea mays L. | 0.0292 | protoplast | CRISPR-Cas9 |
| PCdb_0504 | 30159598 | OsGS3 | G-protein subunit controlling grain length and weight | TCGCTCGGCCGCCTGCAGGG | CGG | Oryza sativa L. | not found | protoplast | not found |
| PCdb_0505 | 38925598 | LOC_Os08g36680 | taste quality | TCGAGCCTACTCCAGTTCCC | CGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_0506 | 31991936 | FWL | FWL (FW2-2-like cell number regulator, plasma membrane-associated) [Source: UniProt] | TCGACGTCGTGCGGCACCGG | CGG | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0507 | 31585004 | SAUR41 subfamily | inducible to modulate cell expansion and salt tolerance | TCCTCCTTCCGCAACCGTCGCGG | CGG | Arabidopsis thaliana (L.) Heynh. | not found | seed | CRISPR-Cas9 |
| PCdb_0508 | 30928637 | OsDEP1 | Oryza sativa Dense and Erect Panicle 1 (OsDEP1, panicle architecture) | TCCTCAAGGTGAGCGCCCCG | CGG | Oryza sativa L. | not found | protoplast | xCas9 |
| PCdb_0509 | 34042262 | not found | not found | TCCCTCCCCCCTTCCTGGCC | CGG | Oryza sativa L. | 0.07 | protoplast | CBE |
| PCdb_0510 | 38925598 | LOC_Os04g45940 | taste quality | TCCCACCGCGAGGCGTCGCG | CGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_0511 | 34539694 | 0 sS 40 | Possible typographical entry (function unclear without additional context) | TCATCCCCTGCCACGAACGA | CGG | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0512 | 31694550 | PDS | Phytoene desaturase | TCAGGGAAATGTCCTGACCT | CGG | Triticum aestivum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0513 | 36057005 | CsGCN5 | Histone acetyltransferase; regulates gene expression via chromatin modification. | TCAGAATCGTCGTCGGAGT | CGG | Cucumis sativus L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0514 | 38925598 | LOC_Os01g52830 | taste quality | TCAGAACCCATCGCCAACAC | CGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_0515 | 34786790 | not found | not found | TCACCTGCCTGTTGTCA | CGG | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0516 | 39469217 | TaD27 | DWARF27 carotenoid isomerase catalyzing isomerization of all-trans-尾-carotene to initiate strigolactone biosynthesis, thereby controlling tiller number in wheat. | TCACAGCCACAGTGGCCTCA | CGG | Triticum aestivum L. | not found | mature embryo | CRISPR/Cas9 |
| PCdb_0517 | 31996144 | CCD8 | Carotenoid cleavage dioxygenase 8, produces strigolactone hormones that regulate shoot branching | TCAATACCGAAAACGGGCCG | CGG | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0518 | 31768121 | ELF3 | EARLY FLOWERING 3 (ELF3): circadian clock and photoperiodic flowering regulator | TATTGGAACCTATGTTTCCT | CGG | Arabidopsis thaliana (L.) Heynh. | 32-91% | protoplast | not found |
| PCdb_0519 | 32799324 | SITLFP8 | Lipid transfer protein (SITLFP8) | TATTCAGTGCTTCATCAAG | CGG | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0520 | 31694550 | PDS | Phytoene desaturase | TAGCTACAACTTGGAGGCGA | CGG | Triticum aestivum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0521 | 35818421 | protopanaxadiol 6-hydroxylase gene | Protopanaxadiol 6-hydroxylase (ginsenoside biosynthesis) | TAGAGAAAAGCAAAGCCTTG | CGG | Panax ginseng C. A. Mey. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0522 | 34115267 | FAD2 | Fatty acid desaturase 2 (oleic to linoleic acid conversion) | TACGTGTACCACAACCCGAT | CGG | Oryza sativa L. | 0.822 | protoplast | not found |
| PCdb_0523 | 32841372 | BnTT8 | regulates seed production | TACGGCTGAAGAGGCTGCGT | CGG | Brassica napus L. | not found | seed | CRISPR-Cas9 |
| PCdb_0524 | 30928637 | OsDEP1 | Oryza sativa Dense and Erect Panicle 1 (OsDEP1, panicle architecture) | tacgaggcggatcgagctag | CGG | Oryza sativa L. | not found | protoplast | xCas9 |
| PCdb_0525 | 31694550 | PDS | Phytoene desaturase | TACCTGCTTTTCCATCCATT | CGG | Triticum aestivum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0526 | 36285668 | HTR12 | Histone H1.2 | taccagctcaccaagcttct | CGG | Arabidopsis thaliana (L.) Heynh. | not found | Centromere | Base editor |
| PCdb_0527 | 31452351 | Glyma.15G049200 Glyma.08G183500 | ERF transcription factor (Glyma.15G049200 & Glyma.08G183500) [Source: SoyBase] | TACAAAAAGAAATGCACGGA | CGG | Glycine max (L.) Merr. | 0.592 | hairy root | CRISPR-Cas9 |
| PCdb_0528 | 33557889 | Gh_A13G0593 | Gh_A13G0593 (Gossypium hirsutum ERF transcription factor A13G0593) [Source: CottonGen] | TAAGTATCGCTAATGTCGGG | CGG | Gossypium hirsutum L. | 0.5889 | seed | CRISPR-Cas9 |
| PCdb_0529 | 33015536 | AGO4 & NRPD1a & NRPE1 & RDR2 & RDR4 & RDR6 & CHLI1 & PIE1 | Multi-gene complex: RNA-directed DNA methylation machinery (small RNA biogenesis and chromatin modification) | TAACCCAAGAGAAAGAGAGA | CGG | Arabidopsis thaliana (L.) Heynh. | 0.18 | seed | CRISPR-Cas9 |
| PCdb_0530 | 36058302 | GluB4 | Glutenin subunit B4 (seed storage protein) [Source: UniProt] | TAAATCCATGGCACAACCCT | CGG | Oryza sativa L. | not found | calli | not found |
| PCdb_0531 | 30406958 | glsA | Glutamate synthase (nitrogen assimilation) [Source: TAIR] | GTTTGCTGACGGAGGCTCTG | CGG | Volvox carteri F.Stein | not found | protoplast | CRISPR-Cas9 |
| PCdb_0532 | 26842991 | FGS | FGS (Arabidopsis thaliana FATTY ACID ELONGASE31, very-long-chain fatty acid biosynthesis) [Source: TAIR] | GTTTGATTTGAAAGCGGGCG | CGG | Zea mays L. | 0.1236 | protoplast | CRISPR-Cas9 |
| PCdb_0533 | 27904648 | the urease gene | Urease (urea hydrolysis) | GTTTCCGATCTAATGTCCAT | CGG | Thalassiosira pseudonana Hasle & Heimdal | not found | protoplast | CRISPR-Cas9 |
| PCdb_0534 | 30625150 | RhCAT | Catalase enzyme RhCAT | GTTGTTCCACACTGGCGCAC | CGG | Arabidopsis thaliana (L.) Heynh. | 0.714 | protoplast | CRISPR-Cas9 |
| PCdb_0535 | 34132917 | CaERF28 | Ethylene responsive factor 28, transcription factor in ethylene signaling pathway | GTTGTCGCAGCAACAGCTGC | CGG | Capsicum annuum L. | 0.857 | Seed | CRISPR-Cas9 |
| PCdb_0536 | 38925598 | LOC_Os07g40020 | taste quality | GTTGGGGAACCTCAACAGCA | CGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_0537 | 38925598 | LOC_Os03g15940 | taste quality | GTTGGCACTTGAAGCAGGAG | CGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_0538 | 36245499 | Ae1Sbe1 | improves gut barrier function and ameliorates type II diabetes in high-fat diet-fed mice by increasing Akkermansia | GTTGGATGTTCGGGGACGCA | CGG | Zea mays L. | not found | Ae1 | CRISPR-Cas9 |
| PCdb_0539 | 38925598 | LOC_Os02g10800 | taste quality | GTTGGAGTTCCCTCGCCGGA | CGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_0540 | 29604159 | eIF4G | Eukaryotic translation initiation factor 4G, scaffold protein for translation machinery | GTTCTGTTCCCTAATTTGGC | CGG | Oryza sativa L. | 0.866 | immature embryos | cas9 |
| PCdb_0541 | 32531863 | ZmPHYC | Phytochrome C light receptor | GTTCTGGAGGTAGGTGGAGA | CGG | Zea mays L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0542 | 27226176 | ABI4 | AP2/EREBP family transcription factor ABI4 | GTTCTATGGGTCTGGATC | CGG | Arabidopsis thaliana (L.) Heynh. | 1 | mature leaves | CRISPR-Cas9 |
| PCdb_0543 | 26657719 | StALS1 | Potato acetolactate synthase 1 (StALS1, branched-chain amino acid biosynthesis) | GTTCTACCTATGATTCCCAG | CGG | Solanum tuberosum L. | 3-60% | protoplast | not found |
| PCdb_0544 | 30800139 | ALS | Acetolactate synthase, target site of ALS-inhibitor herbicides and essential for branched-chain amino acid biosynthesis | GTTCTACCTATGATTCCCAG | CGG | Solanum tuberosum L. | not found | protoplast | CRISPR-Cas9,CRISPR-Cas12,TALEN |
| PCdb_0545 | 32854250 | OsBHY, OsEHY, OsWaxy | Rice beta-hydroxyacyl-ACP dehydratase, enoyl-ACP reductase, and granule-bound starch synthase (three enzymes involved in fatty acid and starch biosynthesis) | GTTCGGCACCTTCGCGCGCTAT | CGG | Oryza sativa L. | 1 | protoplast | CRISPR-Cas9 |
| PCdb_0546 | 29753601 | Aa1 | Aux/IAA protein Aa1 | GTTCCTCTTCTGATTGTCAA | CGG | Brassica napus L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0547 | 28928381 | ALC | Alcobaca (ripening-related) transcription factor | GTTCCACCGGAAGTAAAAAC | CGG | Solanum lycopersicum L. | 72.73-7.69% | callus | CRISPR-Cas9 |
| PCdb_0548 | 28928381 | ALC | Alcobaca (ripening-related) transcription factor | GTTCCACCGGAAGTAAAAAC | CGG | Solanum lycopersicum L. | 72.73-7.69% | callus | CRISPR-Cas9 |
| PCdb_0549 | 40528015 | ZmWRKY125 | WRKY transcription factor involved in regulation of stress responses and developmental processes in maize. | GTTCATGTCGGACTACGTGG | CGG | Zea mays L. | not found | hairy root | CRISPR/Cas9 |
| PCdb_0550 | 26842991 | FGS | FGS (Arabidopsis thaliana FATTY ACID ELONGASE47, very-long-chain fatty acid biosynthesis) [Source: TAIR] | GTTCAGCTTTGCAGAATATT | CGG | Zea mays L. | 0.0114 | protoplast | CRISPR-Cas9 |
| PCdb_0551 | 29867128 | AtMTA | Arabidopsis methylthioadenosine nucleosidase, involved in polyamine metabolism | GTTCACCTTAGCAGCAGTAG | CGG | Arabidopsis thaliana (L.) Heynh. | 0.393 | protoplast | ABE |
| PCdb_0552 | 36743495 | CpSRP43 | Photosynthesis in rice | gtgtgCGAGCCTTCGTGGATCC | CGG | Oryza sativa L. | not found | leaf | CRISPR-Cas9 |
| PCdb_0553 | 32786122 | svDrm | Sugarvine dormancy-associated protein (svDrm, bud dormancy) | GTGTATGGACGACGATATCA | CGG | Setaria viridis (L.) P. Beauv. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0554 | 30729010 | BoSRK3 | S-receptor kinase 3, involved in self-incompatibility response in Brassica oleracea | GTGGGATCTTTAGAGTGCAT | CGG | Brassica oleracea var. capitata L. | 1 | hypocotyl | CRISPR-Cas9 |
| PCdb_0555 | 36743495 | CpSRP43 | Chloroplast signal recognition particle 43 kDa subunit | gtggCGAGCCTTCGTGGATCC | CGG | Oryza sativa L. | not found | leaf | CRISPR-Cas9 |
| PCdb_0556 | 30729010 | BoSRK3 | S-receptor kinase 3, involved in self-incompatibility response in Brassica oleracea | GTGGCAGAGCTTCTCGCCAA | CGG | Brassica oleracea var. capitata L. | 1 | hypocotyl | CRISPR-Cas9 |
| PCdb_0557 | 35684163 | not found | not found | GTGGAGGGCATCTCCATCGG | CGG | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0558 | 27874087 | not found | not found | GTGGAGGGCATCTCCATCGG | CGG | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0559 | 35955484 | not found | not found | GTGGAGGGCATCTCCAT | CGG | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0560 | 29973285 | OsLAC | Encodes laccase enzyme involved in lignin biosynthesis and stress responses. | GTGCGTGCAGGCACGGGTATC | CGG | Oryza sativa L. | not found | protoplast | not found |
| PCdb_0561 | 38925598 | LOC_Os01g49360 | taste quality | GTGCGGTGTGGCGGTAGCGG | CGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_0562 | 32821233 | TaLOX2 | Lipoxygenase 2 | GTGCCGCGCGACGAGCTCTT | CGG | Triticum aestivum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0563 | 32849670 | HIS1 | Histidinol dehydrogenase 1 (histidine biosynthesis) [Source: NCBI] | GTGCAAGAGCTGGCGGCAGC | CGG | Oryza sativa L. | not found | calli | CRISPR-Cas9 |
| PCdb_0564 | 28487703 | ENGase | Endo?尾?N?acetylglucosaminidase (ENGase): key regulator of cell differentiation | GTGATGGGGTAGGAGATGGG | CGG | Hordeum vulgare L. | 0.156 | Immature embryos | CRISPR-Cas9 |
| PCdb_0565 | 27630657 | YFP | Yellow fluorescent protein (YFP, reporter gene) | GTGAACTTCCCAAGATCCGCCA | CGG | Lotus japonicus (Regel) K.Larsen | 0.35 | protoplast | CRISPR-Cas9 |
| PCdb_0566 | 36840200 | ASR2 | Abscisic acid stress ripening protein 2, involved in stress responses | GTCCTTACCACAAAAACTG | CGG | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0567 | 38925598 | LOC_Os09g20400 | taste quality | GTCCGCCCGACTCGCAGCGG | CGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_0568 | 32213123 | CVIF1 | Capsicum virus-induced factor 1 (plant-virus interaction) | GTCCCCAAATTCGGCGAAGA | CGG | Arabidopsis thaliana (L.) Heynh. | not found | seed | CRISPR-Cas9 |
| PCdb_0569 | 36840200 | ASR1 | Abscisic acid stress ripening protein 1, involved in stress responses | GTCCATACCACAAGAACTGTG | CGG | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0570 | 26842991 | FGS | FGS (Arabidopsis thaliana FATTY ACID ELONGASE69, very-long-chain fatty acid biosynthesis) [Source: TAIR] | GTCATAGCTTCTGTAACTAC | CGG | Zea mays L. | 0.0202 | protoplast | CRISPR-Cas9 |
| PCdb_0571 | 30406958 | regA | RegA translational repressor protein (viral gene expression regulation) | GTCACTTGTATCGGCCCCGG | CGG | Volvox carteri F.Stein | not found | protoplast | CRISPR-Cas9 |
| PCdb_0572 | 36565935 | Bcs | improves cotton fiber length and strength | GTCACTGAGGATATCTTAAC | CGG | Gossypium hirsutum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0573 | 38925598 | LOC_Os08g25734 | taste quality | GTAGTTGGCACCCAGAGGCA | CGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_0574 | 26842991 | FGS | FGS (Arabidopsis thaliana FATTY ACID ELONGASE55, very-long-chain fatty acid biosynthesis) [Source: TAIR] | GTACTTGGCCGAGCTTCTCG | CGG | Zea mays L. | 0.49 | protoplast | CRISPR-Cas9 |
| PCdb_0575 | 36630019 | EgFAD2 | Oil palm Fatty Acid Desaturase?2 (EgFAD2): 6 desaturase in lipid metabolism | GTACCTGCAGCCACACCCACG | CGG | Elaeis guineensis Jacq. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0576 | 31684940 | EPSPS | 5-enolpyruvylshikimate-3-phosphate synthase | GTAATGCTGGAACTGCAATG | CGG | Triticum aestivum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0577 | 36245499 | Ae1Sbe1 | improves gut barrier function and ameliorates type II diabetes in high-fat diet-fed mice by increasing Akkermansia | GTAAGGGCTCCCCGACTCAC | CGG | Zea mays L. | not found | Ae1 | CRISPR-Cas9 |
| PCdb_0578 | 38925598 | LOC_Os10g12390 | taste quality | GTAACGTTAGCACCACCGGC | CGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_0579 | 39674177 | lin5 | Confers heat-stress resilience | GGTTTAGATGTATCGTATCG | CGG | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0580 | 34376154 | GUX1 | not found | GGTTGTATTGCTATCAACGG | CGG | Pinus radiata D. Don | not found | embryo | CRISPR-Cas9 |
| PCdb_0581 | 33518716 | not found | not found | GGTGGTGACCGCCACGTGCC | CGG | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0582 | 38925598 | LOC_Os05g06480 | taste quality | GGTGCTCATCCCGCTCGCGG | CGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_0583 | 30406958 | invA | Invasion protein A (bacterial pathogenesis factor) [Source: NCBI] | GGTGCGACCCCTCAATCCGA | CGG | Volvox carteri F.Stein | not found | protoplast | CRISPR-Cas9 |
| PCdb_0584 | 33650757 | ZmIg1 | Indeterminate gametophyte 1 (ZmIg1, reproductive development) | GGTGCCGGCGCCATCGGGG | CGG | Zea mays L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0585 | 35903231 | CPR5 | Constitutive Pathogen Response 5, regulates plant immunity and stress responses | GGTGATATTGTTACAGAGGT | CGG | Glycine max (L.) Merr. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0586 | 26842991 | FGS | FGS (Arabidopsis thaliana FATTY ACID ELONGASE20, very-long-chain fatty acid biosynthesis) [Source: TAIR] | GGTCTACAACCCCTTTGCAG | CGG | Zea mays L. | 0.1109 | protoplast | CRISPR-Cas9 |
| PCdb_0587 | 29157799 | not found | not found | GGTCGTTACCTAAAAATGC | CGG | Solanum lycopersicum L. | 88.9-100% | red-fruited materials | CRISPR-Cas9 |
| PCdb_0588 | 31694550 | PDS | Phytoene desaturase | GGTCGGCAAGGTTCGCAATT | CGG | Triticum aestivum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0589 | 36660914 | CIPK-B | CBL-interacting protein kinase, calcium signaling pathway component | GGTCAAGTTCGCCCAGAACA | CGG | Marchantia polymorpha L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0590 | 36679094 | PAIN-1 | Protein associated with INsensitivity-1 (PAIN-1, stress response) | GGTCAAGTACAAAGGCAACC | CGG | Solanum tuberosum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0591 | 31991936 | FWL | FWL (FW2-2-like cell number regulator, plasma membrane-associated) [Source: UniProt] | GGGTCGACGTCGTTCGGCAC | CGG | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0592 | 36614293 | not found | not found | GGGTCATGGTGATCTCTCCT | CGG | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0593 | 38925598 | LOC_Os11g31360 | taste quality | GGGGCGGAACACACACCCAA | CGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_0594 | 29868058 | AGAMOUS | the poplar homologs of two genes essential to flower formation and morphology | GGGGAAAGGTGGAGATCAAG | CGG | Populus sp. | 0.775 | protoplast | CRISPR-Cas9 |
| PCdb_0595 | 28066464 | DIPM | Disease-Interacting Protein Module (likely involved in plant-pathogen interactions) | GGGGAAAGGAAGCCTAGGGA | CGG | Vitis vinifera L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0596 | 28009483 | CBF3 | C-repeat binding factor 3 | GGGCAGCTGCTCGCAAGCGT | CGG | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0597 | 31728198 | pgUGT84A24 | Panax ginseng UGT84A24 glycosyltransferase (ginsenoside modification) | GGGAGGAGCCGTCGCCTAT | CGG | Punica granatum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0598 | 36204067 | ARP2 | Actin-related protein 2 | GGGAGACTTGCTCTGAGCTC | CGG | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0599 | 33236499 | TaSBEIIa | Starch branching enzyme IIa | GGGAAGGTCCTGGTGCCTGA | CGG | Triticum aestivum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0600 | 38925598 | LOC_Os10g41240 | taste quality | GGCTTTCGACGCGAAGCGCG | CGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_0601 | 38925598 | LOC_Os07g09814 | taste quality | GGCTTCATCGGAGAAGCACG | CGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_0602 | 38925598 | LOC_Os09g08280 | taste quality | GGCTCGTCGTCCTTGGACGA | CGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_0603 | 38925598 | LOC_Os06g43880 | taste quality | GGCGTGCTCGGCTATCAAGC | CGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_0604 | 36326663 | TaCIPK14 | Wheat CIPK14 kinase (TaCIPK14, stress signaling) | GGCGTGAGGTCACAACCATG | CGG | Triticum aestivum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0605 | 30733188 | not found | not found | GGCGTCGGTTTCCACTAT | CGG | Oryza sativa L. | not found | protoplast | not found |
| PCdb_0606 | 38925598 | LOC_Os07g17460 | taste quality | GGCGTCGGGGGCGAGATCAC | CGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_0607 | 30477421 | waxy | Granule鈥恇ound starch synthase I (waxy) | GGCGGCCTCGGCGACGTCCT | CGG | Triticum aestivum L. | 0.5417 | protoplast | CRISPR-Cas9 |
| PCdb_0608 | 26842991 | FGS | FGS (Arabidopsis thaliana FATTY ACID ELONGASE32, very-long-chain fatty acid biosynthesis) [Source: TAIR] | GGCGCGTCCGCTGTGTTCGA | CGG | Zea mays L. | 0.016 | protoplast | CRISPR-Cas9 |
| PCdb_0609 | 38925598 | LOC_Os04g52110 | taste quality | GGCGCCACCGAGCAGCATGG | CGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_0610 | 31244876 | not found | not found | GGCGACGGCGTCGGCTACGG | CGG | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0611 | 33902846 | OsMORF9 | is necessary for chloroplast development and seedling survival in rice | GGCGAAGGCGAATGCCTGCG | CGG | Oryza sativa L. | not found | chloroplast | CRISPR-Cas9 |
| PCdb_0612 | 32512821 | OsCpn60尾1 | Essential for Chloroplast Development in Rice | GGCCTCATGGCTGCGCCAAC | CGG | Oryza sativa L. | not found | chloroplast | CRISPR-Cas9 |
| PCdb_0613 | 30096237 | SlCBF1 | C-repeat binding factor 1 | GGCCGTCGAAATCTTCCGGAT | CGG | Solanum lycopersicum L. | 0.25 | leaf | CRISPR-Cas9 |
| PCdb_0614 | 26842991 | FGS | FGS (Arabidopsis thaliana FATTY ACID ELONGASE65, very-long-chain fatty acid biosynthesis) [Source: TAIR] | GGCCGGAGCGCCACCTTCTG | CGG | Zea mays L. | 0.2194 | protoplast | CRISPR-Cas9 |
| PCdb_0615 | 38925598 | LOC_Os12g41140 | taste quality | GGCCGCCTCTCACACAGCAG | CGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_0616 | 27848933 | MS45 | Male sterility protein 45 (pollen wall development) [Source: MaizeGDB] | GGCCGAGGTCGACTACCGGC | CGG | Zea mays L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0617 | 26269544 | MS45 | Male sterility protein 45 (pollen wall development) [Source: MaizeGDB] | GGCCGAGGTCGACTACCGGC | cgg | Zea mays L. | not found | embryo | CRISPR-Cas9 |
| PCdb_0618 | 34129189 | not found | not found | GGCCCCTCCCTTTCGACAC | CGG | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0619 | 29807545 | GFP | GFP (Green Fluorescent Protein, Aequorea victoria, transformation control) [Source: Addgene] | GGCCATGGCGCCCGCGGCGG | CGG | Oryza sativa L. | 0.0001 | protoplast | ABE |
| PCdb_0620 | 31228115 | not found | not found | GGCCATCCGTATAATATTAC | CGG | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0621 | 32046096 | GmFAD2-1A | Omega-6 fatty acid desaturase (FAD2-1A) | GGCCAAAGTGGAAGTTCAA | CGG | Glycine max (L.) Merr. | 0.95 | protoplast | CRISPR-Cas9 |
| PCdb_0622 | 29210506 | Waxy | Granule-bound starch synthase (GBSS), controls amylose synthesis in endosperm | GGCATGAACGTCGTGTTCGT | CGG | Oryza sativa L. | 0.8696 | seed | cas9 |
| PCdb_0623 | 31991936 | FWL | FWL (FW2-2-like cell number regulator, plasma membrane-associated) [Source: UniProt] | GGCAAGATGCGCACTCAGTA | CGG | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0624 | 31275047 | CTR1 | a negative regulator of ethylene signaling in Arabidopsis, was used as a target gene | GGATTTGATTGGGATCCTAG | CGG | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0625 | 37346168 | Solyc03g119050 | Tomato protein Solyc03g119050 (uncharacterized) | GGATGAAGGTTGGAGGTCGT | CGG | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0626 | 37346168 | Solyc01g009070 | Tomato protein Solyc01g009070 (uncharacterized) | GGATCAGAATCTGTGTTCTC | CGG | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0627 | 38925598 | LOC_Os05g49440 | taste quality | GGAGGTGCCGGGGAAGCCGA | CGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_0628 | 38925598 | LOC_Os12g07120 | taste quality | GGAGGTAGCTGCGAGGCCTA | CGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_0629 | 34498373 | BnaA03.BP | compact architecture to rapeseed | GGAGGGGAAGCAGAATTAC | CGG | Brassica napus L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0630 | 27543262 | not found | not found | GGAGGAGCTGCATGAGCGGG | CGG | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0631 | 27543262 | not found | not found | GGAGGAGCTGCACGAGCGGG | CGG | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0632 | 31585004 | SAUR41 subfamily | Small auxin-up RNA 41 family protein | GGAGCGGTTCGTGGTGAATG | CGG | Arabidopsis thaliana (L.) Heynh. | not found | seed | CRISPR-Cas9 |
| PCdb_0633 | 38925598 | LOC_Os02g51550 | taste quality | GGAGCCAGGGGACCATGCAC | CGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_0634 | 38925598 | LOC_Os10g07998 | taste quality | GGAGAGATCATTCCAGACGG | CGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_0635 | 37528980 | not found | not found | GGAGAAGCCGCCGCCGAAGC | CGG | Oryza sativa L. | not found | blast | CRISPR-Cas9 |
| PCdb_0636 | 38925598 | LOC_Os07g47120 | taste quality | GGAGAACGCCTGGATTGCGC | CGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_0637 | 36660867 | OsCKX | Rice cytokinin oxidase/dehydrogenase (cytokinin catabolism enzyme) | ggactcggacctgttcttcg | cgg | Oryza sativa L. | not found | protoplast | CRISPR-Cas9,CRISPR-Cas12 |
| PCdb_0638 | 37346168 | Solyc04g009950 | Tomato protein Solyc04g009950 (uncharacterized) | GGACGAGCAGGCTTTGATTC | CGG | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0639 | 38925598 | LOC_Os05g12670 | taste quality | GGACGACATCGACTTCACGT | CGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_0640 | 38925598 | LOC_Os06g31090 | taste quality | GGACCAAACCGCATCCTCGT | CGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_0641 | 37248636 | OsRLCK155 | Receptor-like cytoplasmic kinase | GGACACGTTCGAGCACGCAT | CGG | Oryza sativa L. | not found | protoplast | not found |
| PCdb_0642 | 35713718 | not found | not found | GGACACATCATATAACGGC | CGG | Solanum tuberosum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0643 | 33557889 | Gh_A05G0413 | Gh_A05G0413 (Gossypium hirsutum potassium transporter HAK5) [Source: CottonGen] | GGAATATCGGGTCATCATAG | CGG | Gossypium hirsutum L. | 0.5889 | seed | CRISPR-Cas9 |
| PCdb_0644 | 38925598 | LOC_Os02g15250 | taste quality | GGAAGGGGAAGGGCACTCGG | CGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_0645 | 33324433 | TaPDS | Phytoene desaturase | GCTTTCGATCCGGTGAGGC | CGG | Triticum aestivum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0646 | 33557889 | Gh_A10G0657 | Gh_A10G0657 (Gossypium hirsutum sucrose transporter SUT1 A10G0657) [Source: CottonGen] | GCTTGGGCCACAAACACTAC | CGG | Gossypium hirsutum L. | 0.5889 | seed | CRISPR-Cas9 |
| PCdb_0647 | 30191180 | GBSS | Granule-Bound Starch Synthase (GBSS) | GCTTGGGATACCTCTGTAT | CGG | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0648 | 32117361 | Drm-3 | Drosophila melanogaster Drm-3 (likely a developmental regulator, requires verification) | GCTTCCTCAGTAAAGGATCT | CGG | Brassica rapa subsp. chinensis (L.) Makino | not found | seed | CRISPR-Cas9 |
| PCdb_0649 | 32816057 | BnA10.RCO | Reduced-complexity leaf-shape regulator (RCO homolog) | GCTTCACCCTCCACCGTGCA | CGG | Brassica napus L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0650 | 30839150 | Ms1 | Wheat MALE STERILITY 1 transcription factor (anther development) | GCTGCTGGCGGCGCTGCTGC | CGG | Triticum aestivum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0651 | 38925598 | LOC_Os05g49930 | taste quality | GCTGCTCTGGGCAACGTCAG | CGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_0652 | 35222464 | BnaCRTISO | Alters the Color of Petals and Leaves | GCTGCGATCAGCACACGTTA | CGG | Brassica napus L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0653 | 38925598 | LOC_Os07g41720 | taste quality | GCTGCAGGCTCAACAGGCAA | CGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_0654 | 36610008 | not found | not found | GCTGCAGAGGAGCCACCACC | CGG | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0655 | 35876823 | not found | not found | GCTGAGGCTAGTGGACCGCG | CGG | Zea mays L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0656 | 33150679 | TaNCEDI | 9-cis-epoxycarotenoid dioxygenase 1 | GCTGAGCGCGAAGAGCTCGC | CGG | Triticum aestivum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0657 | 34580960 | SlNAM 1 | regulates ethylene biosynthesis and the onset of tomato fruit ripening | GCTGAATTGCAGTTACCTCC | CGG | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0658 | 37084283 | GmPDCTs | Phosphatidylcholine:diacylglycerol cholinephosphotransferase | GCTCTTCGCCGGGCTCAATA | cgg | Glycine max (L.) Merr. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0659 | 30455712 | FRI | FRI (FRIGIDA, scaffold protein for vernalization complex) [Source: UniProt] | GCTCTTCAATCAGCTTAGCT | CGG | Brassica oleracea var. capitata L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0660 | 37797782 | OsNF-YC5 | regulates salt tolerance in rice | GCTCGACCTCAGGAATG | CGG | Oryza sativa L. | not found | not found | CRISPR-Cas9 |
| PCdb_0661 | 30625150 | RhJAZ | Jasmonate ZIM-domain protein JAZ | GCTCCCATGACCATCTTCTT | CGG | Arabidopsis thaliana (L.) Heynh. | 0.55 | protoplast | CRISPR-Cas9 |
| PCdb_0662 | 38925598 | LOC_Os09g32210 | taste quality | GCTCCAGTTCCTCCACTCAA | CGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_0663 | 31694550 | PDS | Phytoene desaturase | GCTCCAGCAGAGGAATGGAT | CGG | Triticum aestivum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0664 | 38925598 | LOC_Os10g42690 | taste quality | GCTCAGAACAATGCCGGCGA | CGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_0665 | 33859403 | OsCDC48-T1 | Rice cell division control protein 48 (AAA+ ATPase involved in cell cycle regulation) | GCTAGCTTTGACATAATCTC | CGG | Oryza sativa L. | not found | protoplast | Prime editor |
| PCdb_0666 | 29807545 | GFP | GFP (Green Fluorescent Protein, Aequorea victoria, transformation control) [Source: Addgene] | GCTAGCTTTGACATAATCTC | CGG | Oryza sativa L. | 0.014 | protoplast | ABE |
| PCdb_0667 | 38925598 | LOC_Os08g45110 | taste quality | GCTAGCATGGAGATGGACAT | CGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_0668 | 34764970 | FAD2 | Enhances Oleic Acid Production | GCTACCGTAGACAGAGACTA | CGG | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | Base editor |
| PCdb_0669 | 38925598 | LOC_Os01g38650 | taste quality | GCTACATCGTCGTCGGCGAC | CGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_0670 | 36374358 | LFY | LEAFY (floral meristem identity transcription factor) [Source: TAIR] | GCTACAGAGAAAGTTCTACT | CGG | Solanum tuberosum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0671 | 30254203 | not found | not found | GCGTGGTACGGGCCGTAGAC | CGG | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0672 | 34077267 | OsRAM2 | Function in Lipid Biosynthesis Is Required for Arbuscular Mycorrhizal Symbiosis in Rice | GCGTGGTACACCACGCGCAT | CGG | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0673 | 39752938 | OsNCED5 | Encodes a chloroplast-localized abscisic acid (ABA) biosynthetic enzyme that regulates reactive oxygen species (ROS) homeostasis to enhance cold stress tolerance | GCGTGGGAGGAGGCCGAGTC | CGG | Oryza sativa L. | not found | calli | CRISPR/Cas9 |
| PCdb_0674 | 37248636 | OsRLCK80 | Receptor-like cytoplasmic kinase | GCGTCTACAAGGGCGTCGTT | CGG | Oryza sativa L. | not found | protoplast | not found |
| PCdb_0675 | 38925598 | LOC_Os10g29540 | taste quality | GCGTCGGTGTCGGCACCGAG | CGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_0676 | 36245499 | Ae1Sbe1 | improves gut barrier function and ameliorates type II diabetes in high-fat diet-fed mice by increasing Akkermansia | GCGGTTTCTGGGGCGGTGCT | CGG | Zea mays L. | not found | Ae1 | CRISPR-Cas9 |
| PCdb_0677 | 38925598 | LOC_Os02g29140 | taste quality | GCGGCTCCTCCAGGCAGCGG | CGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_0678 | 38925598 | LOC_Os10g04980 | taste quality | GCGGCTCCGACGGCTGTCCC | CGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_0679 | 31487408 | Rf4 Bhlh | Restorer-of-fertility 4 bHLH transcription factor | GCGGCTCACCGAGAAGTTTA | CGG | Zea mays L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0680 | 38925598 | LOC_Os11g40530 | taste quality | GCGGCGGCAACGGCGTACAC | CGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_0681 | 36305009 | BES1 | BRI1-EMS suppressor 1 transcription factor | GCGGCGGAGAAGAGCTGTTG | CGG | Arabidopsis thaliana (L.) Heynh. | 0.2 | protoplast | CRISPR/Cas9 |
| PCdb_0682 | 37866445 | OsGSTU34 | essential for rice (Oryza sativa L.) organs coloration | GCGCTCCACCCGCGGAAGAG | cgg | Oryza sativa L. | not found | not found | CRISPR-Cas9 |
| PCdb_0683 | 38925598 | LOC_Os01g04190 | taste quality | GCGCGGTGATCGGAAGTCGC | CGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_0684 | 28349304 | Gn1a | Cytokinin oxidase/dehydrogenase | GCGCGGGGGTGTGGCCACT | CGG | Oryza sativa L. | 0.97 | protoplast | CRISPR-Cas9 |
| PCdb_0685 | 33346897 | Pp3c4_15350V3.1 (PHY5c) | Physcomitrella phytochrome 5c (Pp3c4_15350V3.1, light sensing) | GCGCGGCTACAATCCCTTCC | CGG | Physcomitrella patens (Hedw.) Bruch & Schimp. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0686 | 26188471 | OsU3 | Oryza sativa U3 small nucleolar RNA (OsU3, rRNA processing) | GCGCGCCACCTCGGCCGAAG | CGG | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0687 | 33324433 | TaPDS | Phytoene desaturase | GCGCCGCCGTCTTCGCCAC | CGG | Triticum aestivum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0688 | 30928637 | OsPDS | Oryza sativa phytoene desaturase (OsPDS, carotenoid biosynthesis) | GCGAGCTTGGTATTAATGAT | CGG | Oryza sativa L. | not found | protoplast | xCas9 |
| PCdb_0689 | 38925598 | LOC_Os07g20340 | taste quality | GCGACGCCAGCGGGTGGTTC | CGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_0690 | 38925598 | LOC_Os02g06690 | taste quality | GCGACGCAGTACAAGGTCGG | CGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_0691 | 37866445 | OsGSTU34 | essential for rice (Oryza sativa L.) organs coloration | GCCTTCGCCCCCCGCAGCAA | cgg | Oryza sativa L. | not found | not found | CRISPR-Cas9 |
| PCdb_0692 | 34042262 | OsGN1a | Cytokinin oxidase/dehydrogenase | GCCTGCAGGGCGGCGGCGCG | CGG | Oryza sativa L. | not found | seed | CBE |
| PCdb_0693 | 29735369 | fad2-1 | high oleiclow linoleic rice | GCCTCACTGCTTCCAGCGCT | CGG | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0694 | 28487703 | ENGase | Endoacetylglucosaminidase (ENGase): key regulator of cell differentiation | GCCGTTCGACGCTTCCAGGC | CGG | Hordeum vulgare L. | 0.067 | Immature embryos | CRISPR-Cas9 |
| PCdb_0695 | 25879861 | GFP3 | Reporter fluorescent protein | GCCGTGAGTGATCCCGGCGG | CGG | Glycine max (L.) Merr. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0696 | 31469505 | OsSERK2 | Somatic embryogenesis receptor kinase in developmental signaling | GCCGGACAGCTCCATTGCC | CGG | Oryza sativa L. | 0.667 | calli | ABE |
| PCdb_0697 | 32842152 | SPO11-2 | in meiosis in rice | gccgcggcagatCgggATGg | CGG | Arabidopsis thaliana (L.) Heynh. | not found | calli | CRISPR-Cas9 |
| PCdb_0698 | 38925598 | LOC_Os04g49500 | taste quality | GCCGCCTGACAGTAACCCTC | CGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_0699 | 36595531 | OsFRK3 | Oryza sativa Fructokinase 3 (OsFRK3, sugar metabolism) | GCCGCCGCCGCCCTTCACCG | CGG | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0700 | 29973285 | OsTB1 | TEOSINTE BRANCHED1 ortholog, controls tiller bud outgrowth and shoot branching. | GCCGCATGGGCAGCAGTGG | CGG | Oryza sativa L. | not found | protoplast | not found |
| PCdb_0701 | 39752938 | OsNCED5 | Encodes a chloroplast-localized abscisic acid (ABA) biosynthetic enzyme that regulates reactive oxygen species (ROS) homeostasis to enhance cold stress tolerance | GCCGCACGCGCTGCCGCGGA | CGG | Oryza sativa L. | not found | calli | CRISPR/Cas9 |
| PCdb_0702 | 34580960 | SlNAM 1 | regulates ethylene biosynthesis and the onset of tomato fruit ripening | GCCGATTGGAAATCCGAAAG | CGG | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0703 | 24920971 | BEL | BEL1 family transcription factor, regulates developmental processes | GCCGAGATCGACGCATCCGT | CGG | Oryza sativa L. | not found | calli | not found |
| PCdb_0704 | 33557889 | Gh_A11G2419 | Gh_A11G2419 (Gossypium hirsutum auxin response factor A11G2419) [Source: CottonGen] | GCCGAATCCAGCGTAAGAAG | CGG | Gossypium hirsutum L. | 0.5889 | seed | CRISPR-Cas9 |
| PCdb_0705 | 26842991 | FGS | FGS (Arabidopsis thaliana FATTY ACID ELONGASE6, very-long-chain fatty acid biosynthesis) [Source: TAIR] | GCCCTACTGAATCGATATAT | CGG | Zea mays L. | 0.024 | protoplast | CRISPR-Cas9 |
| PCdb_0706 | 38925598 | LOC_Os03g40440 | taste quality | GCCCGATGCCAACATCATCG | CGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_0707 | 36057005 | CsGCN5 | Histone acetyltransferase; regulates gene expression via chromatin modification. | GCCCCGTCGCGTGTTTCGG | CGG | Cucumis sativus L. | 0.024 | protoplast | CRISPR-Cas9 |
| PCdb_0708 | 29868058 | LEAFY | LFY encodes a transcription factor that regulates the expression of floral organ identity genes. | GCCCCCGCCTCAGCAGCCAC | CGG | Populus sp. | 0.775 | protoplast | CRISPR-Cas9 |
| PCdb_0709 | 29735370 | St16DOX | Potato 16伪-hydroxylase (St16DOX, steroidal glycoalkaloid biosynthesis) | GCCCAGTGCATGAAAGACCATCGG | CGG | Solanum tuberosum L. | not found | hairy root | CRISPR-Cas9 |
| PCdb_0710 | 36139477 | GhCLA 1 | GhCLA1 (Gossypium hirsutum 1-deoxy-D-xylulose 5-phosphate synthase, chloroplast development) [Source: CottonGen] | GCCATCCCACATAGCCGCAA | CGG | Gossypium hirsutum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0711 | 38925598 | LOC_Os03g62590 | taste quality | GCCAGCATCACCATGCTCGC | CGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_0712 | 31694550 | PDS | Phytoene desaturase | GCCAGATAAAACCCTTCGAT | CGG | Triticum aestivum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0713 | 33557889 | Gh_A06G0364 | Gh_A06G0364 (Gossypium hirsutum glutathione S-transferase, GST) [Source: CottonGen] | GCCAACGCGAGAGTGCATGG | CGG | Gossypium hirsutum L. | 0.5889 | seed | CRISPR-Cas9 |
| PCdb_0714 | 38925598 | LOC_Os04g13480 | taste quality | GCATCTGCGACAGGATCATG | CGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_0715 | 26842991 | FGS | FGS (Arabidopsis thaliana FATTY ACID ELONGASE53, very-long-chain fatty acid biosynthesis) [Source: TAIR] | GCATCCTATAACGACCTTTC | CGG | Zea mays L. | 0.38 | protoplast | CRISPR-Cas9 |
| PCdb_0716 | 38925598 | LOC_Os04g33870 | taste quality | GCATCAGCTCTGCTACCCGC | CGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_0717 | 26842991 | FGS | FGS (Arabidopsis thaliana FATTY ACID ELONGASE1, very-long-chain fatty acid biosynthesis) [Source: TAIR] | GCATAGTCTTGATATTATTC | CGG | Zea mays L. | 0.0522 | protoplast | CRISPR-Cas9 |
| PCdb_0718 | 38925598 | LOC_Os08g23870 | taste quality | GCAGTCGACCAAGGAGGCCG | CGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_0719 | 31694550 | PDS | Phytoene desaturase | GCAGGCTCTCCTGGCTCCTG | CGG | Triticum aestivum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0720 | 38925598 | LOC_Os04g33740 | taste quality | GCAGGCGGCTGCTACCACAG | CGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_0721 | 38925598 | LOC_Os01g06630 | taste quality | GCAGGACCCGGAGATCCGGG | CGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_0722 | 33440058 | Os02circ25329 | Circular RNA (potential regulatory function) | gcagctctgacatgtgggcc | CGG | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0723 | 39831348 | Brachytic2 | ABC transporter affecting auxin transport and internode elongation; loss-of-function results in reduced plant height in maize. | GCAGCGGCTGACGGGCGCGG | CGG | Zea mays L. | 0.49-1.12% | protoplast | CRISPR/Cas9 |
| PCdb_0724 | 38925598 | LOC_Os02g36680 | taste quality | GCAGCGGCGTCCCAACCAAC | CGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_0725 | 38925598 | LOC_Os02g06410 | taste quality | GCAGCAGCTGAGGACACCGG | CGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_0726 | 38925598 | LOC_Os09g36700 | taste quality | GCAGAGCAGAGCTATCCTGC | CGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_0727 | 36835599 | CHS7 | Chalcone synthase 7, key enzyme in flavonoid/anthocyanin biosynthesis | GCAGACTTCTCACGATCAAC | CGG | Glycine max (L.) Merr. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0728 | 38925598 | LOC_Os05g45020 | taste quality | GCACCTCCTGCTCGACCCGG | CGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_0729 | 34111225 | DMR6 | Downy Mildew Resistant 6 (salicylic acid hydroxylase) | GCACATACTGCAAAGAAGTT | cgg | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0730 | 30120167 | STP4 | Inhibits in Vitro Pollen Tube Growth | GCACAGATGAAAGGAAACAT | CGG | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0731 | 31694550 | PDS | Phytoene desaturase | GCAAGGTTCGCAATTCGGGA | CGG | Triticum aestivum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0732 | 38925598 | LOC_Os05g01230 | taste quality | GCAACGGAGGAGATCGACCT | CGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_0733 | 31823718 | not found | not found | GCAACGCTCCAGCAGCCT | CGG | Oryza sativa L. | not found | protoplast | not found |
| PCdb_0734 | 36269029 | CsCHS 1 | Chalcone synthase 1; committed enzyme in flavonoid biosynthesis. | GATTGCCGCGTGTGGTCTA | CGG | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0735 | 28790350 | BnaRGA | DELLA protein RGA homolog | GATTAAACCGGTGATTTTCA | CGG | Brassica napus L. | BnaA9.RGA:27.6%, BnaC9.RGA:31.0%, BnaA6.RGA:34.5%, BnaC7.RGA:41.4% | protoplast | CRISPR-Cas9 |
| PCdb_0736 | 36312444 | miR172b | MicroRNA 172b (flowering time regulation) [Source: miRBase] | GATGCTGCATCAGCCATAAA | CGG | Glycine max (L.) Merr. | not found | hairy root | CRISPR-Cas9 |
| PCdb_0737 | 38925598 | LOC_Os02g02560 | taste quality | GATCTGCGAGAGGCCGGCGA | CGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_0738 | 29036337 | CLE24 | CLE-Peptide-Encoding Genes | GATCTAATGAAGAAGTACTT | CGG | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0739 | 31316687 | HY5 | bZIP transcription factor HY5 | GATCGGCGACCGGTCAGGAG | CGG | Arabidopsis thaliana (L.) Heynh. | not found | seed | CRISPR-Cas9 |
| PCdb_0740 | 38925598 | LOC_Os08g41030 | taste quality | GATCGGCACGTTCCCGTCCC | CGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_0741 | 36903878 | not found | not found | GATCGCGTCAGCGCCGTCGT | CGG | Glycine max (L.) Merr. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0742 | 33557889 | Gh_A05G3926 | Gh_A05G3926 (Gossypium hirsutum NAC transcription factor, stress response) [Source: CottonGen] | GATCGACTCGAACCGTGGTT | CGG | Gossypium hirsutum L. | 0.5889 | seed | CRISPR-Cas9 |
| PCdb_0743 | 33396822 | PDS | Phytoene desaturase (PDS, carotenoid biosynthesis) | GATCATATCCAGTCATTGGG | CGG | Pyrus communis聽L. | 0.67 | protoplast | CRISPR-Cas9,Base editor |
| PCdb_0744 | 36679094 | PAIN-1 | Protein associated with INsensitivity-1 (PAIN-1, stress response) | GATCAATGGTACGATATTAA | CGG | Solanum tuberosum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0745 | 36756926 | not found | not found | GATATCCGAGGACGGCATCC | CGG | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0746 | 36613871 | PtrFLA40 and PtrFLA45 | Populus FASCICLIN-like arabinogalactan proteins 40/45 (PtrFLA40/45, cell wall) | GATATATGTAGGGTTGTGTC | CGG | Populus sp. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0747 | 28258551 | not found | not found | GATACCCAGATCATATGAAG | CGG | Gossypium hirsutum L. | 0.43 | seed | CRISPR-Cas9 |
| PCdb_0748 | 29884615 | PYRABACTIN RESISTANCE1-LIKE (PYL) | PYRABACTIN RESISTANCE1-LIKE ABA receptor (PYL, abscisic acid signaling) | GATAAGGCATCGGTGTTAAG | CGG | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0749 | 38925598 | LOC_Os11g47870 | taste quality | GAGTTCCTCCAGCTGCGGCG | CGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_0750 | 38925598 | LOC_Os07g13830 | taste quality | GAGTCGCCGCCGTCGTCCAC | CGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_0751 | 36246293 | not found | not found | GAGTCCACACGTTGTGATCG | CGG | Avicennia officinalis L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0752 | 33859403 | OsGAPDH | Oryza sativa Glyceraldehyde-3-phosphate dehydrogenase (OsGAPDH, glycolysis) | GAGTATGTCGTGGAGTCCAC | CGG | Oryza sativa L. | not found | protoplast | not found |
| PCdb_0753 | 32001363 | OsALS6 | Acetolactate synthase involved in branched-chain amino acid biosynthesis [Source: RiceWiki] | GAGGUCCCCCGCCGCAUGAU | CGG | Oryza sativa L. | not found | calli | CBE |
| PCdb_0754 | 32001363 | OsALS5 | Acetolactate synthase involved in branched-chain amino acid biosynthesis [Source: RiceWiki] | GAGGUCCCCCGCCGCAUGAU | CGG | Oryza sativa L. | not found | calli | CBE |
| PCdb_0755 | 32001363 | OsALS4 | Acetolactate synthase involved in branched-chain amino acid biosynthesis [Source: RiceWiki] | GAGGUCCCCCGCCGCAUGAU | CGG | Oryza sativa L. | not found | calli | CBE |
| PCdb_0756 | 32001363 | OsALS3 | Acetolactate synthase involved in branched-chain amino acid biosynthesis [Source: RiceWiki] | GAGGUCCCCCGCCGCAUGAU | CGG | Oryza sativa L. | not found | calli | CBE |
| PCdb_0757 | 32001363 | OsALS2 | Acetolactate synthase involved in branched-chain amino acid biosynthesis [Source: RiceWiki] | GAGGUCCCCCGCCGCAUGAU | CGG | Oryza sativa L. | not found | calli | CBE |
| PCdb_0758 | 38925598 | LOC_Os09g38030 | taste quality | GAGGCCCTCGAGCTTCACGT | CGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_0759 | 33150679 | TaPDS | Phytoene desaturase | GAGGCAAGAGATGTGTTGGG | CGG | Triticum aestivum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0760 | 31694550 | PDS | Phytoene desaturase | GAGGCAAGAGATGTGTTGGG | CGG | Triticum aestivum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0761 | 30783736 | not found | not found | GAGGATGGAGCCCAAGATCC | CGG | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0762 | 31394891 | SCL26 | Splicing factor-like protein 26 | GAGGACCTTCGTCGGCCATT | CGG | Oryza sativa L. | not found | callus | CRISPR-Cas9 |
| PCdb_0763 | 31394891 | SCL25 | RNA splicing coactivator-like protein | GAGGACCTTCGTCGGCCATT | CGG | Oryza sativa L. | not found | callus | CRISPR-Cas9 |
| PCdb_0764 | 38925598 | LOC_Os02g15350 | taste quality | GAGCGGCGGCGCATTATCCC | CGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_0765 | 38925598 | LOC_Os03g19900 | taste quality | GAGATGGCGCCGTTCGTCGG | CGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_0766 | 28690135 | SbaPKS | Polyketide synthase (SbaPKS) | GAGATGATAGCCGAAGAAAG | CGG | Shiraia bambusicola Henn | not found | protoplast | CRISPR-Cas9 |
| PCdb_0767 | 29250878 | BnCLV2 | CLAVATA2 receptor-like protein | GAGATCCCGCTGACTCTAGC | CGG | Brassica napus L. | 0.243 | seed | CRISPR-Cas9 |
| PCdb_0768 | 32841372 | BnCLV2 | regulates seed production | GAGATCCCGCTGACTCTAGC | CGG | Brassica napus L. | not found | seed | CRISPR-Cas9 |
| PCdb_0769 | 37248636 | OsRLCK301 | Receptor-like cytoplasmic kinase | GAGATCAGCGCCGAGTCGTT | CGG | Oryza sativa L. | not found | protoplast | not found |
| PCdb_0770 | 38925598 | LOC_Os04g43160 | taste quality | GAGAGGAAGGAGTGCAGGAA | CGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_0771 | 35755703 | not found | not found | GAGAGCACCGACTCATCGGC | CGG | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0772 | 38925598 | LOC_Os03g45210 | taste quality | GAGACGGTAGTACTGTTGGG | CGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_0773 | 33608974 | PHOT1 | Blue-light receptor phototropin-1 | gagaaggttaattcgaagg | cgg | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0774 | 26842991 | FGS | FGS (Arabidopsis thaliana FATTY ACID ELONGASE5, very-long-chain fatty acid biosynthesis) [Source: TAIR] | GAGAACGCCTCGCATGCCCA | CGG | Zea mays L. | 0.4827 | protoplast | CRISPR-Cas9 |
| PCdb_0775 | 38925598 | LOC_Os02g09290 | taste quality | GAGAACCACGACGACGACGG | CGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_0776 | 38925598 | LOC_Os07g41720 | taste quality | GACTGTCCAGAATCGCTTGA | CGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_0777 | 36070109 | TraesCS5A02G473800 | Wheat protein kinase (TraesCS5A02G473800, signal transduction) | GACGTAGACCCACGCGAGGG | CGG | Triticum aestivum L. | 0.77 | leaf | not found |
| PCdb_0778 | 30917862 | Glyma.10g037100 | Phenylalanine ammonia-lyase (Glyma.10g037100) [Source: SoyBase] | GACGTACTCGTGATTCCTC | CGG | Glycine max (L.) Merr. | not found | hairy root | CRISPR-Cas9 |
| PCdb_0779 | 31993066 | not found | not found | GACGCGCTCCACCGCGAGAT | CGG | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0780 | 27066031 | GS3 | Grain size regulator (GS3) | GACGCGCTCCACCGCGAGAT | CGG | Oryza sativa L. | 0.575 | Mature seeds | CRISPR-Cas9 |
| PCdb_0781 | 36660867 | OsCKX | Rice cytokinin oxidase/dehydrogenase (cytokinin catabolism enzyme) | gacgcctccatcacatcaga | cgg | Oryza sativa L. | not found | protoplast | CRISPR-Cas9,CRISPR-Cas12 |
| PCdb_0782 | 38925598 | LOC_Os03g57960 | taste quality | GACGCCATGGTCATCCCCGC | CGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_0783 | 38925598 | LOC_Os03g28330 | taste quality | GACGAGCTCATTGGGGTGGG | CGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_0784 | 34257043 | OsMLH1 | regulate synapsis and interference-sensitive crossover formation during meiosis in rice | GACGAGCCTTCGCCGCG | CGG | Oryza sativa L. | not found | chloroplast | CRISPR-Cas9 |
| PCdb_0785 | 30928637 | OsCDC48 | AAA-ATPase mediating protein degradation and stress responses | GACCAGCCAGCGTCTGGCGC | CGG | Oryza sativa L. | not found | protoplast | xCas9 |
| PCdb_0786 | 30582653 | OsCDC48 | AAA-type ATPase involved in protein degradation and stress responses | GACCAGCCAGCGTCTGGCGC | CGG | Oryza sativa L. | 0.08 | protoplast | CBE |
| PCdb_0787 | 31752697 | CDC48 | AAA-type ATPase involved in protein degradation | GACCAGCCAGCGTCTGGCGC | CGG | Oryza sativa L. | 0.667 | calli | CBE |
| PCdb_0788 | 31634585 | CDC48 | AAA-type ATPase involved in protein degradation | GACCAGCCAGCGTCTGGCGC | CGG | Oryza sativa L. | 0.06 | calli | ABE |
| PCdb_0789 | 31666960 | SVP | SHORT VEGETATIVE PHASE (SVP, flowering time) | GACATCGGCGTCGCAGAGAA | CGG | Arabidopsis thaliana (L.) Heynh. | 0.8 | seed | CRISPR-Cas9 |
| PCdb_0790 | 30588320 | NAC1 | a new positive regulator of tomato fruit ripening | GACAAGCCGGTGCTCACCGC | CGG | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0791 | 26842991 | FGS | FGS (Arabidopsis thaliana FATTY ACID ELONGASE51, very-long-chain fatty acid biosynthesis) [Source: TAIR] | GAATGGAGACGACCTGGGCG | CGG | Zea mays L. | 0.1246 | protoplast | CRISPR-Cas9 |
| PCdb_0792 | 33557889 | Gh_A11G2419 | Gh_A11G2419 (Gossypium hirsutum auxin response factor A11G2419) [Source: CottonGen] | GAATCCAGCGTAAGAAGCGG | CGG | Gossypium hirsutum L. | 0.5889 | seed | CRISPR-Cas9 |
| PCdb_0793 | 26842991 | FGS | FGS (Arabidopsis thaliana FATTY ACID ELONGASE49, very-long-chain fatty acid biosynthesis) [Source: TAIR] | GAAGTCGTCTCCACCCCGGC | CGG | Zea mays L. | 0.1926 | protoplast | CRISPR-Cas9 |
| PCdb_0794 | 33557889 | Gh_A13G1627 | Gh_A13G1627 (Gossypium hirsutum cytochrome P450 A13G1627) [Source: CottonGen] | GAAGGTTGAGATCGATCGGA | CGG | Gossypium hirsutum L. | 0.5889 | seed | CRISPR-Cas9 |
| PCdb_0795 | 35991410 | BnaTAA 1 | Tryptophan aminotransferase 1, catalyzes first step in auxin biosynthesis | GAAGCGATCAAAGAGTTGCA | CGG | Brassica napus L. | not found | protoplast | CRISPR-Cas9,SaCas9 |
| PCdb_0796 | 29797189 | Psy1 | Phytoene synthase 1 (Psy1) | GAAGCCGGATATACCTATTC | CGG | Solanum lycopersicum L. | 0.69 | Regenerated shoots | CRISPR-Cas9 |
| PCdb_0797 | 26842991 | FGS | FGS (Arabidopsis thaliana FATTY ACID ELONGASE44, very-long-chain fatty acid biosynthesis) [Source: TAIR] | GAAGCCCTCGAGAGTCATGA | CGG | Zea mays L. | 0.3384 | protoplast | CRISPR-Cas9 |
| PCdb_0798 | 32213123 | CVIF1 | Capsicum virus-induced factor 1 (plant-virus interaction) | GAAGACGGTGTGATCGACGC | CGG | Arabidopsis thaliana (L.) Heynh. | not found | seed | CRISPR-Cas9 |
| PCdb_0799 | 38925598 | LOC_Os10g32810 | taste quality | GAACTTGGCTCAGAGCGCCG | CGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_0800 | 34393601 | GFP | GFP (Green Fluorescent Protein, Aequorea victoria, transformation control) [Source: Addgene] | GAACTGGATGGTGATGTGAA | CGG | Zea mays L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0801 | 31684940 | EPSPS | 5-enolpyruvylshikimate-3-phosphate synthase | GAACTCCAATGCGGCCACTGA | CGG | Triticum aestivum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0802 | 39831348 | Brachytic2 | ABC transporter affecting auxin transport and internode elongation; loss-of-function results in reduced plant height in maize. | GAACGCGCACCGGTTCATCG | CGG | Zea mays L. | 0.49-1.12% | protoplast | CRISPR/Cas9 |
| PCdb_0803 | 31394891 | RSZ23 | Splicing factor with zinc finger motifs | GAACCTGGATCCGCGCGTGA | CGG | Oryza sativa L. | not found | callus | CRISPR-Cas9 |
| PCdb_0804 | 28066464 | DIPM | Disease-Interacting Protein Module (likely involved in plant-pathogen interactions) | GAACAAGCCGGCAAGGGGCT | CGG | Vitis vinifera L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0805 | 26839579 | Niben101Scf04205g03008 (XT1) | Xyloglucan endotransglucosylase/hydrolase protein 1 (cell wall modification) [Source: SolGenomics] | GAAAACACCGTCTTCGGAGA | CGG | Nicotiana attenuata Torr. ex S.Watson | not found | protoplast | CRISPR-Cas9 |
| PCdb_0806 | 31694550 | PDS | Phytoene desaturase | CTTGGCTTCCATGGAGGGTG | CGG | Triticum aestivum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0807 | 31694550 | PDS | Phytoene desaturase | CTTGGAGGCGACGGGGGCTT | CGG | Triticum aestivum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0808 | 29884615 | PYRABACTIN RESISTANCE1-LIKE (PYL) | PYRABACTIN RESISTANCE1-LIKE ABA receptor (PYL, abscisic acid signaling) | CTTGATAACTTGCGCCAGAG | CGG | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0809 | 31394891 | SC34 | Core spliceosome protein component | CTTCGGGAGGTCGGGGCCGC | CGG | Oryza sativa L. | not found | callus | CRISPR-Cas9 |
| PCdb_0810 | 31273916 | mGFP5 | modified green fluorescent protein | CTTCATATGATCTGGGTATC | CGG | Triticum aestivum L. | 48-78% | protoplast | CRISPR-Cas9 |
| PCdb_0811 | 33557889 | Gh_A13G0593 | Gh_A13G0593 (Gossypium hirsutum ERF transcription factor A13G0593) [Source: CottonGen] | CTTACCTTCTGCGAGGACTG | CGG | Gossypium hirsutum L. | 0.5889 | seed | CRISPR-Cas9 |
| PCdb_0812 | 32742269 | ZmGA20ox3 | Generation of Transgene-Free Semidwarf Maize Plants | CTGTCCTTCGGCTTCCACGA | CGG | Zea mays L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0813 | 32694014 | TaNP-A1 | Nucleoprotein A1 | CTGGTGGACCAGCCCATGGT | CGG | Triticum aestivum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0814 | 28349304 | LPA1 | Loose Plant Architecture1 (architecture regulator) | CTGGTCAAGCGCCCCGCGG | CGG | Oryza sativa L. | 0.67 | protoplast | CRISPR-Cas9 |
| PCdb_0815 | 37346168 | Solyc04g078420 | Tomato protein Solyc04g078420 (uncharacterized) | CTGGTAAATCCTGTCGTCTC | CGG | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0816 | 36901844 | TaWOX5 | Wheat WUSCHEL-related homeobox 5 | CTGGATGAAGGCCGGGATCCTGC | CGG | Triticum aestivum L. | 30.3-13.3% | Immature Embryos | not found |
| PCdb_0817 | 35406957 | OsGL 1 -11 | Oryza sativa Glossy 1-11 (OsGL1-11, cuticle wax biosynthesis) | CTGGAACTCGGTGAAGCTGC | CGG | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0818 | 27579989 | AtEDS1 (Col) right | Enhanced disease susceptibility 1 protein (Col-0 ecotype), right genomic position | CTGCGAAACTCCAGTCATGT | CGG | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0819 | 34834905 | FAD2 | FAD2 (Fatty acid desaturase 2, EC 1.14.19.2, linoleic acid biosynthesis) [Source: UniProt] | CTGCCTGCTCCACCAGAGTC | CGG | Glycine max (L.) Merr. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0820 | 34834905 | FAD2 & FATB | Fatty acid desaturase & Acyl-ACP thioesterase | CTGCCTGCTCCACCAGAGTC | CGG | Glycine max (L.) Merr. | 0.592 | hairy root | CRISPR-Cas9 |
| PCdb_0821 | 36840774 | OsU6a | Rice U6 small nuclear RNA promoter | CTGACAGAGGTCTTCATGCA | CGG | Triticum aestivum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0822 | 33557889 | Gh_A07G2334 | Gh_A07G2334 (Gossypium hirsutum tubulin beta chain A07G2334) [Source: CottonGen] | CTCGGATCCGGCCAAGCAAA | CGG | Gossypium hirsutum L. | 0.5889 | seed | CRISPR-Cas9 |
| PCdb_0823 | 38925598 | LOC_Os07g09814 | taste quality | CTCCTCCTGCTCGTCCCGGG | CGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_0824 | 28585692 | OsGCD1 | essential for rice fertility and required for embryo dorsal-ventral pattern formation and endosperm development | CTCCGCAAAACCCTCCTCCA | cgg | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0825 | 38925598 | LOC_Os01g53930 | taste quality | CTCCACCTCCTCGATCACAG | CGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_0826 | 32786122 | Ms26 | Pollen-specific cytochrome P450 fatty acid-hydroxylase (Ms26) | CTCATGATCATCGGCCGGAG | CGG | Setaria viridis (L.) P. Beauv. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0827 | 31446470 | Negfp | not found | CTACCTGCAGCACACCCACC | CGG | Nicotiana tabacum L. | 0.94 | protoplast | CRISPR-Cas9 |
| PCdb_0828 | 30375064 | not found | not found | CTACCTCACCTACGACCGCG | CGG | Oryza sativa L. | not found | protoplast | not found |
| PCdb_0829 | 30405669 | not found | not found | CTAACTGTATCGGTCACGG | CGG | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0830 | 30405669 | Pks401g | Polyketide synthase 401g | CTAACTCTATCGCTCACGC | CGG | Brassica napus L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0831 | 30542354 | not found | not found | CGTCTCCTACGGCGCAC | CGG | Hordeum vulgare L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0832 | 39861650 | Ehd2 | Modulating Heading and Salt Tolerance | CGTCGCCACCAGCGCCCG | CGG | Oryza sativa L. | not found | protoplast | CRISPR/Cas9 |
| PCdb_0833 | 38925598 | LOC_Os01g46910 | taste quality | CGTCGATTCACTGCCCGTCG | CGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_0834 | 36418747 | OsPUB 3 | Oryza sativa U-box E3 ubiquitin ligase 3 (OsPUB3, protein degradation) | CGTCCGACGGGGAGCTG | cgg | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0835 | 35741741 | TaDHL-7B | DEAD-box RNA helicase (DHL-7B) | CGTAGATGACTGCCCTGCAT | CGG | Triticum aestivum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0836 | 38925598 | LOC_Os07g44200 | taste quality | CGGGTTCGCGGAGTTCACCG | CGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_0837 | 33557889 | Gh_A03G1622 | Gh_A03G1622 (Gossypium hirsutum NAC domain protein NST1, secondary wall thickening) [Source: CottonGen] | CGGGGCTTCATTATGCCACG | CGG | Gossypium hirsutum L. | 0.5889 | seed | CRISPR-Cas9 |
| PCdb_0838 | 33828575 | OsWRKY93 | Functions Between Leaf Senescence and in Response to Biotic Stress in Rice | CGGGGAGGAGTACTACAGG | cgg | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0839 | 26842992 | GRMZM2G438243 (Hsg12) | Maize genome reference GRMZM2G438243 (Heat shock protein gene Hsg12) [Source: MaizeGDB] | cggcgtggcgccggagctca | cgg | Zea mays L. | 19-31% | protoplast | CRISPR-Cas9 |
| PCdb_0840 | 38925598 | LOC_Os10g18370 | taste quality | CGGCGATCGACCCGGACTGG | CGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_0841 | 33557889 | Gh_A07G2334 | Gh_A07G2334 (Gossypium hirsutum tubulin beta chain A07G2334) [Source: CottonGen] | CGGCCCGGTTAATCGAACAA | CGG | Gossypium hirsutum L. | 0.5889 | seed | CRISPR-Cas9 |
| PCdb_0842 | 33557889 | Gh_A12G1705 | Gh_A12G1705 (Gossypium hirsutum phytoene desaturase A12G1705) [Source: CottonGen] | CGGCAGGGCGAGTTGATGTT | CGG | Gossypium hirsutum L. | 0.5889 | seed | CRISPR-Cas9 |
| PCdb_0843 | 38925598 | LOC_Os05g49730 | taste quality | CGGAGGTGACGGCAAGGCCG | CGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_0844 | 31159296 | SOD7 | Superoxide dismutase [Cu-Zn] 7 | CGGAGATGACGTGGCGACGA | CGG | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0845 | 38925598 | LOC_Os10g04890 | taste quality | CGCTTCCGCCTGGACTACGA | CGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_0846 | 26269544 | MS45 | Male sterility protein 45 (pollen wall development) [Source: MaizeGDB] | CGCTGGCCGAGGTCGACTAC | cgg | Zea mays L. | not found | embryo | CRISPR-Cas9 |
| PCdb_0847 | 28349304 | BADH2 | Betaine aldehyde dehydrogenase | CGCGATCGGCGAGATGGCCA | CGG | Oryza sativa L. | 0.81 | protoplast | CRISPR-Cas9 |
| PCdb_0848 | 31634585 | ALS | Acetolactate synthase (branched-chain amino acid biosynthesis) | CGCCCCCACCCGGCCTCGAG | CGG | Oryza sativa L. | 0.05 | calli | ABE |
| PCdb_0849 | 38925598 | LOC_Os07g28850 | taste quality | CGCCCACGACCACCCGAGTA | CGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_0850 | 36382925 | not found | not found | CGCCACGCCGCAGCACTACC | CGG | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0851 | 31452351 | Glyma.06G069600 | Isoflavone 2'-hydroxylase (Glyma.06G069600) [Source: SoyBase] | CGCCACGATTCTTCTGACAG | CGG | Glycine max (L.) Merr. | 0.592 | hairy root | CRISPR-Cas9 |
| PCdb_0852 | 33751803 | Waxy | Granule-bound starch synthase (Waxy, starch biosynthesis) | CGCCAAGTACGACGCAACCA | CGG | Oryza sativa L. | 0.294 | calli | ABE |
| PCdb_0853 | 35569367 | OsHSD2 | is essential for lipid metabolism during rice caryopsis development | CGCATGTCGTCGGCGTCGTCGTCG | CGG | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0854 | 37346168 | Solyc06g065100 | Tomato protein Solyc06g065100 (uncharacterized) | CGCAGTTGGCGGCGGTGCTA | CGG | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0855 | 38925598 | LOC_Os03g40440 | taste quality | CGCAGTGCCAGACAGCGCGG | CGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_0856 | 27148303 | IR and Rep of CABs | Intergenic region and repetitive elements of chloroplast DNA [Source: NCBI] | CGCAGCAGCCTTAGCTACGC | CGG | Gossypium hirsutum L. | not found | germplasm | CRISPR-Cas9 |
| PCdb_0857 | 38925598 | LOC_Os11g31340 | taste quality | CGCACCTTGGTATTCCACTA | CGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_0858 | 38925598 | LOC_Os03g48310 | taste quality | CGATGCCGTCCTCAAGGAGT | CGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_0859 | 30455712 | FRI | FRI (FRIGIDA, scaffold protein for vernalization complex) [Source: UniProt] | CGATCGGGAGGAGGGAGACT | CGG | Brassica oleracea var. capitata L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0860 | 36518521 | ZmGSO | GSO/RPK signaling protein (ZmGSO, root growth regulation) | CGAGTTCACCGGAGCAATCC | CGG | Zea mays L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0861 | 38925598 | LOC_Os11g41860 | taste quality | CGAGCCGTGGACATGCTGCG | CGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_0862 | 34104938 | ZmCEP1 | is essential for kernel development in maize | CGAGCACTGAGCAGGTCGT | CGG | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0863 | 34104938 | ZmCEP1 | is essential for kernel development in maize | CGAGCACTGAGCAGGTCGT | CGG | Zea mays L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0864 | 38925598 | LOC_Os12g34300 | taste quality | CGAGATCACGCAGGAGACGG | CGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_0865 | 35178853 | ZmGDI伪 | GDP dissociation inhibitor 伪 (ZmGDI伪, vesicle trafficking) | CGACGTGATCGTTCTGGGCA | CGG | Zea mays L. | 0.4098 | seed | not found |
| PCdb_0866 | 35178853 | ZmGDI伪 | GDP dissociation inhibitor 伪 (ZmGDI伪, vesicle trafficking) | CGACGTGATCGTTCTGGGCA | CGG | Zea mays L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0867 | 33484494 | PsPP2Ab1 | Protein phosphatase 2A regulatory subunit B鈥?,CGACGGAGAGACATTCATGT" | CGG | Glycine max (L.) Merr. | not found | protoplast | CRISPR-Cas9 | not found |
| PCdb_0868 | 38925598 | LOC_Os09g04100 | taste quality | CGACACGCACAAGATGAGCG | CGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_0869 | 35456933 | GmBADH 2 | Enhances Soybean Aroma and Is a Functional Marker for Improving Soybean Flavor | CCTTCCACCCAACACATCAT | cgg | Glycine max (L.) Merr. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0870 | 38925598 | LOC_Os04g32080 | taste quality | CCTGGCGCAGCTCGCCGGAG | CGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_0871 | 38925598 | LOC_Os02g50630 | taste quality | CCTCTGCCCTCGACGAACAC | CGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_0872 | 31284391 | bnaMLPKs | M-locus protein kinase | CCTCTGAGCTCATATACTT | CGG | Brassica napus L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0873 | 31394891 | SC25 | Spliceosome component (25kD protein) | CCTCGGCCGCTACGGCCCAC | CGG | Oryza sativa L. | not found | callus | CRISPR-Cas9 |
| PCdb_0874 | 38925598 | LOC_Os04g10260 | taste quality | CCTCGCTCCCATCGTCGCAC | CGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_0875 | 33638281 | TaASN2 | Wheat with greatly reduced accumulation of free asparagine in the grain | CCTCGCAGTCACTGCCGGTC | CGG | Triticum aestivum L. | 0.64 | protoplast | CRISPR-Cas9 |
| PCdb_0876 | 33557889 | Gh_A05G2993 | Gh_A05G2993 (Gossypium hirsutum cytochrome P450, CYP450) [Source: CottonGen] | CCTAGGTATGATGACCGCCG | CGG | Gossypium hirsutum L. | 0.5889 | seed | CRISPR-Cas9 |
| PCdb_0877 | 38925598 | LOC_Os07g34620 | taste quality | CCTACTGGCCAACGACGTCA | CGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_0878 | 38925598 | LOC_Os12g05540 | taste quality | CCGTGACGTCGACGTACGTG | CGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_0879 | 31394891 | SCL28 | Putative splicing regulatory factor | CCGGGTACCGGAGCCGGAGC | CGG | Oryza sativa L. | not found | callus | CRISPR-Cas9 |
| PCdb_0880 | 31273916 | TaGASR7 | Wheat gibberellin-stimulated regulator protein 7 | CCGGGCACCTACGGCAACAA | CGG | Triticum aestivum L. | 48-78% | protoplast | CRISPR-Cas9 |
| PCdb_0881 | 37511211 | OsPG3 | a Plant-Height-Associated Gene | CCGGCATGACCGACCCGGCA | CGG | Oryza sativa L. | not found | not found | CRISPR-Cas9 |
| PCdb_0882 | 37018323 | PDS | Phytoene desaturase (PDS, carotenoid biosynthesis) | CCGGCAATAACGACCTTCAA | CGG | Vigna unguiculata (L.) Walp. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0883 | 37971599 | ZmRL6 | Maize receptor-like kinase 6 (ZmRL6, signaling pathway) | CCGCCTACCGCTACCCCGC | CGG | Hordeum vulgare L. | not found | not found | CRISPR-Cas9 |
| PCdb_0884 | 36840226 | PHOT2 | Phototropin 2 (PHOT2, blue light phototropism) | CCGATTATGTATGCTAGCAG | CGG | Lactuca sativa L. | 48-73% | cotyledon | CRISPR-Cas9 |
| PCdb_0885 | 33383688 | not found | Gene not detected or not annotated in the database | CCGACGAGCTGGAGAACAG | CGG | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0886 | 38925598 | LOC_Os03g06630 | taste quality | CCCTCCTCCGGCGAGCTCGG | CGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_0887 | 38925598 | LOC_Os05g49480 | taste quality | CCCGGTGACCGATCTCTGGG | CGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_0888 | 28066464 | DIPM | Disease-Interacting Protein Module (likely involved in plant-pathogen interactions) | CCCGCCTTTCCCCAGCATCT | CGG | Vitis vinifera L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0889 | 38925598 | LOC_Os10g04900 | taste quality | CCCCGTCGTCGAGTAGCACG | CGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_0890 | 28349304 | EP3 | Endopolygalacturonase (EP3) | CCCCAATCTTGGCCGGAAT | CGG | Oryza sativa L. | 0.5 | protoplast | CRISPR-Cas9 |
| PCdb_0891 | 31452351 | Glyma.13G056200 | Sucrose synthase (Glyma.13G056200) [Source: SoyBase] | CCCATGGTGAATTTGGAAGG | CGG | Glycine max (L.) Merr. | 0.592 | hairy root | CRISPR-Cas9 |
| PCdb_0892 | 36895877 | TaTFL1-5 | decreases tiller and spikelet numbers in common wheat | CCATGAGCTCTACCCATCAG | CGG | Triticum aestivum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0893 | 33557889 | Gh_A06G0936 | Gh_A06G0936 (Gossypium hirsutum phytoene synthase, carotenoid biosynthesis) [Source: CottonGen] | CCATCTCCGCCCAGAGGCTA | CGG | Gossypium hirsutum L. | 0.5889 | seed | CRISPR-Cas9 |
| PCdb_0894 | 31694550 | PDS | Phytoene desaturase | CCATACTGAAGCAAGTAGTC | CGG | Triticum aestivum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0895 | 34042262 | not found | not found | CCACCCCTCCATCTCCTCCA | CGG | Oryza sativa L. | 0.32 | protoplast | CBE |
| PCdb_0896 | 34347875 | not found | Gene not detected or not annotated in the database | CCACCCAATTAATAAAGCTT | CGG | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0897 | 33557889 | Gh_A11G1758 | Gh_A11G1758 (Gossypium hirsutum chalcone synthase A11G1758) [Source: CottonGen] | CCACAACTACAGCAATCGTG | CGG | Gossypium hirsutum L. | 0.5889 | seed | CRISPR-Cas9 |
| PCdb_0898 | 36840774 | OsU3a | Rice U3 small nuclear RNA promoter | CCAAGTTATCCCTGCTGAAAA | CGG | Triticum aestivum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0899 | 37346168 | Solyc09g010820 | Tomato protein Solyc09g010820 (uncharacterized) | CATTGCACTTCCGATCTATC | CGG | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0900 | 37299168 | LOC 0s09g15240 | Transcriptional activator protein (Os09g15240 locus) [Source: RAP-DB] | CATTCGACCGTCTCAATCTT | CGG | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0901 | 38925598 | LOC_Os01g39020 | taste quality | CATGTGGGAATTGGGATGCG | CGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_0902 | 29973285 | OsSPL14 | Transcription factor regulating tillering and plant architecture (e.g., IPA1 allele increases yield). | CATGTAGCTACCCGCTGG | CGG | Oryza sativa L. | not found | protoplast | not found |
| PCdb_0903 | 38925598 | LOC_Os07g20110 | taste quality | CATGGGCCCTAGCAACTCAT | CGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_0904 | 38925598 | LOC_Os09g39920 | taste quality | CATGGGCATGGCGGGCAGTG | CGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_0905 | 38925598 | LOC_Os02g49410 | taste quality | CATGGATCAGGTCAAGAAGG | CGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_0906 | 38925598 | LOC_Os05g35690 | taste quality | CATGGACAAGCTTACGCCAT | CGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_0907 | 38925598 | LOC_Os05g35690 | taste quality | CATGCTCTCAGGCACATCTT | CGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_0908 | 32933485 | PDS | Phytoene desaturase (PDS, carotenoid biosynthesis) | CATCTTTCTGCAATGGTCCA | CGG | Musa acuminata Colla | 0.056 | protoplast | CRISPR-Cas9 |
| PCdb_0909 | 30917862 | Glyma.10g037100 | Phenylalanine ammonia-lyase (Glyma.10g037100) [Source: SoyBase] | CATCTTACTCACCTTATCCC | CGG | Glycine max (L.) Merr. | not found | hairy root | CRISPR-Cas9 |
| PCdb_0910 | 36818855 | Osv-ATPase d | Vacuolar ATPase subunit d | CATCGTGCGGGGGAACCGGT | CGG | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0911 | 36534157 | TaGAMYB | regulates flowering time and fertility | CATCCTCCGTCGTTGTCCA | CGG | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0912 | 30375064 | not found | not found | CATCCCCTGGCTCAGCTGGG | CGG | Oryza sativa L. | not found | Cell Wall | CRISPR-Cas9 |
| PCdb_0913 | 31694550 | PDS | Phytoene desaturase | CATAGTTGCTTCGATGATTT | CGG | Triticum aestivum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0914 | 28066464 | DIPM | Disease-Interacting Protein Module (likely involved in plant-pathogen interactions) | CAGTTTCTAGAAGCTTCGAG | CGG | Vitis vinifera L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0915 | 37346168 | Solyc04g078420 | Tomato protein Solyc04g078420 (uncharacterized) | CAGTCCGACCCGATAACAAA | CGG | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0916 | 29575650 | NRT1.1B | Nitrate transporter 1.1B, mediates nitrate uptake and signaling in rice | CAGGTCGGCGGCGGAGTCGC | CGG | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0917 | 30272679 | TaALS | Wheat acetolactate synthase | CAGGTCCCCCGCCGCATGAT | CGG | Triticum aestivum L. | 0.38 | protoplast | PBE |
| PCdb_0918 | 33165814 | OsALS | Acetolactate synthase (branched-chain amino acid biosynthesis) | CAGGTCCCCCGCCGCATGAT | CGG | Oryza sativa L. | 0.35 | protoplast | not found |
| PCdb_0919 | 30988404 | ALS | Acetolactate synthase | CAGGTCCCCCGCCGCATGAT | CGG | Triticum aestivum L. | not found | leaf | CBE |
| PCdb_0920 | 34191398 | eCDAL | Engineered cytidine deaminase-activating enzyme (likely used in base editing systems) | CAGGTCCCCCGCCGCATGAT | CGG | Oryza sativa L. | not found | calli | CBE |
| PCdb_0921 | 39901278 | OsALS | Acetolactate synthase catalyzing the first step of branched-chain amino acid biosynthesis (valine, leucine, isoleucine) and target of herbicide inhibition in rice. | CAGGTCCCCCGCCGCATGAT | CGG | Oryza sativa L. | not found | protoplast | Base editing |
| PCdb_0922 | 30819931 | ALS | Acetolactate synthase, target site of ALS-inhibitor herbicides and essential for branched-chain amino acid biosynthesis | CAGGTCCCCCGCCGCATGAT | CGG | Oryza sativa L. | 0.727 | calli | ABE |
| PCdb_0923 | 30819931 | ALS | Acetolactate synthase, target site of ALS-inhibitor herbicides and essential for branched-chain amino acid biosynthesis | CAGGTCCCCCGCCGCATGAT | CGG | Oryza sativa L. | 0.714 | calli | ABE |
| PCdb_0924 | 36630019 | EgFAD2 | Oil palm Fatty Acid Desaturase?2 (EgFAD2)6 desaturase in lipid metabolism | CAGGTACATCAACAACCCCCCGG | CGG | Elaeis guineensis Jacq. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0925 | 34608972 | TT4 | Chalcone synthase (TT4) | CAGGCGACAAGTCGACAATT | CGG | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0926 | 31694550 | PDS | Phytoene desaturase | CAGCAGAGGAATGGATCGGA | CGG | Triticum aestivum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0927 | 35599865 | not found | not found | CAGATCACAAACTTCAATG | CGG | Zea mays L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0928 | 28670755 | OsHAK1 | High-affinity potassium transporter (OsHAK1) | CAGAGCGTGGGCATCATCTA | CGG | Oryza sativa L. | 0.83 | root | CRISPR-Cas9 |
| PCdb_0929 | 34374880 | LOC9269602 | Hypothetical protein LOC9269602 [Source: NCBI] | CAGAAGAGAGAGAGCACAAT | CGG | Oryza sativa L. | not found | seed | CRISPR-Cas9 |
| PCdb_0930 | 34374880 | LOC4347178 | Hypothetical protein LOC4347178 [Source: NCBI] | CAGAAGAGAGAGAGCACAAT | CGG | Oryza sativa L. | not found | seed | CRISPR-Cas9 |
| PCdb_0931 | 34374880 | LOC107278729 | Hypothetical protein LOC107278729 [Source: NCBI] | CAGAAGAGAGAGAGCACAAT | CGG | Oryza sativa L. | not found | seed | CRISPR-Cas9 |
| PCdb_0932 | 38925598 | LOC_Os02g28580 | taste quality | CACGCCATGTACCTGTCGAA | CGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_0933 | 37191128 | not found | not found | CACGACAAGGAGGAATTCTG | CGG | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0934 | 32786122 | Ms26 | Pollen-specific cytochrome P450 fatty acid hydroxylase (Ms26) | CACGACAAGGAGGAATTCTG | CGG | Setaria viridis (L.) P. Beauv. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0935 | 38925598 | LOC_Os07g48170 | taste quality | CACCGTAGTCCCGCCGGCCG | CGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_0936 | 37584314 | Cl97C03G057690.1 (CIPID) | regulates the initiation and morphogenesis of watermelon lateral organs | CACCCCGAACCGGTTTATCT | CGG | Arabidopsis thaliana (L.) Heynh. | not found | not found | CRISPR-Cas9 |
| PCdb_0937 | 28905515 | VvWRKY52 | Vitis vinifera WRKY transcription factor 52 (VvWRKY52, defense response) | CACAGGCCGCCGCAGCAGG | CGG | Vitis vinifera L. | 0.1667 | protoplast | CRISPR-Cas9 |
| PCdb_0938 | 33931634 | VvbZIP36 | Vitis vinifera bZIP transcription factor 36 (VvbZIP36, stress signaling) | CACAGGCCGCCGCAGCAGG | CGG | Vitis vinifera L. | not found | calli | CRISPR-Cas9 |
| PCdb_0939 | 32782475 | BELL15 | BEL1-like homeodomain protein 15, involved in plant development and differentiation | CACACGTGGCACAGCGAAGC | CGG | Populus sp. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0940 | 29867128 | AtALS & AtPDS & AtFT & AtLFY | Acetolactate synthase (ALS), Phytoene desaturase (PDS), Flowering locus T (FT), and Leafy (LFY) - Multiple gene targets for plant genetic studies | CACACACACACCGCAACAGA | CGG | Arabidopsis thaliana (L.) Heynh. | 0.0784 | protoplast | ABE |
| PCdb_0941 | 31694550 | PDS | Phytoene desaturase | CAATGAAATGCTTACTTGGC | CGG | Triticum aestivum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0942 | 29362095 | HSA1 | HEAT SHOCK PROTEIN 90-1, molecular chaperone involved in protein folding | CAAGTGATGATGAGAGTGA | CGG | Oryza sativa L. | not found | chloroplast | CRISPR-Cas9 |
| PCdb_0943 | 34218480 | LPA2 | Low phytic acid 2 (inositol phosphate metabolism) | CAAGGGCTTTGGTTCAGAGA | CGG | Arabidopsis thaliana (L.) Heynh. | not found | Thylakoids | CRISPR-Cas9 |
| PCdb_0944 | 36070109 | TaUPL3 | Ubiquitin-protein ligase 3 | CAAGGAGCAGCAGGAGCCCT | CGG | Triticum aestivum L. | 0.77 | leaf | not found |
| PCdb_0945 | 30644027 | DcMYB113 | MYB transcription factor 113 | CAAGAGAGGGGACTTCGCTG | CGG | Daucus carota subsp. sativus (Hoffm.) Sch眉bl. & G.Martens | not found | protoplast | CRISPR-Cas9 |
| PCdb_0946 | 33557889 | Gh_A11G1758 | Gh_A11G1758 (Gossypium hirsutum chalcone synthase A11G1758) [Source: CottonGen] | CAACTACAGCAATCGTGCGG | CGG | Gossypium hirsutum L. | 0.5889 | seed | CRISPR-Cas9 |
| PCdb_0947 | 38925598 | LOC_Os06g15430 | taste quality | CAACAAGGCAAAGCTGGTCC | CGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_0948 | 30603093 | SlGRAS8 | GRAS family transcription factor | CAAATTAGAACCGTTGGTAG | CGG | Solanum lycopersicum L. | 0.0069 | Germ Cells | CRISPR-Cas9 |
| PCdb_0949 | 36058302 | GluB1 | Glutenin subunit B1 (seed storage protein) [Source: UniProt] | CAAACCCATGGCATAGTCCT | CGG | Oryza sativa L. | not found | calli | not found |
| PCdb_0950 | 35906898 | not found | not found | CAAACATCTTCCCGATGGAA | CGG | Oryza sativa L. | not found | seed | CRISPR-Cas9 |
| PCdb_0951 | 31932727 | OsAAT | Amino acid transporter protein | CAAAACACCTTACCTCGGTC | CGG | Oryza sativa L. | 0.04 | calli | ABE |
| PCdb_0952 | 31932727 | OsAAT | Amino acid transporter protein | CAAAACACCTTACCTCGGTC | CGG | Oryza sativa L. | 0.11 | calli | ABE |
| PCdb_0953 | 31932727 | OsAAT | Amino acid transporter protein | CAAAACACCTTACCTCGGTC | CGG | Oryza sativa L. | 0.043 | calli | ABE |
| PCdb_0954 | 31932727 | OsAAT | Amino acid transporter protein | CAAAACACCTTACCTCGGTC | CGG | Oryza sativa L. | 0.005 | calli | ABE |
| PCdb_0955 | 36430441 | SlACO2 | on Male-Sterility | ATTGGTTGAGAACAGGGGTAA | CGG | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0956 | 31991936 | FWL | FWL (FW2-2-like cell number regulator, plasma membrane-associated) [Source: UniProt] | ATTGAAGCAGGCGAAGAGTC | CGG | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0957 | 31694550 | PDS | Phytoene desaturase | ATTCGGGACGGTCTTGTAAA | CGG | Triticum aestivum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0958 | 29332168 | F3H | Flavanone 3-hydroxylase | ATTAGAGCCCGGGACTACT | CGG | Daucus carota subsp. sativus (Hoffm.) Sch眉bl. & G.Martens | 0.9 | callus | CRISPR-Cas9 |
| PCdb_0959 | 33751803 | Waxy | Granule-bound starch synthase (Waxy, starch biosynthesis) | ATTACAAAGACAACCAGATG | CGG | Oryza sativa L. | 0.667 | calli | ABE |
| PCdb_0960 | 33768632 | BdFAR4 | Fatty acyl-CoA reductase 4 | ATGTCGAATCGGCAAAGCTT | CGG | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0961 | 30652290 | PDS | phytoene desaturase | ATGGCTGCTGAATCAGAGCA | CGG | Hemisorghum C.E.Hubb. ex Bor | not found | protoplast | CRISPR-Cas9 |
| PCdb_0962 | 30652290 | CAD | cinnamyl alcohol dehydrogenase | ATGGCTGCTGAATCAGAGCA | CGG | Hemisorghum C.E.Hubb. ex Bor | not found | protoplast | CRISPR-Cas9 |
| PCdb_0963 | 32854250 | OsBHY, OsEHY, OsWaxy | Rice beta-hydroxyacyl-ACP dehydratase, enoyl-ACP reductase, and granule-bound starch synthase (three enzymes involved in fatty acid and starch biosynthesis) | ATGGCCCCCTGGAGCAAGAC | CGG | Oryza sativa L. | 1 | protoplast | CRISPR-Cas9 |
| PCdb_0964 | 35487656 | AhFatB | Arachis hypogaea fatty acyl-ACP thioesterase B, terminates fatty acid synthesis and releases saturated fatty acids | ATGCTCCTTCAAAGATCAA | CGG | Arachis hypogaea L. | 0.0286 | protoplast | CRISPR-Cas9 |
| PCdb_0965 | 33324433 | TaPDS | Phytoene desaturase | ATGCGAACCCTCCTCCCGT | CGG | Triticum aestivum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0966 | 36638269 | OsTKPR2 | is part of a sporopollenin-producing metabolon required for exine formation in rice | ATGCCGGAGTACTGCGTCAC | CGG | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0967 | 27995308 | ClPDS | Phytoene desaturase, involved in carotenoid biosynthesis (converts phytoene to carotene) | ATGCCGCTAGAGTGGTGCC | CGG | Citrullus lanatus (Thunb.) Matsum. & Nakai | 1 | protoplast | CRISPR-Cas9 |
| PCdb_0968 | 31452351 | Glyma.15G049600 Glyma.08G183000 | MYB transcription factor (Glyma.15G049600 & Glyma.08G183000) [Source: SoyBase] | ATGCAGCGAGGCTTCAAGCA | CGG | Glycine max (L.) Merr. | 0.592 | hairy root | CRISPR-Cas9 |
| PCdb_0969 | 36402381 | BnHOS1 | High expression of osmotically responsive genes 1, negative regulator of cold signaling | ATGATCTGGTGCATAAGACA | cgg | Brassica napus L. | not found | Nuclear Pore | CRISPR-Cas9 |
| PCdb_0970 | 38925598 | LOC_Os02g04330 | taste quality | ATGAGATTATACTCCCTTCC | CGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_0971 | 38060616 | not found | not found | ATCGTCGTATCACAGTAAAG | CGG | Zea mays L. | not found | inflorescence | CRISPR-Cas9 |
| PCdb_0972 | 35216463 | not found | not found | ATCGAGTCGTGGGTGGCCAC | CGG | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0973 | 34129189 | not found | not found | ATCGACCAGGATGACGATT | CGG | Oryza sativa L. | not found | protoplast | not found |
| PCdb_0974 | 31694550 | PDS | Phytoene desaturase | ATCGAAGGGTTTTATCTGGC | CGG | Triticum aestivum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0975 | 34890109 | not found | not found | ATCCGTGACCCGACGCGGCA | CGG | Oryza sativa L. | not found | protoplast | not found |
| PCdb_0976 | 36518521 | ZmGSO | GSO/RPK signaling protein (ZmGSO, root growth regulation) | ATCACAACAAGCTCACCGGT | CGG | Zea mays L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0977 | 31694550 | PDS | Phytoene desaturase | ATAGCAAACTTCACCTTCTC | CGG | Triticum aestivum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0978 | 29616073 | APETALA2 | Lead to Sepal Modification | ATAGAGGCGTTACGTTTTAC | CGG | Brassica napus L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0979 | 33557889 | Gh_D06G1876 | Gh_D06G1876 (Gossypium hirsutum MYB transcription factor D06G1876) [Source: CottonGen] | ATAGACGCAGACCATCTGAT | CGG | Gossypium hirsutum L. | 0.5889 | seed | CRISPR-Cas9 |
| PCdb_0980 | 33810044 | Grain Size 3 | Confers Increased RiceGrain Length | AGTGACATGGCAATGGCGG | CGG | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0981 | 27628577 | GS3 | Grain size regulator | AGTGACATGGCAATGGCGG | CGG | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0982 | 34274523 | TaPDS | Wheat phytoene desaturase | AGTCTTTTGGGTGGTGAGGTC | CGG | Triticum aestivum L. | 12.9-100% | protoplast | not found |
| PCdb_0983 | 31373135 | TaPDS | Wheat phytoene desaturase | AGTCTTTGGGTGGTGAGGTC | CGG | Triticum aestivum L. | 11.1-50.0% | seed | not found |
| PCdb_0984 | 31694550 | PDS | Phytoene desaturase | AGTCTTTGGGTGGTGAGGTC | CGG | Triticum aestivum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0985 | 31264225 | OsPEX5 | regulates rice spikelet development through modulating jasmonic acid biosynthesis | AGTCGATCATCGAGGGGTCT | CGG | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0986 | 37346168 | Solyc01g111500 | Tomato protein Solyc01g111500 (uncharacterized) | AGTAATTAATCCATCGGAGA | CGG | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0987 | 32096325 | B. napus | Brassica napus marker gene (species identifier) | AGGTCCCTCGCCGGATGAT | CGG | Brassica napus L. | not found | protoplast | CRISPR-Cas9,Base editor |
| PCdb_0988 | 34042262 | OsALS | Acetolactate synthase | AGGTCCCCCGCCGCATGAT | CGG | Oryza sativa L. | 0.009 | protoplast | CBE |
| PCdb_0989 | 35903231 | CPR5 | constitutive pathogen response 5 | AGGCTGCGGCGTTCAAACGA | CGG | Glycine max (L.) Merr. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0990 | 31159296 | DPA7 | Regulation of Inflorescence Architecture | AGGCTCCTCATCCTCCGTCG | CGG | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0991 | 35485960 | SPO11-2 | increase crossover frequency | AGGCTAATCTTTGTTTGTCAA | CGG | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0992 | 30887096 | rft1-3 | Rice florigen transporter 1, involved in florigen transport | AGGATCGTCCCTGCCGCTGC | CGG | Oryza sativa L. | not found | leaf | CRISPR-Cas9 |
| PCdb_0993 | 38925598 | LOC_Os05g47820 | taste quality | AGGAGGCGACGCTCCTGTGG | CGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_0994 | 38925598 | LOC_Os09g30240 | taste quality | AGCTTGTGGAGCTCGAGCGA | CGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_0995 | 32225072 | OsNAC006 | Oryza sativa NAC006 transcription factor (OsNAC006, stress response) | AGCTGGTCCTCCGACCGCGG | CGG | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_0996 | 34376154 | GUX1 | not found | AGCTGCAGGTTGGAAACTG | CGG | Pinus radiata D. Don | not found | embryo | CRISPR-Cas9 |
| PCdb_0997 | 38925598 | LOC_Os03g46100 | taste quality | AGCGCCGCAGTGATGTCTCG | CGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_0998 | 38925598 | LOC_Os03g22470 | taste quality | AGCGCCGAACAGCAGATTCG | CGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_0999 | 38925598 | LOC_Os08g35670 | taste quality | AGCGAGGATCTCGTTCTTCC | CGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_1000 | 29259295 | RLP1 | RLP1 receptor-like protein (pathogen recognition) | AGCCTGTATATCACCAAGCC | CGG | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1001 | 30582653 | OsROC5 | Regulates leaf rolling and drought tolerance in rice | AGCCAGCTGCTTACAAAAC | CGG | Oryza sativa L. | 0.03 | protoplast | not found |
| PCdb_1002 | 38925598 | LOC_Os03g26490 | taste quality | AGCACCGCTGCAGCTAACGG | CGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_1003 | 36499273 | BnaCOL9 | Advances the Flowering Time | AGCAAGAGCTGATGTGAGA | CGG | Brassica napus L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1004 | 29511025 | LsNCED4 | 9-cis-epoxycarotenoid dioxygenase 4 (abscisic acid biosynthesis) [Source: NCBI] | AGCAAGAATTATCGTTAGGC | CGG | Lactuca sativa L. | 0.333 | protoplast | CRISPR-Cas9 |
| PCdb_1005 | 38005766 | GmNHL1 | NDR1/HIN1-like protein 1 (disease response) | AGATTACGTAGATTTCGAGG | CGG | Glycine max (L.) Merr. | not found | not found | CRISPR-Cas9 |
| PCdb_1006 | 38925598 | LOC_Os06g41800 | taste quality | AGAGGTCCAAGAATTAATGG | CGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_1007 | 33015536 | AGO4 & NRPD1a & NRPE1 & RDR2 & RDR4 & RDR6 & CHLI1 & PIE1 | Multi-gene complex: RNA-directed DNA methylation machinery (small RNA biogenesis and chromatin modification) | AGAGGCAGACGTTAATGCAG | CGG | Arabidopsis thaliana (L.) Heynh. | 0.79 | seed | CRISPR-Cas9 |
| PCdb_1008 | 28499063 | GhCLA1 | GhCLA1 (Gossypium hirsutum 1-deoxy-D-xylulose 5-phosphate synthase, chloroplast development) [Source: CottonGen] | AGAGCTGCTGACAAGTATCA | CGG | Gossypium hirsutum L. | 1 | hypocotyl | CRISPR-Cas9 |
| PCdb_1009 | 31634585 | SPL14 | Ideal Plant Architecture 1 gene controlling tillering and panicle structure | AGAGAGAGCACAGCTCGAGT | CGG | Oryza sativa L. | 0.44 | calli | ABE |
| PCdb_1010 | 31469505 | OsSPL14 | Ideal Plant Architecture 1 (SPL14) controlling tillering and panicle structure | AGAGAGAGCACAGCTCGAGT | CGG | Oryza sativa L. | 0.375 | calli | ABE |
| PCdb_1011 | 30928636 | OsSPL14 | Ideal Plant Architecture gene (SPL14) regulating tiller number | AGAGAGAGCACAGCTCGAGT | CGG | Oryza sativa L. | not found | calli | ABE |
| PCdb_1012 | 33557889 | Gh_A13G1973 | Gh_A13G1973 (Gossypium hirsutum peroxidase A13G1973) [Source: CottonGen] | AGAGAACCGAGTATCTTGAT | CGG | Gossypium hirsutum L. | 0.5889 | seed | CRISPR-Cas9 |
| PCdb_1013 | 36139477 | GhCLA 1 | GhCLA1 (Gossypium hirsutum 1-deoxy-D-xylulose 5-phosphate synthase, chloroplast development) [Source: CottonGen] | AGACCTCCTGACAAGTATCA | CGG | Gossypium hirsutum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1014 | 38925598 | LOC_Os11g15620 | taste quality | AGACCACATAAGCGCTCTCC | CGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_1015 | 33925088 | MIR172c | Required for Floral Organ Identity and Number in Tomato | AGAATCTTGATGATGCTGCAG | CGG | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1016 | 38925598 | LOC_Os04g45020 | taste quality | AGAAGCCCAAGGTGCACTAC | CGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_1017 | 29867128 | LFY | LEAFY (floral meristem identity transcription factor) [Source: TAIR] | AGAAGCAACAGCAGCAGAGA | CGG | Arabidopsis thaliana (L.) Heynh. | 0.76 | protoplast | ABE |
| PCdb_1018 | 29577542 | MORC1 | Microrchidia CW-type zinc finger 1 (chromatin remodeling) [Source: TAIR] | ACTTCGGGTGCACCCGCGCG | CGG | Hordeum vulgare L. | 70-100% | calli | CRISPR-Cas9 |
| PCdb_1019 | 29577542 | MORC1 | Microrchidia CW-type zinc finger 1 (chromatin remodeling) [Source: TAIR] | ACTTCGGGTGCACCCGCGCG | CGG | Hordeum vulgare L. | 70-100% | calli | CRISPR-Cas9 |
| PCdb_1020 | 35485960 | ATSPO11-1 | increase crossover frequency | ACTTATATCAGAAATAAAAA | CGG | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1021 | 30917862 | Glyma.20g148200 | Flavonoid 3'-hydroxylase (Glyma.20g148200) [Source: SoyBase] | ACTCTCTTTGAGAACCAAAA | CGG | Glycine max (L.) Merr. | not found | hairy root | CRISPR-Cas9 |
| PCdb_1022 | 33420305 | not found | Gene not detected or not annotated in the database | ACTACAAGAGCCGCCACTTC | CGG | Oryza sativa L. | not found | chloroplast | CRISPR-Cas9 |
| PCdb_1023 | 38925598 | LOC_Os01g03660 | taste quality | ACGTAGAGCGTGTTGGGCAT | CGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_1024 | 38925598 | LOC_Os03g51350 | taste quality | ACGGGACTCGGCTTCGCGCT | CGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_1025 | 36430644 | Sp126 | Spinach protein Sp126 (chloroplast-associated, unknown function) | ACGGCGACCGTGAGGCCGTT | CGG | Oryza sativa L. | not found | protoplast | not found |
| PCdb_1026 | 34908145 | not found | not found | ACGGATCCACCTCCCTGCAG | cgg | Triticum aestivum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1027 | 33790930 | TaQsd 1 | Seedormancy Qsd1 protein | ACGGATCCACCTCCCTGCAG | CGG | Triticum aestivum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1028 | 32821233 | TaQsd1 | Seedormancy Qsd1 protein | ACGGATCCACCTCCCTGCAG | CGG | Triticum aestivum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1029 | 27986915 | ScFtsz2-1 | responsible for chloroplast division, and mutations result in the development of large chloroplasts | ACGCGCGGGCTCGCAGC | CGG | Scopelophila cataractae (Mitt.) Kindb. | 0.687 | protoplast | CRISPR-Cas9 |
| PCdb_1030 | 36616184 | OsOr | Oryza sativa Orange protein (OsOr, carotenoid accumulation) | ACGCCTGCAGCAGCGTCGTT | CGG | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1031 | 38925598 | LOC_Os12g38340 | taste quality | ACGACGACAACGATGCAGTA | CGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_1032 | 27986915 | ScFtsz2-1 | responsible for chloroplast division, and mutations result in the development of large chloroplasts | ACCTTGCAGACGATACCTT | CGG | Scopelophila cataractae (Mitt.) Kindb. | 0.595 | protoplast | CRISPR-Cas9 |
| PCdb_1033 | 31694550 | PDS | Phytoene desaturase | ACCTTACCATTTAAGGGCGC | CGG | Triticum aestivum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1034 | 33557889 | Gh_A13G1568 | Gh_A13G1568 (Gossypium hirsutum ABC transporter A13G1568) [Source: CottonGen] | ACCTGGATAACTTCAGCAAG | CGG | Gossypium hirsutum L. | 0.5889 | seed | CRISPR-Cas9 |
| PCdb_1035 | 36149320 | not found | not found | ACCGGGGCGGTGTACAGCTA | CGG | Oryza sativa L. | not found | protoplast | not found |
| PCdb_1036 | 26842992 | GRMZM2G099580 (Hsg7) | Maize genome reference GRMZM2G099580 (Heat shock protein gene Hsg7) [Source: MaizeGDB] | acccttgttgtcggatccag | cgg | Zea mays L. | 19-31% | protoplast | CRISPR-Cas9 |
| PCdb_1037 | 38925598 | LOC_Os12g32150 | taste quality | ACCCGTGATTCGCCTCGACG | CGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_1038 | 37346168 | Solyc05g052850 | Tomato protein Solyc05g052850 (uncharacterized) | ACCATAGTTCCTCAGGGTTG | CGG | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1039 | 38925598 | LOC_Os03g16760 | taste quality | ACCAAGAATCCGTGCTTCTC | CGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_1040 | 33467172 | ZmJAZ15 | Regulating Maize Immunity to Gibberella Stalk Rot | ACATGGACGACCCGCGAGAC | CGG | Zea mays L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1041 | 34042262 | OsGW2 | E3 ubiquitin ligase (controls grain width and weight) | ACATCGACCAGAAGAAGCTC | CGG | Oryza sativa L. | not found | seed | CBE |
| PCdb_1042 | 29807545 | GFP | GFP (Green Fluorescent Protein, Aequorea victoria, transformation control) [Source: Addgene] | ACAGATCTTGCCGTCTTTTT | CGG | Oryza sativa L. | 0.003 | protoplast | ABE |
| PCdb_1043 | 38085691 | Glossy2 | Glossy2 (wax ester synthase/cuticular wax biosynthesis) [Source: MaizeGDB] | ACAGATCACAAACTICAAATG | CGG | Zea mays L. | not found | not found | CRISPR-Cas9 |
| PCdb_1044 | 38085691 | Glossy2 | Very-long-chain fatty acid condensing enzyme (epicuticular wax biosynthesis) | ACAGATCACAAACTICAAATG | CGG | Zea mays L. | not found | not found | CRISPR-Cas9 |
| PCdb_1045 | 38085691 | Glossy2 | AP2/ERF transcription factor in epicuticular wax regulation (Glossy2) | ACAGATCACAAACTICAAATG | CGG | Zea mays subsp. huehuetenangensis (H.H.Iltis & Doebley) Doebley | not found | not found | CRISPR-Cas9 |
| PCdb_1046 | 38085691 | Glossy2 | Glossy2 (wax ester synthase/cuticular wax biosynthesis) [Source: MaizeGDB] | ACAGATCACAAACTICAAATG | CGG | Zea mays subsp. parviglumis H.H.Iltis & Doebley | not found | not found | CRISPR-Cas9 |
| PCdb_1047 | 34984801 | OsSPL14 | Squamosa promoter-binding-like 14 | ACAGAGAGCACAGCTCGAGT | CGG | Oryza sativa L. | not found | protoplast | CRISPR-Cas9,Base editor |
| PCdb_1048 | 38925598 | LOC_Os12g24800 | taste quality | ACAAGCTGCCATGTCATCCG | CGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_1049 | 31404128 | PDS | Phytoene desaturase (PDS, carotenoid biosynthesis) | ACAAGCCAGGAGAATTCAGC | CGG | Glycine max (L.) Merr. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1050 | 31404128 | PDS | Phytoene desaturase (carotenoid biosynthesis) | ACAAGCCAGGAGAATTCAGC | CGG | Oryza sativa L. | not found | protoplast | not found |
| PCdb_1051 | 30959555 | not found | not found | ACAAGATATCCTAAAAGGCA | CGG | Oryza sativa L. | 0.224 | calli | ABE |
| PCdb_1052 | 33557889 | Gh_A08G1108 | Gh_A08G1108 (Gossypium hirsutum xyloglucan endotransglucosylase/hydrolase A08G1108) [Source: CottonGen] | ACAACCTTCGGAGACTACCA | CGG | Gossypium hirsutum L. | 0.5889 | seed | CRISPR-Cas9 |
| PCdb_1053 | 33557889 | Gh_D13G0216 | Gh_D13G0216 (Gossypium hirsutum WRKY transcription factor D13G0216) [Source: CottonGen] | ACAAACGAGTGCCACCGCGT | CGG | Gossypium hirsutum L. | 0.5889 | seed | CRISPR-Cas9 |
| PCdb_1054 | 36660867 | OsCKX | Rice cytokinin oxidase/dehydrogenase (cytokinin catabolism enzyme) | aatgtgttcgtgccaaagca | cgg | Oryza sativa L. | not found | protoplast | CRISPR-Cas9,CRISPR-Cas12 |
| PCdb_1055 | 27097775 | SlPIF4 | Phytochrome-interacting factor 4 homolog | AATGGGGATGGGTCCGCCTTCGG | CGG | Solanum lycopersicum L. | 0.8947 | seed | CRISPR-Cas9 |
| PCdb_1056 | 33557889 | Gh_A03G1792 | Gh_A03G1792 (Gossypium hirsutum calcium-dependent protein kinase, CDPK) [Source: CottonGen] | AATGCTGCAATAGTCCCGAC | CGG | Gossypium hirsutum L. | 0.5889 | seed | CRISPR-Cas9 |
| PCdb_1057 | 38925598 | LOC_Os07g47840 | taste quality | AATGAGGCGTACTGCTCGCG | CGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_1058 | 33557889 | Gh_A09G0654 | Gh_A09G0654 (Gossypium hirsutum laccase A09G0654) [Source: CottonGen] | AATCCTCAACCGCAAAGTGG | CGG | Gossypium hirsutum L. | 0.5889 | seed | CRISPR-Cas9 |
| PCdb_1059 | 36660867 | OsCKX | Rice cytokinin oxidase/dehydrogenase (cytokinin catabolism enzyme) | aagttcgccgacgtcccggg | cgg | Oryza sativa L. | not found | protoplast | CRISPR-Cas9,CRISPR-Cas12 |
| PCdb_1060 | 31694550 | PDS | Phytoene desaturase | AAGTCTCTGGGAAATCAAAA | CGG | Triticum aestivum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1061 | 28584922 | DEP1 | G-protein subunit controlling panicle architecture (Dense and erect panicle1) | AAGGACCTCCAAGATGCG | CGG | Oryza sativa L. | not found | protoplast | not found |
| PCdb_1062 | 31452351 | Glyma.04G067900 | Cinnamoyl-CoA reductase (Glyma.04G067900) [Source: SoyBase] | AAGGAAAAGCCAAGGCCAGG | CGG | Glycine max (L.) Merr. | 0.592 | hairy root | CRISPR-Cas9 |
| PCdb_1063 | 32841372 | BnaEOD3 | regulates seed production | AAGCTGATTCCTTAACCGGC | CGG | Brassica napus L. | not found | seed | CRISPR-Cas9 |
| PCdb_1064 | 33557889 | Gh_A12G1590 | Gh_A12G1590 (Gossypium hirsutum lipoxygenase A12G1590) [Source: CottonGen] | AAGCTCGGATTGTACAAGCG | CGG | Gossypium hirsutum L. | 0.5889 | seed | CRISPR-Cas9 |
| PCdb_1065 | 34598671 | OsFtsH2 | Oryza sativa Filamentation temperature sensitive H 2 (OsFtsH2, chloroplast protease) | AAGCTCGCGCTTGGGAACCT | CGG | Oryza sativa L. | not found | protoplast | not found |
| PCdb_1066 | 31500108 | OsCAF1 | Influences Chloroplast Development | AAGCCCAGTACCCCATCTCA | CGG | Oryza sativa L. | not found | chloroplast | CRISPR-Cas9 |
| PCdb_1067 | 38925598 | LOC_Os01g59760 | taste quality | AAGAGGAATGCCGAAACGGG | CGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_1068 | 40152981 | BnaA5.TAC1 | TILLER ANGLE CONTROL 1 homolog controlling branch/tiller angle in rapeseed, thereby influencing tiller number and overall yield. | AAGAACGTCAACCAAGAGT | CGG | Brassica napus L. | not found | not found | CRISPR/Cas9 |
| PCdb_1069 | 37346168 | Solyc03g119050 | Tomato protein Solyc03g119050 (uncharacterized) | AAGAAAGCTTGTCTTTTCGC | CGG | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1070 | 30061908 | DMC1 | Meiotic recombination protein DMC1 | AACTCGAACCAGCCTCCTCT | CGG | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1071 | 31993066 | not found | not found | AACGTGTACGCCAGCGTTCT | CGG | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1072 | 38925598 | LOC_Os01g53650 | taste quality | AACGGGCACCCGGAGCCGCG | CGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_1073 | 29511025 | LsNCED4 | 9-cis-epoxycarotenoid dioxygenase 4 (abscisic acid biosynthesis) [Source: NCBI] | AACCCCATGTTTAAGCCAAC | CGG | Lactuca sativa L. | 0.882 | protoplast | CRISPR-Cas9 |
| PCdb_1074 | 38925598 | LOC_Os08g45110 | taste quality | AACCAGCGTTGCCCCTTCCG | CGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_1075 | 37346168 | Solyc02g092930 | Tomato protein Solyc02g092930 (uncharacterized) | AAATCGATTCCGGGGAGATC | CGG | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1076 | 33557889 | Gh_A05G2993 | Gh_A05G2993 (Gossypium hirsutum cytochrome P450, CYP450) [Source: CottonGen] | AAAGGCGTGTACCACTACCG | CGG | Gossypium hirsutum L. | 0.5889 | seed | CRISPR-Cas9 |
| PCdb_1077 | 31694550 | PDS | Phytoene desaturase | AAACCAACTCCAGCATCGAA | CGG | Triticum aestivum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1078 | 31694550 | PDS | Phytoene desaturase | AAAATTGAACTGAACCCTGA | CGG | Triticum aestivum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1079 | 26842992 | GRMZM2G000411 (Hsg8) | Maize genome reference GRMZM2G000411 (Heat shock protein gene Hsg8) [Source: MaizeGDB] | aaaagaactcactctgcagc | cgg | Zea mays L. | 19-31% | protoplast | CRISPR-Cas9 |
| PCdb_1080 | 40606783 | CmGAD1 | Enhance fruit shelf-life |
AAGTCGAGGCGCTGCCGATA | CGG | Cucumis melo L. | not found | seed | CRISPR/Cas9 |
| PCdb_1081 | 35410430 | Sb-Mtl | during rapid de novo shoot regeneration | TAATAATGTTGTATAGCCGC | CGG | Hemisorghum C.E.Hubb. ex Bor | not found | embryo | CRISPR-Cas9 |
| PCdb_1082 | 26842991 | FGS | FGS (Arabidopsis thaliana FATTY ACID ELONGASE61, very-long-chain fatty acid biosynthesis) [Source: TAIR] | GTCATGGTAGTAGCAGTGAC | CGG | Zea mays L. | 0.7 | protoplast | CRISPR-Cas9 |
| PCdb_1083 | 26842991 | FGS | FGS (Arabidopsis thaliana FATTY ACID ELONGASE60, very-long-chain fatty acid biosynthesis) [Source: TAIR] | GTACACTTCCATATCCATGG | CGG | Zea mays L. | 0.2724 | protoplast | CRISPR-Cas9 |
| PCdb_1084 | 26842991 | FGS | FGS (Arabidopsis thaliana FATTY ACID ELONGASE43, very-long-chain fatty acid biosynthesis) [Source: TAIR] | GCGGTAGGAGAAGTGTCGCG | CGG | Zea mays L. | 0.2018 | protoplast | CRISPR-Cas9 |
| PCdb_1085 | 26842991 | FGS | FGS (Arabidopsis thaliana FATTY ACID ELONGASE62, very-long-chain fatty acid biosynthesis) [Source: TAIR] | GAGGCGGTCCGTGATGACGA | CGG | Zea mays L. | 0.199 | protoplast | CRISPR-Cas9 |
| PCdb_1086 | 26842991 | FGS | FGS (Arabidopsis thaliana FATTY ACID ELONGASE88, very-long-chain fatty acid biosynthesis) [Source: TAIR] | GAGACTTGAGGATCTGTTCA | CGG | Zea mays L. | 0.022 | protoplast | CRISPR-Cas9 |
| PCdb_1087 | 29036337 | CLE20 | CLE-Peptide-Encoding Genes | GACGAAGATCGTCTAGATTT | CGG | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1088 | 26842991 | FGS | FGS (Arabidopsis thaliana FATTY ACID ELONGASE14, very-long-chain fatty acid biosynthesis) [Source: TAIR] | GACCCAATAGCTGGTATACA | CGG | Zea mays L. | 0.024 | protoplast | CRISPR-Cas9 |
| PCdb_1089 | 26842991 | FGS | FGS (Arabidopsis thaliana FATTY ACID ELONGASE39, very-long-chain fatty acid biosynthesis) [Source: TAIR] | GACCATAGCCAGGTTGAATC | CGG | Zea mays L. | 0.0244 | protoplast | CRISPR-Cas9 |
| PCdb_1090 | 37952706 | Protein kinase A | regulatory subunit is required for normal growth, zoosporogenesis, and pathogenicity in Phytophthora sojae | CGTGCACTGCATTCAAACAA | cgg | Glycine max (L.) Merr. | not found | not found | CRISPR-Cas9 |
| PCdb_1091 | 39840369 | BnaX.SGT.a | FAE1 gene encodes 3-ketoacyl-CoA synthase (KCS), catalyzing the rate-limiting initial condensation step for elongation of C18-CoA to very-long-chain fatty acids including erucic acid (C22:1) | ATTTTGTAAAGCGGTCCGAG | CGG | Sinapis alba L. | not found | hypocotyl | CRISPR/Cas9 |
| PCdb_1092 | 29036337 | CLE7 | CLE-Peptide-Encoding Genes | AAATGGAAGGGAGGATACTT | CGG | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1093 | 30537191 | GL2 | Homeobox transcription factor regulating leaf epidermis development | GCTTTCTTGAACGGTTGCGGC | CGCGGT | Oryza sativa L. | 0.07 | calli | CBE |
| PCdb_1094 | 30537191 | OsGRF3 | Growth-regulating factor involved in leaf and grain development | GCTTTCTTGAACGGTTGCGGC | CGCGGT | Oryza sativa L. | 0.18 | calli | CBE |
| PCdb_1095 | 34713242 | OsWaxy | Oryza sativa granule-bound starch synthase (OsWaxy, amylose biosynthesis) | TCGGCCACCGGCTTCGGCAT | CGC | Oryza sativa L. | not found | calli | CRISPR-xCas9 |
| PCdb_1096 | 34984801 | OSEU11 | ELONGATED UPPERMOST INTERNODE 1 | TCCACCATGCACCACGACGT | CGC | Oryza sativa L. | not found | protoplast | CRISPR-Cas9,Base editor |
| PCdb_1097 | 33152517 | APOBEC3A | the APOBEC family of cytidine deaminases | TCCACCATGCACCACGACGT | CGC | Oryza sativa L. | 0.517 | protoplast | CBE |
| PCdb_1098 | 34042262 | OsALS | Acetolactate synthase | TCATCAAACCGCACACCAAA | CGC | Oryza sativa L. | not found | protoplast | CBE |
| PCdb_1099 | 34042262 | OsALS | Acetolactate synthase | GGGATGCATGGCACGGTGTA | CGC | Oryza sativa L. | 0.006 | protoplast | CBE |
| PCdb_1100 | 30928637 | OsDEP1 | Oryza sativa Dense and Erect Panicle 1 (OsDEP1, panicle architecture) | CAGCTGCATCCGCCGCCGGC | CGC | Oryza sativa L. | not found | protoplast | xCas9 |
| PCdb_1101 | 30928637 | OsDEP1 | Oryza sativa Dense and Erect Panicle 1 (OsDEP1, panicle architecture) | CAGCCGCCGCCGCCGCGGGG | CGC | Oryza sativa L. | not found | protoplast | xCas9 |
| PCdb_1102 | 36312444 | mir172a | MicroRNA 172a (flowering time regulation) [Source: miRBase] | CAAGTCCCACCCACCACCTG | CGC | Glycine max (L.) Merr. | not found | hairy root | CRISPR-Cas9 |
| PCdb_1103 | 36518521 | ZmGSO | GSO/RPK signaling protein (ZmGSO, root growth regulation) | ATCACAACAAGCTCACCGGT | CGC | Zea mays L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1104 | 30928637 | OsDEP1 | Oryza sativa Dense and Erect Panicle 1 (OsDEP1, panicle architecture) | AGCTGCATCCGCCGCCGGC | CGC | Oryza sativa L. | not found | protoplast | xCas9 |
| PCdb_1105 | 30928637 | OsDEP1 | Oryza sativa Dense and Erect Panicle 1 (OsDEP1, panicle architecture) | AGCCGCCGCCGCCGCGGGG | CGC | Oryza sativa L. | not found | protoplast | xCas9 |
| PCdb_1106 | 30144351 | not found | Gene not detected or not annotated in the database | AATCACTCAAGGAAATTCCG | CGC | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1107 | 31932727 | OsAAT | Amino acid transporter protein | AAGGTCAATCTCGGCGTCGG | CGC | Oryza sativa L. | 0.008 | calli | ABE |
| PCdb_1108 | 30928637 | OsPDS | Oryza sativa phytoene desaturase (OsPDS, carotenoid biosynthesis) | TCTGAATACGAGAATTCAGC | CGA | Oryza sativa L. | not found | protoplast | xCas9 |
| PCdb_1109 | 30928637 | OsDEP1 | Dense and Erect Panicle 1 controlling panicle architecture | GGCGGTGGTGATGGAGGCGC | CGA | Oryza sativa L. | not found | protoplast | xCas9 |
| PCdb_1110 | 34042262 | OsALS | Acetolactate synthase | CTCCTGGAAGGCGTCGGTGC | CGA | Oryza sativa L. | 0.014 | protoplast | CBE |
| PCdb_1111 | 36518521 | ZmGSO | GSO/RPK signaling protein (ZmGSO, root growth regulation) | CGAGTTCACCGGAGCAATCC | CGA | Zea mays L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1112 | 31932727 | OsCDC48 | Rice cell division control protein 48 (AAA+ ATPase involved in protein degradation and cell cycle regulation) | CCATGACAATGACATGGGAA | CGA | Oryza sativa L. | 0.18 | calli | ABE |
| PCdb_1113 | 31932727 | OsCDC48 | Rice cell division control protein 48 (AAA+ ATPase involved in protein degradation and cell cycle regulation) | CCATGACAATGACATGGGAA | CGA | Oryza sativa L. | 0.018 | calli | ABE |
| PCdb_1114 | 30928637 | OsGS3 | Oryza sativa Grain Size 3 (OsGS3, seed size regulation) | AGATTGTACCTCGAGGAATC | CGA | Oryza sativa L. | not found | protoplast | xCas9 |
| PCdb_1115 | 30051586 | OsSPL14 | Transcription factor regulating tillering and plant architecture (e.g., IPA1 allele increases yield). | AGAAGAGAGAGAGCACAGCT | CGA | Oryza sativa L. | 0.667 | leaf | ABE |
| PCdb_1116 | 34984801 | OsEU11 | ELONGATED UPPERMOST INTERNODE 1 | ACGGACCCGGAGCTCATCGG | CGA | Oryza sativa L. | not found | protoplast | CRISPR-Cas9,Base editor |
| PCdb_1117 | 33751803 | ALS | Acetolactate synthase, target site of ALS-inhibitor herbicides and essential for branched-chain amino acid biosynthesis | TAACAAAGAAGAGTGAAGTC | CG | Oryza sativa L. | 0.821 | calli | ABE |
| PCdb_1118 | 26269544 | ALS | Acetolactate synthase, target site of ALS-inhibitor herbicides and essential for branched-chain amino acid biosynthesis | AGTGCCCTGTCCACGGCGCTG | CCT | Zea mays L. | not found | embryo | CRISPR-Cas9 |
| PCdb_1119 | 36305009 | BZR1 | BRASSINAZOLE-RESISTANT 1 transcription factor | TTCTATGCGGTTTCTGCACC | CCT | Arabidopsis thaliana (L.) Heynh. | 0.2 | protoplast | CRISPR/Cas9 |
| PCdb_1120 | 27148303 | IR and Rep of CABs | Intergenic region and repetitive elements of chloroplast DNA [Source: NCBI] | TTAATTTGAACTGGCTTCCC | CCT | Gossypium hirsutum L. | not found | germplasm | CRISPR-Cas9 |
| PCdb_1121 | 31548867 | BnLPAT5 | Lysophosphatidic acid acyltransferase 5 | TGTGGCCTTTCCTCTTTG | CCT | Brassica napus L. | not found | seed | CRISPR-Cas9 |
| PCdb_1122 | 40601421 | SlPRR1 | Pseudo-response regulator 1 controlling circadian clock and photoperiodic flowering in tomato. | TGTGAAGCCTCTCCGCACTA | CCT | Solanum lycopersicum L. | not found | protoplast | CRISPR/Cas9 |
| PCdb_1123 | 34904377 | UR9 | Uncharacterized resistance protein UR9 (fungal disease resistance) | TGTCCTCACACGAGACACGC | cct | Glycine max (L.) Merr. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1124 | 34904377 | UR9 | Uncharacterized resistance protein UR9 (fungal disease resistance) | TGTCCTCACACGAGACACGC | cct | Glycine max (L.) Merr. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1125 | 36142294 | LcyE | Lycopene-cyclase (carotenoid biosynthesis) [Source: RAP-DB] | TGTCAGACATCTCCTCTCT | CCT | Oryza sativa L. | 0.9 | protoplast | CRISPR-Cas9 |
| PCdb_1126 | 32918784 | YKT61 | YKT61 v-SNARE (vesicle trafficking) | TGCTCGTTCTCAAGTGCGCT | CCT | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1127 | 34978137 | not found | not found | TCGGGAACAGGACCGTGTCC | CCT | Triticum aestivum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1128 | 27148303 | IR and Rep of CABs | Intergenic region and repetitive elements of chloroplast DNA [Source: NCBI] | TCGAACTGGATGAGAACATG | CCT | Gossypium hirsutum L. | not found | germplasm | CRISPR-Cas9 |
| PCdb_1129 | 33971367 | not found | not found | TCCTTCCGCCTCACTAACAT | CCT | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1130 | 29036337 | CLV3 | CLE-Peptide-Encoding Genes | TCATGATGCTTCTGGTCTCA | CCT | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1131 | 29036337 | CLE44 | CLE-Peptide-Encoding Genes | TCATGAATCCTCATCTAAGA | CCT | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1132 | 27148303 | IR and Rep of CABs | Intergenic region and repetitive elements of chloroplast DNA [Source: NCBI] | TCAAAGCCGTTGAAGTCGAA | CCT | Gossypium hirsutum L. | not found | germplasm | CRISPR-Cas9 |
| PCdb_1133 | 37123849 | CiGAS-S3 | Geranylgeranyl diphosphate synthase small subunit isoform 3, involved in terpenoid biosynthesis | TATATAAGGGATAGAGTACC | CCT | Cichorium intybus L. | 0.78 | protoplast | CRISPR-Cas9 |
| PCdb_1134 | 29036339 | MAF1 | isoforms to temperature-dependent flowering | TAGTAAGTAATTAGCTAAG | CCT | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1135 | 37123849 | CiGAS-S2 | Geranylgeranyl diphosphate synthase small subunit isoform 2, involved in terpenoid biosynthesis | TACATAAGGGATAGAGTACC | CCT | Cichorium intybus L. | 0.53 | protoplast | CRISPR-Cas9 |
| PCdb_1136 | 37123849 | CiGAS-S1 | Geranylgeranyl diphosphate synthase small subunit isoform 1, involved in terpenoid biosynthesis | TACATAAGGGATAGAGTACC | CCT | Cichorium intybus L. | 0.53 | protoplast | CRISPR-Cas9 |
| PCdb_1137 | 37123849 | CiGAS-L | Geranylgeranyl diphosphate synthase large subunit, involved in terpenoid backbone synthesis | TACATAAGAGATAGAGTACC | CCT | Cichorium intybus L. | 0.53 | protoplast | CRISPR-Cas9 |
| PCdb_1138 | 32933074 | not found | not found | TAAGGCTGAGAGAAATAGGC | CCT | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1139 | 36942473 | CmCNIH1 | improves salt tolerance | GTTAGCTGTTATCACATAA | CCT | Cucurbita maxima 脳 C. moschata | not found | protoplast | CRISPR-Cas9 |
| PCdb_1140 | 27148303 | IR and Rep of CABs | Intergenic region and repetitive elements of chloroplast DNA [Source: NCBI] | GTGCGTGAATCCATGGTTGT | CCT | Gossypium hirsutum L. | not found | germplasm | CRISPR-Cas9 |
| PCdb_1141 | 27148303 | Rep-A of alphasatellite | Alphasatellite replication-associated protein (Rep-A, viral replication) | GGTTCTATACACGTGGAGGA | CCT | Gossypium hirsutum L. | not found | germplasm | CRISPR-Cas9 |
| PCdb_1142 | 34009654 | ZmNL4 | controls leaf width | GGTCAGGAGGAACGTGGCG | CCT | Zea mays L. | not found | chloroplast | CRISPR-Cas9 |
| PCdb_1143 | 33740293 | not found | not found | GGCAGCGCATAGAAGGTGAA | CCT | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1144 | 36628413 | eIF4E | knockout of eIF4E improves Wheat yellow mosaic virus resistance without yield penalty | GGACCTTCTGGTTCGACAAC | CCT | Triticum aestivum L. | 0.0865 | protoplast | CRISPR-Cas9 |
| PCdb_1145 | 27148303 | Rep-A of alphasatellite | Alphasatellite replication-associated protein (Rep-A, viral replication) | GCTGGCAGGAAGAAGAGTCG | CCT | Gossypium hirsutum L. | not found | germplasm | CRISPR-Cas9 |
| PCdb_1146 | 33550455 | SIHWS | Tomato HWS histone methyltransferase (SIHWS, epigenetic regulation) | GCCCTTGTTGTTTTTGACGT | CCT | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1147 | 34696530 | eIF4G | Resistance to Rice Black-Streaked Dwarf Virus | GCACCTGCCCCGACCGCTCT | CCT | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1148 | 28542349 | PDS | Phytoene desaturase (PDS, carotenoid biosynthesis) | GATCGAGTAACAGATGAGGT | CCT | Vitis vinifera L. | 0.615 | protoplast | CRISPR-Cas9 |
| PCdb_1149 | 29036337 | CLE15 | CLE-Peptide-Encoding Genes | GATCACTATCCTTCACTACC | CCT | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1150 | 28696528 | not found | not found | GAGAGAAGGGAGATTTTCAT | CCT | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1151 | 34265153 | BnQCR8 | Ubiquinolytochrome c reductase 8 kDa subunit | GAGAAGATCCACCACAAAGT | CCT | Brassica napus L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1152 | 36403232 | TaSPL13 | Wheat SPL13 transcription factor (TaSPL13, development) | GAGAAGACAGUACGUCGGUA | cct | Triticum aestivum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1153 | 28542349 | PDS | Phytoene desaturase (PDS, carotenoid biosynthesis) | GAAGCTTCTTTTGCCGGGAG | CCT | Vitis vinifera L. | 0.615 | protoplast | CRISPR-Cas9 |
| PCdb_1154 | 36142294 | not found | not found | CTCTGATCCGACCGGCTCA | CCT | Oryza sativa L. | 0.9 | protoplast | CRISPR-Cas9 |
| PCdb_1155 | 32152696 | Clpsk1 | Phytosulfokine receptor-like kinase, may mediate cell proliferation signals | CTCTCTTCTTTTCCTCTGTC | CCT | Citrullus lanatus (Thunb.) Matsum. & Nakai | 0.023 | protoplast | CRISPR-Cas9 |
| PCdb_1156 | 37161940 | AcNAC1 | NAC domain transcription factor 1, regulates stress responses and development | CTCCC GGTCTCTATCATAGC | cct | Actinidia chinensis Planch. | not found | oocytes,fruits,fruit | CRISPR-Cas9 |
| PCdb_1157 | 28098143 | TaGW2 | Wheat E3 ubiquitin ligase controlling grain width and weight | CTAGAAATGCCCCATCCTGG | CCT | Triticum aestivum L. | 0.334 | protoplast | CRISPR-Cas9 |
| PCdb_1158 | 29570880 | TaGW2 | Wheat E3 ubiquitin ligase controlling grain width and weight | CTAGAAATGCCCCATCCTGG | CCT | Triticum aestivum L. | not found | grain | CRISPR-Cas9 |
| PCdb_1159 | 31373135 | TaGW2 | Wheat E3 ubiquitin ligase controlling grain width and weight | CTAGAAATACCCCATCCTGG | CCT | Triticum aestivum L. | 11.1-50.0% | seed | not found |
| PCdb_1160 | 34274523 | TaGW2 | Wheat E3 ubiquitin ligase controlling grain width and weight | CTAGAAATACCCCATCCTGG | CCT | Triticum aestivum L. | 12.9-100% | protoplast | not found |
| PCdb_1161 | 30477421 | waxy | Granuleound starch synthase I (waxy) | CGTGTTCGTCGGCGCCGAGAT | CCT | Triticum aestivum L. | 0.5417 | protoplast | CRISPR-Cas9 |
| PCdb_1162 | 36871136 | CsPrx5 | promotes waterlogging-triggered adventitious root formation | CGGTGGGGAAGCGACTAAGC | CCT | Cucumis sativus L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1163 | 36835599 | CHS7 | Chalcone synthase 7, key enzyme in flavonoid/anthocyanin biosynthesis | CGGGAGGAGTTTCTGCATGT | CCT | Glycine max (L.) Merr. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1164 | 37148285 | WRI1 | Wrinkled1 transcription factor (WRI1, lipid biosynthesis) | CGCCACCGTCACAGCAATTC | CCT | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1165 | 37148285 | bZIP52 | Basic leucine zipper transcription factor 52, regulates stress responses and development | CGCCACCGTCACAGCAATTC | CCT | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1166 | 37148285 | bZIP | Basic leucine zipper transcription factor family (general function in gene regulation) | CGCCACCGTCACAGCAATTC | CCT | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1167 | 27995308 | ClPDS | Phytoene desaturase, involved in carotenoid biosynthesis (converts phytoene to carotene) | CGAGATGCTGTTCTCCATT | CCT | Citrullus lanatus (Thunb.) Matsum. & Nakai | 1 | protoplast | CRISPR-Cas9 |
| PCdb_1168 | 31548867 | BnLPAT2 | Lysophosphatidic acid acyltransferase 2 | CGAAATGTGTTGATTCCT | CCT | Brassica napus L. | not found | seed | CRISPR-Cas9 |
| PCdb_1169 | 30291759 | AP2 | APETALA2 transcription factor | CCTTTTAGGCAGGATGCAACCAT | CCT | Gossypium hirsutum L. | 0.701 | leaf | CRISPR-Cas9 |
| PCdb_1170 | 30291759 | AP2 | APETALA2 transcription factor | CCTTTTAGGCAGGATGCAACCAT | CCT | Gossypium hirsutum L. | 0.701 | leaf | CRISPR-Cas9 |
| PCdb_1171 | 33872346 | EPSPS | 5-Enolpyruvylshikimate-3-phosphate synthase | CCTGTTCGTGTCAATGCTAA | CCT | Brassica napus L. | 0.105 | seed | CRISPR-Cas9 |
| PCdb_1172 | 34850950 | BnaC4_SBE2.1 | Starch branching enzyme 2.1 | CCTCTGGTACTCCTCCTCCA | CCT | Brassica napus L. | 0.48 | protoplast | CRISPR-Cas9 |
| PCdb_1173 | 34850950 | BnaA5_SBE2.1 | Starch branching enzyme 2.1 | CCTCTGGTACTCCTCCTCCA | CCT | Brassica napus L. | 0.28 | protoplast | CRISPR-Cas9 |
| PCdb_1174 | 27558837 | TaGW2 | Wheat E3 ubiquitin ligase controlling grain width and weight | CCTCTAGAAATGCCCCATCCTGG | CCT | Triticum aestivum L. | 0.026 | grain | CRISPR-Cas9 |
| PCdb_1175 | 33657669 | not found | not found | CCTCCTTCTATACTTCTCC | CCT | Brassica napus L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1176 | 31993066 | not found | not found | CCTCATGTGGGGCGGCGTTA | CCT | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1177 | 28873302 | slmapk3 | Mitogen-activated protein kinase 3 | CCGCCCTTACGAAGGGAGT | CCT | Solanum lycopersicum L. | 0.4182 | cotyledon | CRISPR-Cas9 |
| PCdb_1178 | 29333573 | Glyma.10G244400 | Chalcone synthase (Glyma.10G244400) [Source: SoyBase] | CCGCCCAAGGCTCCGCCACC | cct | Glycine max (L.) Merr. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1179 | 37682975 | OsCOI2 | Rice coronatine insensitive 2 (JA signaling pathway component) | CCGCAGGATGATCGTGTCCG | CCT | Oryza sativa L. | not found | not found | CRISPR-Cas9 |
| PCdb_1180 | 35216118 | not found | not found | CCGAGCGGTCTTTACTAGAA | CCT | Arabidopsis thaliana (L.) Heynh. | not found | leaf | CRISPR-Cas9 |
| PCdb_1181 | 35216118 | BsrBI | Type II restriction enzyme from Bacillus stearothermophilus (DNA cleavage) | CCGAGCGGTCTTTACTAGAA | CCT | Arabidopsis thaliana (L.) Heynh. | 0.01 | leaf | CRISPR-Cas9 |
| PCdb_1182 | 36060110 | SACPD-C | Stearoyl-ACP desaturase C (SACPD-C, fatty acid desaturation) | CCCTGACCCCTCCCTTCCGC | cct | Glycine max (L.) Merr. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1183 | 34850950 | BnaA5_SBE2.1 | Starch branching enzyme 2.1 | CCCAAGTTTCAACGACGATC | CCT | Brassica napus L. | 0.93 | protoplast | CRISPR-Cas9 |
| PCdb_1184 | 34850950 | BnaC4_SBE2.1 | Starch branching enzyme 2.1 | CCCAAGTTTCAACGACGATC | CCT | Brassica napus L. | 0.66 | protoplast | CRISPR-Cas9 |
| PCdb_1185 | 36105709 | inactivation of the kauniolide synthase | Kauniolide synthase (sesquiterpene lactone biosynthesis) [Source: NCBI] | CCATCAGATTGGTTTAGCA | CCT | Cichorium intybus L. | not found | root | CRISPR-Cas9 |
| PCdb_1186 | 37323119 | not found | not found | CCAATCCGCCCTCCTTCAAG | CCT | Oryza sativa L. | not found | blast,plants,plant | CRISPR-Cas9 |
| PCdb_1187 | 27148303 | IR and Rep of CABs | Intergenic region and repetitive elements of chloroplast DNA [Source: NCBI] | CATGTGAATGAAGATCTTCA | CCT | Gossypium hirsutum L. | not found | germplasm | CRISPR-Cas9 |
| PCdb_1188 | 29575650 | NRT1.1B | Nitrate transporter 1.1B, mediates nitrate uptake and signaling in rice | CATCGCCTCCATCCTCCTCA | CCT | Oryza sativa L. | not found | protoplast | not found |
| PCdb_1189 | 27007717 | OsDEP1 | G protein subunit, DENSE AND ERECT PANICLE1 (OsDEP1) | CAATTGTTCTTGCAGCTCAT | CCT | Oryza sativa L. | 0.64 | protoplast | CRISPR-Cas9 |
| PCdb_1190 | 27007717 | OsDEP1 | G protein subunit, DENSE AND ERECT PANICLE1 (OsDEP1) | CAATTGTTCTTGCAGCTCAT | CCT | Oryza sativa L. | 0.64 | protoplast | CRISPR-Cas9 |
| PCdb_1191 | 29973285 | OsDEP1 | Oryza sativa Dense and Erect Panicle 1 (OsDEP1, panicle architecture) | CAATGTTCTTGCAGCTCAT | CCT | Oryza sativa L. | 15-100% | protoplast | CRISPR-Cas9,CRISPR-Cas12 |
| PCdb_1192 | 26768120 | not found | not found | ATGATCCCAAGTGGGGGCGC | CCT | Oryza sativa L. | not found | protoplast | not found |
| PCdb_1193 | 27530958 | PDS | Phytoene desaturase (PDS, carotenoid biosynthesis) | ATACTACTAGAAGCGAGAGA | CCT | Malus x domestica Bork. | 0.318 | leaf | CRISPR-Cas9 |
| PCdb_1194 | 28499063 | GhCLA1 | GhCLA1 (Gossypium hirsutum 1-deoxy-D-xylulose 5-phosphate synthase, chloroplast development) [Source: CottonGen] | ATACCACCTGTGGGAGCTTT | CCT | Gossypium hirsutum L. | 0.667 | hypocotyl | CRISPR-Cas9 |
| PCdb_1195 | 28499063 | GhCLA1 | GhCLA1 (Gossypium hirsutum 1-deoxy-D-xylulose 5-phosphate synthase, chloroplast development) [Source: CottonGen] | ATACCACCTGTGGGAGCTTT | CCT | Gossypium hirsutum L. | 0.667 | hypocotyl | CRISPR-Cas9 |
| PCdb_1196 | 32429836 | TFL1 | TERMINAL FLOWER 1 floral repressor | AGTGACCCCTTTCTAAAAGA | CCT | Brassica napus L. | not found | calli | CRISPR-Cas9 |
| PCdb_1197 | 36518081 | ARC1 | leads to a complete breakdown of self-incompatibility responses | AGCAACACGGCTCAGAGTTGG | CCT | Brassica napus L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1198 | 30819931 | NRT1.1B | Nitrate transporter 1.1B, regulates nitrogen uptake and utilization | ACTAGATATCTAAACCATTA | CCT | Oryza sativa L. | 0.595 | calli | ABE |
| PCdb_1199 | 30627700 | TaLpx-1 | Wheat lipoxygenase (Lpx-1) enzyme | ACGTCGACACCACCCCCGGC | CCT | Triticum aestivum L. | 0.09 | Protoplast | CRISPR-Cas9 |
| PCdb_1200 | 24836556 | AT2G1377 | Arabidopsis thaliana gene AT2G1377 (uncharacterized protein) | ACGGGAACTGGGAAAACTCT | CCT | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1201 | 28412227 | ZmTMS5 | Thermosensitive male sterility protein 5 (pollen development) | ACCAGGGAGCGAGATCAAGC | CCT | Zea mays L. | 0.048 | maize protoplasts | CRISPR-Cas9 |
| PCdb_1202 | 36232648 | not found | not found | AAGTCGGTCTGCAATTCACA | CCT | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1203 | 29036337 | CLE11 | CLE-Peptide-Encoding Genes | AAGCCGTGTAGTTTCCTCTT | CCT | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1204 | 31469505 | SPX-MSF2 | SPX domain protein involved in phosphate sensing | AGATGACCATCAACAAATCCA | CCGAAT | Oryza sativa L. | 0.098 | calli | ABE |
| PCdb_1205 | 35604091 | BAHD acyltransferases | Plant acyl-CoA-dependent acyltransferases, involved in secondary metabolite biosynthesis | GTGGCCGCCTGGAACTTGAC | CCG | Cichorium intybus L. | not found | hairy root | CRISPR-Cas9 |
| PCdb_1206 | 32913300 | not found | not found | TTGTGGCCATTGCACTAGCC | CCG | Oryza sativa L. | not found | protoplast | not found |
| PCdb_1207 | 31373135 | BnaMAX1 | MAX1 cytochrome P450 monooxygenase homolog | TTCTTGCCAAGCACTATGGC | CCG | Brassica napus L. | 0.563 | seed | CRISPR-Cas9 |
| PCdb_1208 | 34539694 | 0 sS 40 | Possible typographical entry (function unclear without additional context) | TTCGAGCTCGACGAGAGCGA | CCG | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1209 | 34539694 | 0 sS 40 | Possible typographical entry (function unclear without additional context) | TTCACGGACCCGATCGAGAT | CCG | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1210 | 29036337 | CLE5 | CLE-Peptide-Encoding Genes | TGTCCATGGGCAATATGGAT | CCG | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1211 | 31547486 | IbSBEII | starch biosynthetic pathway genes | TGTAGGCTGCTTAAAGCCAGGAAA | CCG | Ipomoea batatas (L.) Lam. | 62-92% | protoplast | CRISPR-Cas9 |
| PCdb_1212 | 31547486 | IbSBEII | starch biosynthetic pathway genes | TGTAGGCTGCTTAAAGCCAGGAAA | CCG | Ipomoea batatas (L.) Lam. | 62-92% | protoplast | CRISPR-Cas9 |
| PCdb_1213 | 34426588 | not found | not found | TGGGATTTGGGGAAGCCAAC | CCG | Oryza sativa L. | not found | protoplast | not found |
| PCdb_1214 | 30291759 | ARC | NB-ARC domain disease resistance protein | TGGGAACACTGATGGTAGAC | CCG | Gossypium hirsutum L. | 0.701 | leaf | CRISPR-Cas9 |
| PCdb_1215 | 30291759 | ARC | NB-ARC domain disease resistance protein | TGGGAACACTGATGGTAGAC | CCG | Gossypium hirsutum L. | 0.701 | leaf | CRISPR-Cas9 |
| PCdb_1216 | 34942204 | TaPDI | TaPDI genes on storage protein accumulation | TGCATGCCAACCATCTCCCA | CCG | Triticum aestivum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1217 | 37856327 | BnaTT | TRANSPARENT TESTA family transcription factor regulating flavonoid and proanthocyanidin biosynthesis in seed coat, affecting seed color and antioxidant accumulation. | TGAGAAATGCATAGAGGAGC | CCG | Brassica napus L. | not found | seed | pYLCRISPR/Cas9P35S-H |
| PCdb_1218 | 35684226 | not found | not found | TGAATATAGAGATGCCAGGA | CCG | Oryza sativa L. | not found | protoplast | not found |
| PCdb_1219 | 36471650 | fdh | fdh (Formate dehydrogenase, EC 1.2.1.2, formate oxidation) [Source: UniProt] | TCTTAAGATGGATTCTGAGC | CCG | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1220 | 36596996 | TRIPTYCHON | R3 MYB transcription factor TRIPTYCHON | TCGTCGCCGTCGTAAGCAAC | CCG | Arabidopsis thaliana (L.) Heynh. | 80.9-100% | protoplast | CRISPR-Cas9 |
| PCdb_1221 | 27148303 | IR and Rep of CABs | Intergenic region and repetitive elements of chloroplast DNA [Source: NCBI] | TCGATCTGAAATTGCCCCCA | CCG | Gossypium hirsutum L. | not found | germplasm | CRISPR-Cas9 |
| PCdb_1222 | 30627700 | TaMLO | Wheat mildew resistance locus O (susceptibility factor) | TCACGCAGGACCCAATCTCC | CCG | Triticum aestivum L. | 0.27 | Protoplast | CRISPR-Cas9 |
| PCdb_1223 | 33131175 | FAD2 | Fatty acid desaturase 2 | TCACCACTCGAACACCGGTT | CCG | Gossypium hirsutum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1224 | 33222361 | DrPDS | Dunaliella salina phytoene desaturase, key enzyme in carotenoid biosynthesis | TAGCTGTCCACGCCCAAAT | CCG | Dioscorea rotundata Poir. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1225 | 36204067 | SYP121 | Syntaxin of plants 121 | GTGGTTGACGGCTACTCGT | CCG | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1226 | 31993066 | not found | not found | GTGGCATGCAGAATTTGCCC | CCG | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1227 | 30258105 | not found | not found | GTGGCACCTACGGCAAC | CCG | Triticum aestivum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1228 | 35713092 | SBE | Starch branching enzyme (SBE, starch biosynthesis) | GTGCGGTTCCCCGTGCCAGCC | CCG | Oryza sativa L. | 1 | leaf | CRISPR-Cas9 |
| PCdb_1229 | 29946044 | not found | not found | GTGCCACCAAGTTGAAGAAC | CCG | Solanum lycopersicum L. | not found | Spores, Fungal | CRISPR-Cas9 |
| PCdb_1230 | 29036337 | CLE19 | CLE-Peptide-Encoding Genes | GTCGTCGACGCCGGTGAAAT | CCG | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1231 | 25733849 | MPK5 | Mitogen-activated protein kinase 5 (stress signaling) [Source: TAIR] | GTACCTGCTCTACGACATC | CCG | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1232 | 31547486 | IbGBSSI | Granule-bound starch synthase I (amylose biosynthesis) [Source: UniProt] | GGGTTATCATTGGATGTGGG | CCG | Ipomoea batatas (L.) Lam. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1233 | 32762648 | GST 1 | GST1 (Glutathione S-transferase 1) [Source: UniProt] | GGGTATACCCACCGATTCTT | ccg | Gentiana triflora聽脳聽G. scabra | not found | protoplast | not found |
| PCdb_1234 | 34143557 | psy | wheat grain quality improvement | GGCGCCCCTACGACATGCTC | CCG | Triticum aestivum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1235 | 36799433 | TC1b | contributes to the autoimmunity of snc1 | GGATTGTCGACTTATTGTT | CCG | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1236 | 35713092 | SBE | Starch branching enzyme (SBE, starch biosynthesis) | GGAGGGTTGCCCCTGCAGCT | CCG | Oryza sativa L. | 1 | leaf | CRISPR-Cas9 |
| PCdb_1237 | 33576792 | YSL3 | Yellow stripe-like transporter 3 (YSL3, iron-phytosiderophore transport) | GGACGATGGACCAGCGCGCG | CCG | Brachypodium distachyon (L.) P. Beauv. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1238 | 32841372 | EOD3 | regulates seed production | GCCGGTTAAGGAATCAGCTT | CCG | Brassica napus L. | not found | seed | CRISPR-Cas9 |
| PCdb_1239 | 30246111 | not found | not found | GCCCAGTTGGAATGTAGGTG | ccg | Oryza sativa L. | not found | protoplast | CRISPR-Cas9,Base editor,Target-AID |
| PCdb_1240 | 28921815 | sgAlpha | single-guide RNA targeting 鈥渁lpha鈥?gene for CRISPR editing | GCCACAAGAGCAAGTTCCAT | CCG | Triticum aestivum L. | 62.3-75.1% | protoplast | CRISPR-Cas9 |
| PCdb_1241 | 28921815 | sgAlpha | single-guide RNA targeting 鈥渁lpha鈥?gene for CRISPR editing | GCCACAAGAGCAAGTTCCAT | CCG | Triticum aestivum L. | 62.3-75.1% | protoplast | CRISPR-Cas9 |
| PCdb_1242 | 33822021 | not found | not found | GCACCGCATGAACAGCTCCG | CCG | Zea mays L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1243 | 33608974 | PHOT1 | Blue-light receptor phototropin-1 | gcaactctggtcggagttcc | ccg | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1244 | 27148303 | IR and Rep of CABs | Intergenic region and repetitive elements of chloroplast DNA [Source: NCBI] | GATGGCCGCGCGATTTTTT | CCG | Gossypium hirsutum L. | not found | germplasm | CRISPR-Cas9 |
| PCdb_1245 | 32913300 | not found | not found | GAGCATGTGTGCTACGTGCA | CCG | Oryza sativa L. | not found | chloroplast | CRISPR-Cas9 |
| PCdb_1246 | 31993066 | not found | not found | GAGCAGTCGCTCTCGACCAC | CCG | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1247 | 26193631 | PtoPDS | Tomato phytoene desaturase (PtoPDS, carotenoid biosynthesis) | GACCTTGATAACACGGTGAA | CCG | Populus sp. | 0.517 | leaf | CRISPR-Cas9 |
| PCdb_1248 | 32933485 | PDS | Phytoene desaturase (PDS, carotenoid biosynthesis) | GACCGAGTCAATGATGAAG | CCG | Musa acuminata Colla | not found | protoplast | CRISPR-Cas9 |
| PCdb_1249 | 32323464 | not found | not found | GAACCCGATTGATGTTCCAA | CCG | Oryza sativa L. | not found | pollen,embryo sac | CRISPR-Cas9 |
| PCdb_1250 | 28584067 | BnaA.ALC | Basic helix鈥恖oop鈥恏elix transcription factor ALCATRAZ homolog | CTTGTGCAGCCGCTGAAACT | CCG | Brassica napus L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1251 | 36835599 | CHS7 | Chalcone synthase 7, key enzyme in flavonoid/anthocyanin biosynthesis | CTTCAATTTTCCAGCGGCTA | CCG | Glycine max (L.) Merr. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1252 | 32645290 | ZmMS26 | Cytochrome P450 MS26 (male sterility) | CTTAATCCACGACAAATAAC | CCG | Zea mays L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1253 | 31585004 | SAUR41 subfamily | inducible to modulate cell expansion and salt tolerance | CTGGTCACGTACCTGTCTAC | CCG | Arabidopsis thaliana (L.) Heynh. | not found | seed | CRISPR-Cas9 |
| PCdb_1254 | 37820936 | TaATX4 | Improvement of wheat drought tolerance | CTGCAGCACGCCCCGGAGGT | CCG | Triticum aestivum L. | not found | not found | CRISPR-Cas9 |
| PCdb_1255 | 36587283 | gibberellin 3鈥恛xidase | Gibberellin 3-oxidase (gibberellin biosynthesis) [Source: UniProt] | CTCATCGCCTCCTACGTCTC | CCG | Hordeum vulgare L. | not found | coleoptile | CRISPR-Cas9 |
| PCdb_1256 | 33547931 | OSFucT | Fucosyltransferase (cell wall modification) | CGGTCGAGAGCTGGACCACCT | CCG | Oryza sativa L. | not found | protoplast | not found |
| PCdb_1257 | 30839150 | Ms1 | Wheat MALE STERILITY 1 transcription factor (anther development) | CGGGCTGCTGCTGGTGGCGG | CCG | Triticum aestivum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1258 | 35929662 | Ghir_A12G012140 | Ghir_A12G012140 (Gossypium hirsutum WRKY transcription factor A12G012140) [Source: CottonGen] | CGGAGGGACACTACGAGCCT | CCG | Gossypium hirsutum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1259 | 27148303 | IR and Rep of CABs | Intergenic region and repetitive elements of chloroplast DNA [Source: NCBI] | CGCGATTTTTTTGTGGGCCC | CCG | Gossypium hirsutum L. | not found | germplasm | CRISPR-Cas9 |
| PCdb_1260 | 33971367 | not found | not found | CGCCCTTCACATCAGCTACT | CCG | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1261 | 28326091 | SBEI | Starch branching enzyme I | CGCCCGCTCCGCTCCTTCCC | CCG | Oryza sativa L. | 26.7-40% | mutant lines | cas9 |
| PCdb_1262 | 32645290 | ZmMS26 | Cytochrome P450 MS26 (male sterility) | CGATGCAACGCATATGTGGC | CCG | Zea mays L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1263 | 28009483 | CBF1 | C-repeat binding factor 1 | CCTTGAGGCTCGTAATCGGA | CCG | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1264 | 34848714 | VviPLATZ1 | a major factor that controls female flower morphology determination in Vitis L.vine | CCTTCTACAGGTGCACCCCT | CCG | Vitis vinifera L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1265 | 35410430 | Sb-Kaf | during rapid de novo shoot regeneration | CCTGTTATGATGCGCATTTA | CCG | Hemisorghum C.E.Hubb. ex Bor | not found | embryo | CRISPR-Cas9 |
| PCdb_1266 | 37997505 | a dominant resistance gene | Dominant disease resistance | CCTCACTAACATCAGCTAC | CCG | Oryza sativa L. | not found | not found | CRISPR-Cas9 |
| PCdb_1267 | 35876823 | not found | not found | CCGTCTCTGCTGTACGACGA | ccg | Zea mays L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1268 | 25038773 | MLO | Mildew resistance locus O | CCGTCACGCAGGACCCAATCTCC | CCG | Triticum aestivum L. | 0.804 | protoplast | CRISPR-Cas9 |
| PCdb_1269 | 34274523 | TaGASR7 | Wheat gibberellin-stimulated regulator protein 7 | CCGGGCACCTACGGCAACAA | CCG | Triticum aestivum L. | 12.9-100% | protoplast | not found |
| PCdb_1270 | 29723918 | TaGASR7 | Wheat gibberellin鈥恠timulated regulator protein 7 | CCGGGCACCTACGGCAAC | CCG | Triticum aestivum L. | not found | protoplast | CRISPR-Cas9,TALEN,Base editor |
| PCdb_1271 | 29036337 | CLE14 | CLE-Peptide-Encoding Genes | CCGGCCGCAAGCTCCCTAGT | CCG | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1272 | 29797189 | CrtR-b2 | 尾-carotene hydroxylase CrtR-b2 | CCCCGCCGGTTCTGTTCTTC | CCG | Solanum lycopersicum L. | 0.69 | Regenerated shoots | CRISPR-Cas9 |
| PCdb_1273 | 35159251 | LOC542650 | Hypothetical protein LOC542650 [Source: NCBI] | CCATGTTTGACGTGGAGTA | ccg | Zea mays L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1274 | 35485228 | not found | not found | CATGGTCGCTCAAGGAGTT | CCG | Zea mays L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1275 | 33950284 | OsCOP 1 | regulates embryo development and flavonoid biosynthesis in rice | CATGGGTGACTCGACGGTGG | CCG | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1276 | 37119891 | NlugGr23a | Gustatory receptor (NlugGr23a) | CAGTTGGGCCCAATTCCAAG | CCG | Oryza sativa L. | not found | testis,sperm | CRISPR-Cas9 |
| PCdb_1277 | 34143557 | pinb | wheat grain quality improvement | CAGGAGCGGCCGAAGCTAAG | CCG | Triticum aestivum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1278 | 30477421 | Pinb | Puroindoline b (grain hardness protein) | CAGGAGCGGCCGAAGCTAAG | CCG | Triticum aestivum L. | 0.5417 | protoplast | CRISPR-Cas9 |
| PCdb_1279 | 37521929 | not found | not found | CAGCTGCTCGACAGGTTTGG | CCG | Paspalum notatum Fl眉gg茅 | not found | callus | CRISPR-Cas9 |
| PCdb_1280 | 36041562 | not found | not found | CAGCCTCAGGCGGCCAAG | CCG | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1281 | 29476918 | not found | not found | ATTTTATGACTGAGTATGT | CCG | Oryza sativa L. | not found | protoplast | CRISPR-Cas9,Base editor |
| PCdb_1282 | 35192362 | not found | not found | ATGATCCCGAGTGGTGGCA | CCG | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9,Base editor |
| PCdb_1283 | 30375064 | not found | not found | ATCGTCGGCAACATGGCGAT | CCG | Oryza sativa L. | not found | protoplast | not found |
| PCdb_1284 | 32808386 | BnaA09.ZEP | Zeaxanthin epoxidase | AGTTTTCTTGGGATACAAG | CCG | Brassica napus L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1285 | 30319576 | PsMAD1 | MADS-box transcription factor 1 homolog (development) | AGTCGCAGTCTTCGAGCAGC | CCG | Glycine max (L.) Merr. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1286 | 35216118 | not found | not found | AGGGTACCTGCATATAATTG | CCG | Arabidopsis thaliana (L.) Heynh. | not found | leaf | CRISPR-Cas9 |
| PCdb_1287 | 35216118 | KpnI | KpnI restriction endonuclease (Type II restriction enzyme) [Source: REBASE] | AGGGTACCTGCATATAATTG | CCG | Arabidopsis thaliana (L.) Heynh. | 0.01 | leaf | CRISPR-Cas9 |
| PCdb_1288 | 27148303 | Rep-A of alphasatellite | Alphasatellite replication-associated protein (Rep-A, viral replication) | AGGCTGGTGTAGTATTACCC | CCG | Gossypium hirsutum L. | not found | germplasm | CRISPR-Cas9 |
| PCdb_1289 | 32535959 | not found | not found | AGGATCCACTTCATGCTTTC | CCG | Oryza sativa L. | not found | protoplast | Base editor |
| PCdb_1290 | 35159251 | LOC542650 | Hypothetical protein LOC542650 [Source: NCBI] | AGCGCTGCTTCTTCTGGAT | ccg | Zea mays L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1291 | 33657669 | not found | not found | AGACTCACACGTGATCTATA | CCG | Brassica napus L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1292 | 29476916 | OsSPL14 | Rice SQUAMOSA promoter-binding protein-like 14, regulates ideal plant architecture | ACTCGAGCTGTGCTCTCTCT | CCG | Oryza sativa L. | not found | protoplast | Base editor |
| PCdb_1293 | 29036337 | CLE45 | CLE-Peptide-Encoding Genes | ACGCGTTCTCGAGGAAGTTA | CCG | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1294 | 34426588 | not found | not found | ACGATTTCTTCACGTGGGA | CCG | Oryza sativa L. | not found | Subcellular Fractions | CRISPR-Cas9 |
| PCdb_1295 | 33950284 | OsCOP 1 | regulates embryo development and flavonoid biosynthesis in rice | ACAGGGACCTCCTCTCCCCG | CCG | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1296 | 32591429 | ZmNRPC 2 | RNA polymerase C2 subunit | AATTGAAGCGCGCAACGATC | CCG | Zea mays L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1297 | 31548867 | BnLPAT2 | Lysophosphatidic acid acyltransferase 2 | AAGTGATATTGATTGGCT | CCG | Brassica napus L. | not found | seed | CRISPR-Cas9 |
| PCdb_1298 | 37841627 | CPR5 | Defense regulator CPR5 | AAGGCTCCCGCCTICAAACCA | CCG | Glycine max (L.) Merr. | not found | not found | CRISPR-Cas9 |
| PCdb_1299 | 28009483 | CBF2 | C-repeat binding factor 2 | AAGCTTGCCACGAGCTGCCC | CCG | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1300 | 29036339 | MAF1 | isoforms to temperature-dependent flowering | AACTTAATTCTCTAGAGTT | CCG | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1301 | 37323119 | not found | not found | AACGCCCTCACCATCCTCCT | CCG | Oryza sativa L. | not found | blast,plants,plant | CRISPR-Cas9 |
| PCdb_1302 | 35929662 | Ghir_D12G012350 | Ghir_D12G012350 (Gossypium hirsutum hypothetical protein D12G012350) [Source: CottonGen] | TTACCCOCCCATTCGAAACG | CCC | Gossypium hirsutum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1303 | 35098208 | not found | not found | TTAAATTTATTTGCACTACT | ccc | Glycine max (L.) Merr. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1304 | 27148303 | IR and Rep of CABs | Intergenic region and repetitive elements of chloroplast DNA [Source: NCBI] | TGTGCGTGAATCCATGGTTG | CCC | Gossypium hirsutum L. | not found | germplasm | CRISPR-Cas9 |
| PCdb_1305 | 27066031 | DEP1 | G protein subunit, DENSE AND ERECT PANICLE1 (DEP1) | TGTACAGCTGCTTCAAGATC | CCC | Oryza sativa L. | 0.675 | Mature seeds | CRISPR-Cas9 |
| PCdb_1306 | 27066031 | DEP1 | G protein subunit, DENSE AND ERECT PANICLE1 (DEP1) | TGTACAGCTGCTTCAAGATC | CCC | Oryza sativa L. | 0.675 | Mature seeds | CRISPR-Cas9 |
| PCdb_1307 | 36613871 | PtrFLA40 and PtrFLA45 | Populus FASCICLIN-like arabinogalactan proteins 40/45 (PtrFLA40/45, cell wall) | TGGTITAACCATCTTTGCAC | CCC | Populus sp. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1308 | 37161940 | AcNAC1 | NAC domain transcription factor 1 | TGG TTTTCTATGGAGGAAAG | ccc | Actinidia chinensis Planch. | not found | oocytes,fruits,fruit | CRISPR-Cas9 |
| PCdb_1309 | 30544514 | AtCDC45 | DNA replication factor CDC45 | TGCAGGCTTCATGCTCCGAC | CCC | Arabidopsis thaliana (L.) Heynh. | 80.9-100% | protoplast | CRISPR-Cas9 |
| PCdb_1310 | 31035982 | FAD2 | FAD2 (Fatty acid desaturase 2, EC 1.14.19.2, linoleic acid biosynthesis) [Source: UniProt] | TCGACCGCGACGAAGTGTTT | CCC | Arachis hypogaea L. | 0.828 | protoplast | CRISPR-Cas9 |
| PCdb_1311 | 27148303 | IR and Rep of CABs | Intergenic region and repetitive elements of chloroplast DNA [Source: NCBI] | TCGAACTGGATGAGCACATG | CCC | Gossypium hirsutum L. | not found | germplasm | CRISPR-Cas9 |
| PCdb_1312 | 25733849 | MPK2 | Mitogen-activated protein kinase 2 (defense response) [Source: TAIR] | TCCTTGAGGCGACCGGGTTC | CCC | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1313 | 27576893 | IdnDH | L-Idonate 5-dehydrogenase (uronate metabolism) [Source: BRENDA] | TCCTAACTTTAACATCATGG | CCC | Vitis vinifera L. | 1 | induced embryogenic callus, | CRISPR-Cas9 |
| PCdb_1314 | 32842152 | SPO11-2 | in meiosis in rice | tcccgccgaggtcagccgct | CCC | Arabidopsis thaliana (L.) Heynh. | not found | calli | CRISPR-Cas9 |
| PCdb_1315 | 29036337 | CLE43 | CLE-Peptide-Encoding Genes | TCATGACCTCCAAGAACAAG | CCC | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1316 | 31198943 | miR396-encoding gene | leaf growth and developmental phase transition | TAACTTCTGTCTATGAGTTT | CCC | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1317 | 38013635 | MusaENODL3 | Early nodulin-like protein involved in pollen tube guidance and fertilization processes during banana reproductive development. | GTTCACGGACTTCTTGCTCA | CCC | Musa L. | not found | protoplast | CRISPR/Cas9 |
| PCdb_1318 | 32415890 | OSALS | not found | GGGTATGGTGGTGCAATGGG | CCC | Oryza sativa L. | not found | protoplast | Prime editor |
| PCdb_1319 | 39674177 | lin5 | Confers heat-stress resilience | GGCTAACCTATCTGATCCAT | CCC | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1320 | 33526582 | APETALA2 | control flower and grain development in barley | GGCCGAGGGCGGCCCCG | CCC | Hordeum vulgare L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1321 | 32742269 | ZmGA20ox3 | Generation of Transgene-Free Semidwarf Maize Plants | GGAGCCATTCCTGTGGCCGC | CCC | Zea mays L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1322 | 33121183 | not found | not found | GCGGGTTTCGTAGCACCC | CCC | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1323 | 36382925 | not found | not found | GCGGGAGGACAGGGTGGTGC | CCC | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1324 | 29392632 | AtGGAT1 | Gamma-glutamyl amino acid transferase 1, involved in amino acid metabolism | GACATAGATGCAATAACTTC | CCC | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | not found |
| PCdb_1325 | 36330262 | GSH1 | Glutamate-cysteine ligase | GAATTCCTCGTTGTACCCT | CCC | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1326 | 34240197 | Gmpin1abc-L1 | involved in soybean nodule development | CTTCATAGCCTCCAACAA | CCC | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1327 | 36204067 | DIS1 | Distorted root hair initiation protein | CTGTGTCGTGGGAAGGCCAT | CCC | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1328 | 27148303 | IR and Rep of CABs | Intergenic region and repetitive elements of chloroplast DNA [Source: NCBI] | CTGTGCGTGAATCCATGGTT | CCC | Gossypium hirsutum L. | not found | germplasm | CRISPR-Cas9 |
| PCdb_1329 | 36616184 | OsOr | Oryza sativa Orange protein (OsOr, carotenoid accumulation) | CTGGTAAGTATATATACTTC | CCC | Oryza sativa L. | not found | protoplast | not found |
| PCdb_1330 | 29036337 | CLE46 | CLE-Peptide-Encoding Genes | CTCGGGACCTAACCCAACAG | CCC | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1331 | 31198943 | miR396-encoding gene | leaf growth and developmental phase transition | CTCACTCCCTCTTTCCACAA | CCC | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1332 | 28349304 | Hd1 | CONSTANS-like heading date regulator | CGGCCGCGCTCGCGTGCCG | CCC | Oryza sativa L. | 0.78 | protoplast | CRISPR-Cas9 |
| PCdb_1333 | 36871136 | CsPrx5 | Peroxidase class III enzyme; functions in reactive oxygen species (ROS) metabolism. | CGGCAGAGATAGCAGAAGAG | CCC | Cucumis sativus L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1334 | 35679334 | GmTCP19L | increasing susceptibility to Phytophthora sojae | CGCGGATCTTCCAGCTCACC | ccc | Glycine max (L.) Merr. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1335 | 26507366 | Avr46 | Avirulence effector (pathogen recognition) | CGCGATGCAACCATCGTCGA | ccc | Glycine max (L.) Merr. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1336 | 30208656 | BnWRKY11 | WRKY transcription factor 11 homolog | CGCCGCGTCTCCTCATAAAAC | CCC | Brassica napus L. | 0.545 | seed | CRISPR-Cas9 |
| PCdb_1337 | 32170801 | PHYTOENE DESATURASE | Phytoene desaturase (carotenoid biosynthesis) | CGAAGCTTTACCCGCTCCTT | CCC | Solanum tuberosum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1338 | 36105709 | inactivation of the kauniolide synthase | Kauniolide synthase (sesquiterpene lactone biosynthesis) [Source: NCBI] | CATCATGAGCCTGCAACTCG | CCC | Cichorium intybus L. | not found | root | CRISPR-Cas9 |
| PCdb_1339 | 35534986 | not found | not found | CACCATGGGATCCTAGTCCG | CCC | Oryza sativa L. | not found | protoplast | Base editor |
| PCdb_1340 | 27148303 | IR and Rep of CABs | Intergenic region and repetitive elements of chloroplast DNA [Source: NCBI] | ATTGTCCGCGTCACAAAGC | CCC | Gossypium hirsutum L. | not found | germplasm | CRISPR-Cas9 |
| PCdb_1341 | 30610223 | MTL | MATRILINEAL (phospholipase mediating seed development) [Source: UniProt] | ATGGCACTAAGGCTCTCCG | CCC | Oryza sativa L. | not found | protoplast | not found |
| PCdb_1342 | 29036337 | CLE17 | CLE-Peptide-Encoding Genes | ATCGTTGATTGGAGTAGACA | CCC | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1343 | 32630379 | GmNMHC5 | A Neoteric Positive Transcription Factor of Flowering and Maturity in Soybean | ATCACCTCATGAATCCGG | CCC | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1344 | 36233329 | GmNAC 12 | Glycine max NAC domain-containing protein 12 (stress response transcription factor) [Source: SoyBase] | ATCAAGCTCAAAGACTCCTC | CCC | Glycine max (L.) Merr. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1345 | 28725235 | At1g68170 | Arabidopsis thaliana gene AT1G68170 (uncharacterized protein) | agtgtactcgtggcctat | CCC | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1346 | 35984919 | not found | not found | AGTCCAAGAGGACCTCCAAA | CCC | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1347 | 27148303 | Rep-A of alphasatellite | Alphasatellite replication-associated protein (Rep-A, viral replication) | AGATGACCGCACTATCTTCT | CCC | Gossypium hirsutum L. | not found | germplasm | CRISPR-Cas9 |
| PCdb_1348 | 36403232 | TaSPL13 | Wheat SPL13 transcription factor (TaSPL13, development) | AGAGAAGACAGUUCGUCGG | ccc | Triticum aestivum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1349 | 34848714 | VviPLATZ1 | a major factor that controls female flower morphology determination in Vitis L.vine | ACTGTTTGCTCCCTCACCGCC | CCC | Vitis vinifera L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1350 | 35332341 | RNase H | Ribonuclease H (RNase H, nucleic acid metabolism) | ACGGCGTGCAGTGCTTCAGC | CCC | Oryza sativa L. | not found | protoplast | not found |
| PCdb_1351 | 34887519 | ZmPLD 3 | cause haploid induction | ACCGGCAATGTCAGTAGTCT | CCC | Zea mays L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1352 | 35534986 | not found | not found | ACCATGGGATCCTAGTCCGG | CCC | Oryza sativa L. | not found | protoplast | not found |
| PCdb_1353 | 35449885 | XIP | Improved the Dough Quality of Common Wheat | ACAACATCCGCGGCGGCCCG | ccc | Triticum aestivum L. | not found | plants,LM 6 | CRISPR-Cas9 |
| PCdb_1354 | 27148303 | IR and Rep of CABs | Intergenic region and repetitive elements of chloroplast DNA [Source: NCBI] | AATATCTCTGGGTTTTCAAG | CCC | Gossypium hirsutum L. | not found | germplasm | CRISPR-Cas9 |
| PCdb_1355 | 36715107 | eIF4E1 | generates resistance to multiple potyvirus isolates | AAGCAAGTTAATTATGGGAG | CCC | Solanum lycopersicum L. | not found | protoplast | Base editor |
| PCdb_1356 | 36613871 | PtrFLA40 and PtrFLA45 | Modulating Wood Cell Size and SCW Synthesis in Poplar | AAGACGAAAACCGCTTATTC | CCC | Populus sp. | not found | Cell Wall | CRISPR-Cas9 |
| PCdb_1357 | 32358986 | BnCRT1a | Carotene isomerase (CRTISO) 1a | AACTTCATCTCTCTGATTCTT | CCC | Brassica napus L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1358 | 37323119 | not found | not found | AACGCCCTCACCATCCTCCT | CCC | Oryza sativa L. | not found | blast,plants,plant | CRISPR-Cas9 |
| PCdb_1359 | 37323119 | not found | not found | AACGCCCTCACCATCCTCCT | CCC | Oryza sativa L. | not found | blast,plants,plant | CRISPR-Cas9 |
| PCdb_1360 | 35604091 | BAHD acyltransferases | Plant acyl-CoA-dependent acyltransferases, involved in secondary metabolite biosynthesis | TACCCCCCTTGAAGAAGTCC | CCA | Cichorium intybus L. | not found | hairy root | CRISPR-Cas9 |
| PCdb_1361 | 25733849 | MPK1 | Mitogen-activated protein kinase 1 (growth regulation) [Source: TAIR] | TTTTATACCCCGGTGGGCCA | cca | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1362 | 35563030 | GBSS | GBSS (Granule-bound starch synthase, EC 2.4.1.242, amylose biosynthesis) [Source: UniProt] | TTGTTTTGGAAAGGGAATGAAC | CCA | Solanum tuberosum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1363 | 27148303 | IR and Rep of CABs | Intergenic region and repetitive elements of chloroplast DNA [Source: NCBI] | TTGTCCGCGTCACAAAGCA | CCA | Gossypium hirsutum L. | not found | germplasm | CRISPR-Cas9 |
| PCdb_1364 | 32429836 | TFL1 | TERMINAL FLOWER 1 floral repressor | TTGATAGTGGGAAGAGTGGT | CCA | Brassica napus L. | not found | calli | CRISPR-Cas9 |
| PCdb_1365 | 33131175 | FAD2 | Fatty acid desaturase 2 | TTCCGCCCCACTGTTTTCGC | CCA | Gossypium hirsutum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1366 | 27148303 | IR and Rep of CABs | Intergenic region and repetitive elements of chloroplast DNA [Source: NCBI] | TTCCCAATATCTCTGGGTTT | CCA | Gossypium hirsutum L. | not found | germplasm | CRISPR-Cas9 |
| PCdb_1367 | 36028578 | eIF4E | enhance PVY resistance in tobacco | TTAGAGAATTCTTGGACTTT | CCA | Solanum tuberosum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1368 | 30465094 | not found | not found | TGTCCAGCCCATCGGATGTC | CCA | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1369 | 27148303 | IR and Rep of CABs | Intergenic region and repetitive elements of chloroplast DNA [Source: NCBI] | TGGTTGTGGCAGTTGATTGA | CCA | Gossypium hirsutum L. | not found | germplasm | CRISPR-Cas9 |
| PCdb_1370 | 29036337 | CLE18 | CLE-Peptide-Encoding Genes | TGGGAACGATCGCTAACTCT | CCA | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1371 | 34254310 | PjIPT1a | Poncirus trifoliata isopentenyltransferase 1a (cytokinin biosynthesis) | TGGCGTCCACCACCACCG | CCA | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1372 | 36012245 | OsPIN1b | Oryza sativa PIN-FORMED 1b auxin transporter (OsPIN1b, auxin distribution) | TGCTCACGGCGTGGAGCCAC | CCA | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1373 | 29797189 | Psy1 | Phytoene synthase 1 (Psy1) | TCTGGAGAACGGACGATGAC | CCA | Solanum lycopersicum L. | 0.69 | Regenerated shoots | CRISPR-Cas9 |
| PCdb_1374 | 35082818 | LeRBOH & LeRBOHE | Respiratory burst oxidase homolog D/E (reactive oxygen species production) [Source: SolGenomics] | TCTAGCAAGTAA TCCGTCTT | CCA | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1375 | 30729010 | BoMS1 | Male sterility 1 protein, involved in pollen development in Brassica oleracea | TCGAAGCCTCTCTTAACCTC | CCA | Brassica oleracea var. capitata L. | 0.2778 | hypocotyl | CRISPR-Cas9 |
| PCdb_1376 | 31684940 | EPSPS | 5-enolpyruvylshikimate-3-phosphate synthase | TCCGTATGTTTGGAGACTGATC | CCA | Triticum aestivum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1377 | 31002444 | not found | not found | TCCAAGGTGATTTCAGTGCC | CCA | Oryza sativa L. | not found | protoplast | not found |
| PCdb_1378 | 30381456 | T92 C | Tomato cultivar 92C marker gene | TCACGACTATGTTTATTG | CCA | Gossypium hirsutum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1379 | 36457532 | not found | not found | TCACCGGCCAGGTCCCCCGC | CCA | Glycine max (L.) Merr. | 0.592 | hairy root | CRISPR-Cas9 |
| PCdb_1380 | 39348559 | BnaA02 | Brassica napus gene located on chromosome A02; function context-dependent and varies by specific locus. | TAATCTGTAATCATCAGCGT | CCA | Brassica napus L. | not found | hypocotyl | CRISPR-Cas9 |
| PCdb_1381 | 36818855 | Osv-ATPase d | Vacuolar ATPase subunit d | GTGCGAGAACCTCGACGACG | CCA | Oryza sativa L. | not found | protoplast | not found |
| PCdb_1382 | 36222582 | OsZAS | OsZAS2 expression increased during mycorrhization, specifically in arbuscule-containing cells. | GGTCACTAGATGCATTCATCT | CCA | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1383 | 31344311 | TaPLA | Wheat phospholipase A1 (haploid induction factor) | GGGACGTCAACCGCTTC | CCA | Triticum aestivum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1384 | 36768486 | g2P1 | single-guide RNA targeting PDS gene variant | GCGTGCTCACG TGGATGGTC | CCA | Triticum aestivum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1385 | 36305009 | BES1 | BRI1-EMS suppressor 1 transcription factor | GCGGCGGAGAAGAGCTTTG | CCA | Arabidopsis thaliana (L.) Heynh. | 0.2 | protoplast | CRISPR-Cas9 |
| PCdb_1386 | 28326091 | SBEIIb | Starch branching enzyme IIb | GCCTTAGATGATGAATTAAG | CCA | Oryza sativa L. | 26.7-40% | mutant lines | cas9 |
| PCdb_1387 | 29036339 | MAF1 | isoforms to temperature-dependent flowering | GCATTTCCAAGATCATTGAT | CCA | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1388 | 35456898 | PDS | Phytoene desaturase (PDS, carotenoid biosynthesis) | GCATCTGCCAGATATTTTGC | CCA | Oryza sativa L. | not found | protoplast | not found |
| PCdb_1389 | 36222582 | OsZAS | Oryza sativa ZEITLUPE/ADAGIO-like protein (OsZAS, circadian clock) | gcagatctgaagagactgat | CCA | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1390 | 33391326 | GOLS | Galactinol synthase | GCAATGCCCGGAGAAGGTGC | cca | Glycine max (L.) Merr. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1391 | 30159598 | OsGn1a | Cytokinin oxidase regulating grain number | GATGCTGCAGAGAGTAAGCC | CCA | Oryza sativa L. | not found | chloroplast | CRISPR-Cas9 |
| PCdb_1392 | 27148303 | Rep-A of alphasatellite | Alphasatellite replication-associated protein (Rep-A, viral replication) | GATGACCGCACTATCTTCTG | CCA | Gossypium hirsutum L. | not found | germplasm | CRISPR-Cas9 |
| PCdb_1393 | 33547931 | OsXyIT | Xylosyltransferase (hemicellulose biosynthesis) | GAGTCACGGATTTACCTAACC | CCA | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1394 | 36633200 | SBP1 | SBP domain transcription factor 1 | GACCGTTGTTTGGGTTGCTAACA | CCA | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1395 | 31373135 | BnaMAX1 | MAX1 cytochrome P450 monooxygenase homolog | CTTGCCCATGCTGGCTAAG | CCA | Brassica napus L. | 0.563 | seed | CRISPR-Cas9 |
| PCdb_1396 | 30644027 | DcPDS | Phytoene desaturase | CTGCTTCCCGCCCCAATAAA | CCA | Daucus carota subsp. sativus (Hoffm.) Sch眉bl. & G.Martens | not found | protoplast | CRISPR-Cas9 |
| PCdb_1397 | 31684940 | EPSPS | 5-enolpyruvylshikimate-3-phosphate synthase | CTGACGGCAGCTGTAGTAGC | CCA | Triticum aestivum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1398 | 33774917 | not found | not found | CTCCACCGACCATGCCCTCC | CCA | Eucalyptus grandis聽W. Hill ex Maiden | not found | protoplast | CRISPR-Cas9 |
| PCdb_1399 | 33176692 | Glyma.U020300.1 | Hypothetical protein Glyma.U020300.1 [Source: SoyBase] | CTCAGCGAACCGGATATTGG | cca | Glycine max (L.) Merr. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1400 | 29036337 | CLE9 | CLE-Peptide-Encoding Genes | CGTGACTCCTCACCGTTCGT | CCA | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1401 | 34160096 | GoFLA19 | Gossypium FASCICLIN-like arabinogalactan protein 19 (cell wall biosynthesis) [Source: CottonGen] | CGTCTCCCCACATTTCCTCT | CCA | Gossypium hirsutum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1402 | 31705705 | BnaA9.WRKY47 | contributes to the adaptation of rape to low boron stress | CGGTAACTTTCTATCAAGTT | CCA | Brassica napus L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1403 | 35755680 | QLD (Wxa) and YSZ (Wxb) | Waxy granule-bound starch synthase alleles (amylose synthesis) | CGGGTTCCAGGGCCTCAAGC | CCA | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1404 | 37323119 | not found | not found | CGGGATAGCAGAGGAGCTAC | CCA | Oryza sativa L. | not found | blast,plants,plant | CRISPR-Cas9 |
| PCdb_1405 | 35114063 | Ghir_D02G025140 | Ghir_D02G025140 (Gossypium hirsutum MYB transcription factor D02G025140) [Source: CottonGen] | CGGAGGGACACTACGAGCCT | CCA | Gossypium hirsutum L. | not found | microspore,male gametophyte,pollen,POLLEN,tapetum,anthers | CRISPR-Cas9 |
| PCdb_1406 | 35055026 | Ara h 2 | Ara h 2 allergen, major peanut allergen protein | cgcatctgcgaggcagcagt | cca | Arachis hypogaea L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1407 | 34884871 | SpDIR1L | Implicated in S-RNase-Independent Pollen Rejection | CCTTCATCAATTGGTCA | CCA | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1408 | 30291759 | MYB44 | MYB transcription factor 44 | CCGGGGAGTGGTGGGGGGTT | CCA | Gossypium hirsutum L. | 0.701 | leaf | CRISPR-Cas9 |
| PCdb_1409 | 30291759 | MYB44 | MYB transcription factor 44 | CCGGGGAGTGGTGGGGGGTT | CCA | Gossypium hirsutum L. | 0.701 | leaf | CRISPR-Cas9 |
| PCdb_1410 | 37247337 | LsCPT 3 | Copayl diphosphate synthase 3 (diterpenoid biosynthesis) [Source: NCBI] | CCGCTAAGAACTCACGCACA | CCA | Solidago canadensis L. | not found | laticifers,laticifer,plants,hairy roots,plant | CRISPR-Cas9 |
| PCdb_1411 | 27066031 | IPA1 | SPL transcription factor Ideal Plant Architecture1 (IPA1) | CCGACTCGAGCTGTGTGCTCTC | CCA | Oryza sativa L. | 0.275 | Mature seeds | CRISPR-Cas9 |
| PCdb_1412 | 32339389 | not found | not found | CCCACACCACCACCCCCTCT | CCA | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1413 | 35534986 | not found | not found | CCATGGGATCCTAGTCCGGC | CCA | Oryza sativa L. | not found | protoplast | not found |
| PCdb_1414 | 37047735 | WAX INDUCER 1 | Regulates -Diketone Biosynthesis by Mediating Expression of the Cer-cqu Gene Cluster | CCACTGGGGCTCCTGGGTCTCC | CCA | Hordeum vulgare L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1415 | 36068333 | OsFTL4 | Regulates Flowering Time and Drought Tolerance in Rice | CATGTTGAGATTGAAGGTCG | CCA | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1416 | 36105709 | inactivation of the kauniolide synthase | Kauniolide synthase (sesquiterpene lactone biosynthesis) [Source: NCBI] | CATCGTGCTTTCCTCTCGTT | CCA | Cichorium intybus L. | not found | root | CRISPR-Cas9 |
| PCdb_1417 | 34160096 | GoFLA19 | are responsible for the male sterility caused by hybrid breakdown in cotton | CATCGGATCTCCAAGTCCGC | CCA | Gossypium hirsutum L. | not found | chloroplast | CRISPR-Cas9 |
| PCdb_1418 | 31116473 | GhCLA | Phytoene desaturase | CATAGCCGCAACGGTGTTCAA | cca | Gossypium hirsutum L. | not found | protoplast | CRISPR-Cas9,Base editor |
| PCdb_1419 | 32842152 | SPO11-2 | in meiosis in rice | caggatcagaggtgcactcc | CCA | Arabidopsis thaliana (L.) Heynh. | not found | calli | CRISPR-Cas9 |
| PCdb_1420 | 31198943 | miR396-encoding gene | leaf growth and developmental phase transition | CAGCTTTCTTGAACTGCAAA | CCA | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1421 | 33484494 | PsPP2Ab1 | Protein phosphatase 2A regulatory subunit B鈥?,CAACGCCGAGTTCGACTACC" | CCA | Glycine max (L.) Merr. | not found | protoplast | CRISPR-Cas9 | not found |
| PCdb_1422 | 29036337 | CLE6 | CLE-Peptide-Encoding Genes | CAACCATGGGCGATATGGAT | CCA | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1423 | 36617723 | not found | not found | CAACAACCATTTCTCCAGC | CCA | Triticum aestivum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1424 | 29511025 | LsNCED4 | 9-cis-epoxycarotenoid dioxygenase 4 (abscisic acid biosynthesis) [Source: NCBI] | ATTGGCGAACTGCATGGCCA | CCA | Lactuca sativa L. | 0.467 | protoplast | CRISPR-Cas9 |
| PCdb_1425 | 32849670 | HIS1 | Histidinol dehydrogenase 1 (histidine biosynthesis) [Source: NCBI] | ATGGCTGACGAGTCATGGAG | CCA | Oryza sativa L. | not found | calli | CRISPR-Cas9 |
| PCdb_1426 | 32842152 | SPO11-2 | in meiosis in rice | ATGgatgattcaacggatga | CCA | Arabidopsis thaliana (L.) Heynh. | not found | calli | CRISPR-Cas9 |
| PCdb_1427 | 27208253 | ABP1 | Auxin-binding protein 1 | ATCGAATTTCCAATCTTTGC | CCA | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1428 | 35133010 | OsADK1 | a novel kinase regulating arbuscular mycorrhizal symbiosis in rice | ATCCCAGTGAGGGCCACGCT | CCA | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1429 | 27148303 | IR and Rep of CABs | Intergenic region and repetitive elements of chloroplast DNA [Source: NCBI] | ATATCTCTGGGTTTTCAAGT | CCA | Gossypium hirsutum L. | not found | germplasm | CRISPR-Cas9 |
| PCdb_1430 | 30644027 | DcPDS | Phytoene desaturase | AGTTTACGCGAACACGCCCC | CCA | Daucus carota subsp. sativus (Hoffm.) Sch眉bl. & G.Martens | 0.353 | protoplast | CRISPR-Cas9 |
| PCdb_1431 | 28883826 | OsHDT701 | Histone deacetylase (HDT701) | AGTGAAGAATGAGACAACGG | CCA | Oryza sativa L. | not found | protoplast | not found |
| PCdb_1432 | 29753601 | Aa2 | Aux/IAA protein Aa2 | AGGAGTTGCCTCGATGGTC | CCA | Brassica napus L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1433 | 27212389 | OsYSA | Chloroplast development regulator YELLOW SEEDLING ALBINISM (OsYSA) | AGCTTATGTTGAAGCTCAAG | CCA | Oryza sativa L. | 0.29 | callus | CRISPR-Cas9 |
| PCdb_1434 | 32429836 | TFL1 | TERMINAL FLOWER 1 floral repressor | AGCCTAGGGTTGAGATCCAT | CCA | Brassica napus L. | not found | calli | CRISPR-Cas9 |
| PCdb_1435 | 28499063 | GhCLA1 | GhCLA1 (Gossypium hirsutum 1-deoxy-D-xylulose 5-phosphate synthase, chloroplast development) [Source: CottonGen] | AGCAAATCGGTGGGCCTATG | CCA | Gossypium hirsutum L. | 0.9231 | hypocotyl | CRISPR-Cas9 |
| PCdb_1436 | 32719704 | PDS | Phytoene desaturase (PDS, carotenoid biosynthesis) | AGACCGGACCTTGATAACAC | CCA | Populus sp. | 0.855 | protoplast | CRISPR-Cas9 |
| PCdb_1437 | 26193631 | PtoPDS | Tomato phytoene desaturase (PtoPDS, carotenoid biosynthesis) | AGACCGGACCTTGATAACAC | CCA | Populus sp. | 0.517 | leaf | CRISPR-Cas9 |
| PCdb_1438 | 34259977 | PagPDS1 | Panicum antidotale phytoene desaturase (PagPDS1, carotenoid biosynthesis) | AGACCGGACCTTGATAACAC | CCA | Populus 脳 canadensis Moench (and other hybrids) | 0.745 | hybrid poplar | CRISPR-Cas9 |
| PCdb_1439 | 36679080 | BnCYP704B1 | Confers Male Sterility in Rapeseed | AGAATCTTAGAGACTTCAGT | CCA | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1440 | 37323119 | not found | not found | AGAAGATCCGCCTCTCCACC | CCA | Oryza sativa L. | not found | blast,plants,plant | CRISPR-Cas9 |
| PCdb_1441 | 32849670 | HIS1 | Histidinol dehydrogenase 1 (histidine biosynthesis) [Source: NCBI] | AGAACAAGAACACCAATGGC | CCA | Oryza sativa L. | not found | calli | CRISPR-Cas9 |
| PCdb_1442 | 29036337 | CLE40 | CLE-Peptide-Encoding Genes | ACTGGATCCGACCCTCTTCA | CCA | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1443 | 29036337 | CLE25 | CLE-Peptide-Encoding Genes | ACTGGATCCGACCCTCTTCA | CCA | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1444 | 28509421 | GmFT2a | Florigen FT homolog | ACCAAGGGTAAATATCGGTG | CCA | Glycine max (L.) Merr. | 0.37 | leaf | CRISPR-Cas9 |
| PCdb_1445 | 30405669 | not found | not found | AAGGAGATTTGGGGGTTGGA | CCA | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1446 | 30405669 | Pks401g | Polyketide synthase 401g | AAGGAGATTTGGCGCTTGGA | CCA | Brassica napus L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1447 | 29036337 | CLE21 | CLE-Peptide-Encoding Genes | AAGCTTCATGATCTTGACTC | CCA | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1448 | 35710302 | SP3C | SELF-PRUNING 3C (SP3C, shoot architecture) | AAGCCGGTAATTGGGAT | CCA | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1449 | 27353960 | CBF1 | C-repeat binding factor 1 | AACCGCTGAGATGGCAGCT | CCA | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1450 | 31307375 | GmFAD2 | Glycine max fatty acid desaturase 2 (linoleic acid biosynthesis) [Source: SoyBase] | AACACAAAGCCACCATTCAC | CCA | Glycine max (L.) Merr. | 0.533 | hairy root | CRISPR-Cas9 |
| PCdb_1451 | 33397431 | OsCOI2 | Coronatine insensitive 2 (jasmonate signaling) | TGAGCGCGTCGACCCTGCAC | CAG | Oryza sativa L. | 29.3-2.4% | calli | ABE |
| PCdb_1452 | 36181413 | not found | not found | TGACTCCATTCTTGTATGAT | CAG | Oryza sativa L. | not found | protoplast | not found |
| PCdb_1453 | 34402093 | OsGI | salt tolerant | CTGTTCTGGCCCCCAC | CAC | Oryza sativa L. | 0.4875 | protoplast | CRISPR-Cas9 |
| PCdb_1454 | 31730252 | not found | Gene not detected or not annotated in the database | TTAATCTATAATCTCTATCTTCC | CAAA | Oryza sativa L. | not found | protoplast | CRISPR-Cas12 |
| PCdb_1455 | 31350780 | HSFB4 | Heat shock transcription factor B4 (thermotolerance regulator) [Source: TAIR] | ACCATCTGGTGAACGATCCTTCAA | CAAA | Physcomitrella patens (Hedw.) Bruch & Schimp. | not found | Protoplast | CRISPR-Cas9,CRISPR-Cas12 |
| PCdb_1456 | 30928637 | OsPDS | Oryza sativa phytoene desaturase (OsPDS, carotenoid biosynthesis) | GCAACTATGCAAGAGCTAGC | CAA | Oryza sativa L. | not found | protoplast | xCas9 |
| PCdb_1457 | 31228114 | not found | not found | GTGAGGCTATCGGATTC | ATTG | Solanum tuberosum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1458 | 38034561 | ICU 11 | ICU11 (iron-sulfur cluster assembly factor) [Source: TAIR] | GCGAGGCAAGATTGAAGCTT | ATTG | Arabidopsis thaliana (L.) Heynh. | not found | not found | CRISPR-Cas9 |
| PCdb_1459 | 37773156 | Os-TG04 | Oryza sativa TG04 transcription factor (Os-TG04, stress response) | TGTAATGCAGGGCTAAAGA | ATGAAA | Oryza sativa L. | not found | not found | Base editor,CRISPR-Cas9,CRISPRi,CRISPR-Cas12 |
| PCdb_1460 | 30706614 | U6 | U6 small nuclear RNA promoter | GTGAGCAAGGgGCGAGGAG | ATG | Triticum aestivum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1461 | 31228114 | not found | not found | GAGGCTATCGGATTQTG | ATG | Solanum tuberosum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1462 | 37032710 | not found | not found | GTTTGAACATTTCAGGTTTG | ATAGAAA | Oryza sativa L. | not found | protoplast | not found |
| PCdb_1463 | 25824104 | OsSWEET13 | Oryza sativa SWEET13 sugar transporter (OsSWEET13, sugar efflux) | GCACCACAACTCCCTT | ATAAAA | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1464 | 30928636 | PMS3 | Mismatch repair protein maintaining genome stability | TTTGTCTACCATCCATCAAG | AGT | Oryza sativa L. | 0.045 | calli | CBE |
| PCdb_1465 | 31932727 | OsCDC48 | Rice cell division control protein 48 (AAA+ ATPase involved in protein degradation and cell cycle regulation) | GTGCTACAAACCGGCCAAAC | AGT | Oryza sativa L. | 0.05 | calli | ABE |
| PCdb_1466 | 31932727 | OsCDC48 | Rice cell division control protein 48 (AAA+ ATPase involved in protein degradation and cell cycle regulation) | GTGCTACAAACCGGCCAAAC | AGT | Oryza sativa L. | 0.002 | calli | ABE |
| PCdb_1467 | 30959555 | not found | not found | GCAGAGAAGCTTGCACAACT | AGT | Oryza sativa L. | 0.082 | calli | ABE |
| PCdb_1468 | 30928635 | OsBZR1 | Brassinosteroid signaling transcription factor | GCACCCGGACACGAUACCGG | AGT | Oryza sativa L. | 0.118 | protoplast | ABE |
| PCdb_1469 | 30928637 | OsPDS | Oryza sativa phytoene desaturase (OsPDS, carotenoid biosynthesis) | gagatcatatgcagcgctgg | AGT | Oryza sativa L. | not found | protoplast | xCas9 |
| PCdb_1470 | 34984801 | OSMADS57 | MADS-box transcription factor 57 | ATCACAGCAAAGAGAAGGGG | AGT | Oryza sativa L. | not found | protoplast | CRISPR-Cas9,Base editor |
| PCdb_1471 | 30928637 | OsPDS | Oryza sativa phytoene desaturase (OsPDS, carotenoid biosynthesis) | AGTCAGCATGTGAGCTTTGG | AGT | Oryza sativa L. | not found | protoplast | xCas9 |
| PCdb_1472 | 30928637 | OsPDS | Oryza sativa phytoene desaturase (OsPDS, carotenoid biosynthesis) | AGATGGTTTTACTGTTTCTG | AGT | Oryza sativa L. | not found | protoplast | xCas9 |
| PCdb_1473 | 33328469 | BrOG1AOE | Brassica rapa overexpressor line 1A (transgenic construct) | TTCCGTCGGAGTTATCAGCC | AGGAAT | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1474 | 28790350 | not found | not found | TGCATGAAAAGCATTTGTAC | AGG | Brassica napus L. | BnaA2.DA2:47.1%, BnaC6.DA2: 82.4% | protoplast | not found |
| PCdb_1475 | 31991936 | FWL | FWL (FW2-2-like cell number regulator, plasma membrane-associated) [Source: UniProt] | CATCTTGGCGCGGTAGAAGC | AGG | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1476 | 28066464 | MLO-7 | Mildew resistance locus O 7 (powdery mildew susceptibility) [Source: TAIR] | TTTTAAGAACACATGCTCTG | AGG | Vitis vinifera L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1477 | 40364305 | BnABI5 | Drought tolerance | TTTGGTCTGAGATACATAG | AGG | Brassica napus L. | not found | seed | CRISPR/Cas9 |
| PCdb_1478 | 28528644 | Solyc03g114840 | Solyc03g114840 putative protein | TTTGGGCACGTTAAGCTCGA | AGG | Solanum lycopersicum L. | 1 | seed | CRISPR-Cas9 |
| PCdb_1479 | 35779674 | SlMADS1 | regulate tomato sepal growth | TTTGGGCACGTTAAGCTCGA | AGG | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1480 | 31694550 | PDS | Phytoene desaturase | TTTGCCATGCCAAACAAACC | AGG | Triticum aestivum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1481 | 31694550 | PDS | Phytoene desaturase | TTTCTTTTCTAACTGTTTAC | AGG | Triticum aestivum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1482 | 32970905 | Ms 2 | Fertility recovery of wheat male sterility | TTTCAGGGATGGTTCCCGGG | AGG | Triticum aestivum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1483 | 31694550 | PDS | Phytoene desaturase | TTTCACAAGTAGCAGCGTCC | AGG | Triticum aestivum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1484 | 31694550 | PDS | Phytoene desaturase | TTTATTCCTTAAGCCAAGGG | AGG | Triticum aestivum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1485 | 37176936 | FtsZ1 | FtsZ1 (Filamenting temperature-sensitive mutant Z 1, chloroplast division) [Source: UniProt] | TTTAGGGGAACACGCAGCGG | AGG | Solanum tuberosum L. | 1 | protoplast | CRISPR-Cas9 |
| PCdb_1486 | 38925598 | LOC_Os11g18140 | taste quality | TTTAATCATCAAGACGATTC | AGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_1487 | 31694550 | PDS | Phytoene desaturase | TTGTTTGCCAAGATTTTCCA | AGG | Triticum aestivum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1488 | 31694550 | PDS | Phytoene desaturase | TTGTGCTCAGTCCATAGTGC | AGG | Triticum aestivum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1489 | 37346168 | Solyc12g049300 | Tomato protein Solyc12g049300 (unknown function) | TTGTCCACACAAAGGCAATC | AGG | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1490 | 31752697 | Waxy | Granule-bound starch synthase determining amylose content | TTGTAATCAACTCCAGTGTC | AGG | Oryza sativa L. | 0.05 | calli | CBE |
| PCdb_1491 | 31782599 | Waxy | Granule-bound starch synthase determining amylose content | TTGTAATCAACTCCAGTGTC | AGG | Oryza sativa L. | 0.0625 | seed | ABE |
| PCdb_1492 | 33751803 | Waxy | Granule-bound starch synthase (Waxy, starch biosynthesis) | TTGTAATCAACTCCAGTGTC | AGG | Oryza sativa L. | 0.935 | calli | ABE |
| PCdb_1493 | 31634585 | Waxy | Granule-bound starch synthase determining amylose content | TTGTAATCAACTCCAGTGTC | AGG | Oryza sativa L. | 0.18 | calli | ABE |
| PCdb_1494 | 32841372 | BnTT8 | regulates seed production | TTGGAGACGTCATCGTCATC | AGG | Brassica napus L. | not found | seed | CRISPR-Cas9 |
| PCdb_1495 | 37952706 | Protein kinase A | regulatory subunit is required for normal growth, zoosporogenesis, and pathogenicity in Phytophthora sojae | TTGCTGCTATCTATATGTGG | agg | Glycine max (L.) Merr. | not found | not found | CRISPR-Cas9 |
| PCdb_1496 | 37346168 | Solyc09g090790 | Tomato protein Solyc09g090790 (uncharacterized) | TTGCTCGTAGCTTGCCTGGG | AGG | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1497 | 37204504 | Bra032957 | leads to the conversion of flower color from yellow to white | TTGCGTTAGATGTTGCAGCT | AGG | Brassica napus L. | not found | flower,petals | CRISPR-Cas9 |
| PCdb_1498 | 30644027 | DcMYB113 | MYB transcription factor 113 | TTGCCGGAAGACTTCCCGGA | AGG | Daucus carota subsp. sativus (Hoffm.) Sch眉bl. & G.Martens | not found | protoplast | CRISPR-Cas9 |
| PCdb_1499 | 37346168 | Solyc05g007160 | Tomato protein Solyc05g007160 (uncharacterized) | TTGCCAAGGTGGTATCAGGC | AGG | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1500 | 37346168 | Solyc10g081320 | Tomato protein Solyc10g081320 (unknown function) | TTGCAAGGCTATTCCCAGGG | AGG | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1501 | 38925598 | LOC_Os03g55130 | taste quality | TTGATGGCAGGGGCTTCCAG | AGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_1502 | 36959937 | OsEPSPS | 5-Enolpyruvylshikimate-3-phosphate synthase | TTGATGGAGTGCCACGAATGAGG | AGG | Oryza sativa L. | 0.428571429 | dried seeds | not found |
| PCdb_1503 | 38310724 | EPSPS | Confer herbicide resistance | TTGATGGAGTACCAAGAATG | AGG | Zea mays L. | not found | seed | CRISPR/Cas9 |
| PCdb_1504 | 31694550 | PDS | Phytoene desaturase | TTCCGAATGGATGGAAAAGC | AGG | Triticum aestivum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1505 | 31452351 | Glyma.12G234500 Glyma.13G264400 | Phenylalanine ammonia-lyase (Glyma.12G234500 & Glyma.13G264400) [Source: SoyBase] | TTCCATTTGTAAAGTTGCCA | AGG | Glycine max (L.) Merr. | 0.592 | hairy root | CRISPR-Cas9 |
| PCdb_1506 | 37346168 | Solyc04g079360 | Tomato protein Solyc04g079360 (uncharacterized) | TTCATCCTCCGCCGGAGAAA | AGG | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1507 | 27510362 | ZmAgo18b | Argonaute protein 18b (ZmAgo18b, RNA silencing pathway) | TTCAGCTCTTGAAGGCCCTC | AGG | Zea mays L. | not found | chloroplast | CRISPR-Cas9 |
| PCdb_1508 | 30988404 | ALS | Acetolactate synthase | TTCAGCTACTAAGACAGCGC | AGG | Triticum aestivum L. | not found | leaf | CBE |
| PCdb_1509 | 33557889 | Gh_A12G2520 | Gh_A12G2520 (Gossypium hirsutum glutathione S-transferase A12G2520) [Source: CottonGen] | TTCAGAGTCCGAATCGGACG | AGG | Gossypium hirsutum L. | 0.5889 | seed | CRISPR-Cas9 |
| PCdb_1510 | 38925598 | LOC_Os12g34300 | taste quality | TTCACCTTCACGGCACCGGG | AGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_1511 | 27579989 | NbPAD4 | Phytoalexin deficient 4 lipase homolog | TTCACCAAGTTCTAGCCTCG | AGG | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1512 | 30291759 | AP2 | APETALA2 transcription factor | TTATACCATCGGACTTTGCT | AGG | Gossypium hirsutum L. | 0.701 | leaf | CRISPR-Cas9 |
| PCdb_1513 | 30291759 | AP2 | APETALA2 transcription factor | TTATACCATCGGACTTTGCT | AGG | Gossypium hirsutum L. | 0.701 | leaf | CRISPR-Cas9 |
| PCdb_1514 | 35457106 | BnaSVP | MADS-box transcription factor SVP | TTAGGACCTCTCAACTCAA | AGG | Brassica napus L. | not found | seed | CRISPR-Cas9 |
| PCdb_1515 | 31694550 | PDS | Phytoene desaturase | TTACTTTATTCCTTAAGCCA | AGG | Triticum aestivum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1516 | 33557889 | Gh_A04G1202 | Gh_A04G1202 (Gossypium hirsutum xyloglucan endotransglucosylase/hydrolase, XTH) [Source: CottonGen] | TTACGGCTATCATTCCTAGA | AGG | Gossypium hirsutum L. | 0.5889 | seed | CRISPR-Cas9 |
| PCdb_1517 | 31452351 | Glyma.13G196300 Glyma.15G234500 | Catalase (Glyma.13G196300 & Glyma.15G234500) [Source: SoyBase] | TTACCTGGGTCTGAGATGGG | AGG | Glycine max (L.) Merr. | 0.592 | hairy root | CRISPR-Cas9 |
| PCdb_1518 | 29867128 | AtACT2 | Actin 2, cytoskeletal structural protein commonly used as reference gene | TTACCTGCTGGAATGTGCTG | AGG | Arabidopsis thaliana (L.) Heynh. | not found | seed | CBE |
| PCdb_1519 | 31694550 | PDS | Phytoene desaturase | TTAATCGTGTTCTCTAGTGG | AGG | Triticum aestivum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1520 | 28256588 | not found | not found | TTAAGACCAGATATCAAAAG | AGG | Gossypium hirsutum L. | 0.988 | protoplast | CRISPR-Cas9 |
| PCdb_1521 | 33557889 | Gh_A05G0413 | Gh_A05G0413 (Gossypium hirsutum potassium transporter HAK5) [Source: CottonGen] | TTAACGTCTTGGCCATCCGC | AGG | Gossypium hirsutum L. | 0.5889 | seed | CRISPR-Cas9 |
| PCdb_1522 | 37497643 | PSY1 | Carotenoid biosynthesis phytoene synthase | TGTTGTTTTGAGTGTCGTCT | AGG | Solanum lycopersicum L. | 0.5 | not found | CRISPR-Cas9 |
| PCdb_1523 | 31034471 | NBP35 | P-loop NTP-binding protein NBP35 | tgttgtcaaatgcagATTA | agg | Arabidopsis thaliana (L.) Heynh. | not found | Cytosol | CRISPR-Cas9 |
| PCdb_1524 | 31452351 | Glyma.02G279600 | UDP-glucosyltransferase (Glyma.02G279600) [Source: SoyBase] | TGTGGTTGATCCACTTCCTG | AGG | Glycine max (L.) Merr. | 0.592 | hairy root | CRISPR-Cas9 |
| PCdb_1525 | 38925598 | LOC_Os09g27990 | taste quality | TGTGGTAACAAGACACCGAG | AGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_1526 | 38925598 | LOC_Os10g04890 | taste quality | TGTGGACGACGTTGTCGGTC | AGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_1527 | 33557889 | Gh_A03G1685 | Gh_A03G1685 (Gossypium hirsutum laccase-17, lignin biosynthesis) [Source: CottonGen] | TGTCGAGGTCCGAATCCCGG | AGG | Gossypium hirsutum L. | 0.5889 | seed | CRISPR-Cas9 |
| PCdb_1528 | 27579989 | AtEDS1 (Col) left | Enhanced disease susceptibility 1 protein (Col-0 ecotype), left genomic position | TGTCATCAGAATAGAGCCTG | AGG | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1529 | 26269544 | LIG | LIGULELESS (ligule and auricle development in maize) [Source: MaizeGDB] | TGTACCGTACGTGCCCCGGCGG | agg | Zea mays L. | not found | embryo | CRISPR-Cas9 |
| PCdb_1530 | 36005383 | TaHRC | Wheat HRC gene (TaHRC, disease resistance) | TGGTCGAGGAGAAGAAAAGA | AGG | Zea mays L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1531 | 31694550 | PDS | Phytoene desaturase | TGGTCAGCAGCGATTTCATC | AGG | Triticum aestivum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1532 | 34397079 | GmPPR576 | a fertility restorer gene of cytoplasmic male sterility | TGGGTGGGGTACGACGCACA | AGG | Glycine max (L.) Merr. | not found | Cytoplasm | CRISPR-Cas9 |
| PCdb_1533 | 36077304 | OsRAD51 | Plays a Vital Role in Promoting Homologous Recombination in Rice Meiosis | TGGCTCATGCTTCCACAACA | AGG | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1534 | 32640102 | IAA7 | Auxin-responsive Aux/IAA7 protein | TGGCCACCTGTGAGGAACTAC | AGG | Brassica napus L. | >20% | seed | A3A-PBE |
| PCdb_1535 | 31694550 | PDS | Phytoene desaturase | TGGCAAACAACCTGCAAAGA | AGG | Triticum aestivum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1536 | 31694550 | PDS | Phytoene desaturase | TGGATGGTAATCCTCCTGAA | AGG | Triticum aestivum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1537 | 30289378 | TYLCVCP | Tomato yellow leaf curl virus coat protein | TGGATGAGCACATGCAAGTG | AGG | Solanum lycopersicum L. | not found | cotyledon | CRISPR-Cas9 |
| PCdb_1538 | 29331085 | REF6 | RELATIVE OF EARLY FLOWERING 6 (REF6, histone demethylase) | TGGATCTCAAAACAGAGCAG | AGG | Arabidopsis thaliana (L.) Heynh. | not found | seed | CRISPR-Cas9 |
| PCdb_1539 | 38077491 | OPR3 | 12-Oxophytodienoate reductase 3 | TGGAAGGCAAGGCAGTGATG | AGG | Brassica napus L. | not found | not found | CRISPR-Cas9 |
| PCdb_1540 | 38925598 | LOC_Os09g28130 | taste quality | TGCTGGTAAAGAGAAGGCCG | AGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_1541 | 33931634 | VvbZIP36 | Vitis vinifera bZIP transcription factor 36 (VvbZIP36, stress signaling) | TGCTGACGCTTCCAGCGATA | AGG | Vitis vinifera L. | not found | calli | CRISPR-Cas9 |
| PCdb_1542 | 31694550 | PDS | Phytoene desaturase | TGCTCTAAACAGATTTCTCC | AGG | Triticum aestivum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1543 | 38925598 | LOC_Os02g19420 | taste quality | TGCTCCTTCCGAGCTACGCA | AGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_1544 | 33226310 | NIT3 | Nitrilase 3 | TGCTATTTGCTGGGAGAAT | AGG | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1545 | 33339449 | miR399i | MicroRNA regulating phosphate homeostasis | TGCTAGCCTTTCCCTGCCAA | AGG | Oryza sativa L. | 0.857 | protoplast | not found |
| PCdb_1546 | 30463360 | SLSBPASE | Sedoheptulose-1,7-bisphosphatase (photosynthesis Calvin cycle) | TGCGCCTAAATCATCACTAA | AGG | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1547 | 30455712 | FRI | FRI (FRIGIDA, scaffold protein for vernalization complex) [Source: UniProt] | TGCGAGTTGATGTGCAGCAA | AGG | Brassica oleracea var. capitata L. | 0.09-2.25% | protoplast | CRISPR-Cas9 |
| PCdb_1548 | 33557889 | Gh_A03G0760 | Gh_A03G0760 (Gossypium hirsutum 9-cis-epoxycarotenoid dioxygenase, ABA biosynthesis) [Source: CottonGen] | TGCCTTCTATCCCTAAAGGA | AGG | Gossypium hirsutum L. | 0.5889 | seed | CRISPR-Cas9 |
| PCdb_1549 | 36993856 | FLOURY ENDOSPERM 2 | FLOURY ENDOSPERM 2 (starch biosynthesis regulator) | TGCCGTCAACTTCGGAACAA | AGG | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1550 | 38925598 | LOC_Os01g56850 | taste quality | TGCACGACACCAAGGTCGCC | AGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_1551 | 32661060 | not found | not found | TGCACAAATTGCCGTTCTAA | AGG | Oryza sativa L. | not found | protoplast | not found |
| PCdb_1552 | 34073486 | NbPDS | Phytoene desaturase (carotenoid biosynthesis) [Source: SolGenomics] | TGCAAATTGAGTTGGGAGTG | AGG | Nicotiana tabacum L. | 0.2289 | leaf | ABE |
| PCdb_1553 | 27579989 | DM2h promoter to exon 2 | DM2 gene (h variant) promoter through exon 2 sequence | TGATTTCTGCTAATTCATCA | AGG | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1554 | 38925598 | LOC_Os08g27870 | taste quality | TGATTGAAGCGATCGAGAAA | AGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_1555 | 28873302 | slmapk3 | Mitogen-activated protein kinase 3 | TGATTCCTCCGCCCTTACGA | AGG | Solanum lycopersicum L. | 0.4182 | cotyledon | CRISPR-Cas9 |
| PCdb_1556 | 30272679 | APOBEC1 | Apolipoprotein B mRNA editing enzyme (cytidine deaminase), RNA-editing protein | TGATGCATAGGATGAGTAGC | AGG | Solanum tuberosum L. | 0.1 | protoplast | PBE |
| PCdb_1557 | 29051769 | OsGIF1 | Positively Regulates the Sizes of Stems, Leaves, and Grains in Rice | TGATGATGCAGTCCGGGGCG | AGG | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1558 | 38925598 | LOC_Os06g51084 | taste quality | TGATCTGGACCCTAAGTTGG | AGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_1559 | 30272679 | APOBEC1 | Apolipoprotein B mRNA editing enzyme (cytidine deaminase), RNA-editing protein | TGATCCGCTACTTTATCTGC | AGG | Solanum tuberosum L. | 0.03 | protoplast | PBE |
| PCdb_1560 | 37248636 | OsRLCK88 | Receptor-like cytoplasmic kinase | TGAGTGCCGAATCAATACGG | AGG | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1561 | 38925598 | LOC_Os01g04190 | taste quality | TGAGGATATTCCATTGGAGA | AGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_1562 | 35457106 | BnaSVP | MADS-box transcription factor SVP | TGAGAGGAGAGGAACTTCA | AGG | Brassica napus L. | not found | seed | CRISPR-Cas9 |
| PCdb_1563 | 36833415 | XSP10 & SlSAMT | Xylem sap protein 10 & SAM synthase (XSP10 & SlSAMT, stress response) | TGAGAATGCATCCGTATCAAGG | AGG | Solanum lycopersicum L. | 0.1153 | seed | CRISPR-Cas9 |
| PCdb_1564 | 36833415 | XSP10 & SlSAMT | Xylem sap protein 10 & SAM synthase (XSP10 & SlSAMT, stress response) | TGAGAATGCATCCGTATCAAGG | AGG | Solanum lycopersicum L. | 0.038 | seed | CRISPR-Cas9 |
| PCdb_1565 | 31694550 | PDS | Phytoene desaturase | TGACTATGCATGCATTTAAC | AGG | Triticum aestivum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1566 | 31694550 | PDS | Phytoene desaturase | TGAACAGTTAGCTGCATGGA | AGG | Triticum aestivum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1567 | 26408904 | RIN | Ripening inhibitor (RIN) transcription factor | TGAACAGCCTTCTCATCATG | AGG | Solanum lycopersicum L. | 0-100% | fruit | CRISPR-Cas9 |
| PCdb_1568 | 31694550 | PDS | Phytoene desaturase | TGAAAAAACTGTAAATGTGT | AGG | Triticum aestivum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1569 | 33396568 | CRTISO | Induced Somatic Recombination | TCTTTGCCAGTATCTGCGCA | agg | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1570 | 26408904 | RIN | Ripening inhibitor (RIN) transcription factor | TCTTCATACAATATGGGTAG | AGG | Solanum lycopersicum L. | 0-100% | fruit | CRISPR-Cas9 |
| PCdb_1571 | 31694550 | PDS | Phytoene desaturase | TCTGTTGATTTGAATATTTC | AGG | Triticum aestivum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1572 | 38925598 | LOC_Os04g31170 | taste quality | TCTGCATCAATCCCTACGAA | AGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_1573 | 33924895 | SOC1 | MADS-box transcription factor SOC1 | TCTGATCATCTICTCTCCTA | AGG | Brassica napus L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1574 | 30917862 | Glyma.10g246300 | Isoflavone reductase (Glyma.10g246300) [Source: SoyBase] | TCTCGCTATTGCAACTTCGG | AGG | Glycine max (L.) Merr. | not found | hairy root | CRISPR-Cas9 |
| PCdb_1575 | 28670755 | OsHAK1 | High-affinity potassium transporter (OsHAK1) | TCTCCCGGTACGCCAAGATC | AGG | Oryza sativa L. | 0.83 | root | CRISPR-Cas9 |
| PCdb_1576 | 31452351 | Glyma.08G125600 | Cytochrome P450 (Glyma.08G125600) [Source: SoyBase] | TCTCCCAAAAGAGTTGGGGG | AGG | Glycine max (L.) Merr. | 0.592 | hairy root | CRISPR-Cas9 |
| PCdb_1577 | 40029441 | PlCYP81Q38 | Cytochrome P450 monooxygenase involved in specialized secondary metabolism (e.g., phenylpropanoid or alkaloid biosynthesis) in plants. | TCTCAGGATTGTCAGATTGG | AGG | Phryma leptostachya subsp. asiatica (Hara) Kitamura | not found | protoplast | CRISPR/Cas9 |
| PCdb_1578 | 30159598 | OsGW2 | E3 ubiquitin ligase negatively regulating grain width | TCGTGGTGTAAAGACAAAGG | AGG | Oryza sativa L. | not found | protoplast | not found |
| PCdb_1579 | 33669319 | EAS2 | Elicitor-activated sesquiterpene synthase 2, produces phytoalexins in plant defense | TCGCGCTAGGTAATGTGGCA | AGG | Lolium arundinaceum (Schreb.) Darbysh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1580 | 34454034 | PDS | Phytoene desaturase | TCGCCTTGGAGATGGCCTAA | AGG | Triticum aestivum L. | not found | protoplast | CRISPRa,CRISPR-Cas9,CRISPRi |
| PCdb_1581 | 29250878 | BnCLV1 | CLAVATA1 receptor-like kinase | TCGCCATGTCGAGGACCTCT | AGG | Brassica napus L. | not found | seed | CRISPR-Cas9 |
| PCdb_1582 | 32841372 | BnCLV1 | regulates seed production | TCGCCATGTCGAGGACCTCT | AGG | Brassica napus L. | not found | seed | CRISPR-Cas9 |
| PCdb_1583 | 31694550 | PDS | Phytoene desaturase | TCGATCGGTGATCGTTGCAG | AGG | Triticum aestivum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1584 | 38925598 | LOC_Os08g28940 | taste quality | TCGAGGAAGGTGTCGATTGG | AGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_1585 | 38925598 | LOC_Os05g47820 | taste quality | TCGAAGCTTCCGAACAACCC | AGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_1586 | 31694550 | PDS | Phytoene desaturase | TCCTGATCGAGTCAACGACG | AGG | Triticum aestivum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1587 | 30819931 | Wxb | Waxy gene allele producing low amylose content in endosperm | TCCTCGGTACGACCAGTACA | AGG | Oryza sativa L. | 0.591 | calli | CBE |
| PCdb_1588 | 30819931 | Wxb | Waxy gene allele producing low amylose content in endosperm | TCCTCGGTACGACCAGTACA | AGG | Oryza sativa L. | 0.467 | calli | CBE |
| PCdb_1589 | 32190101 | NaEAH1 | Ethanolamine ammonia-lyase 1 (lipid metabolism) [Source: UniProt] | TCCGTTCAGATTCTTCTTC | AGG | Nicotiana rustica L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1590 | 31694550 | PDS | Phytoene desaturase | TCCATGCAGCTAACTGTTCA | AGG | Triticum aestivum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1591 | 36070109 | TaGW7 | Grain width regulator GW7 | TCCATCAACCGGGACTCGGG | AGG | Triticum aestivum L. | 0.77 | leaf | not found |
| PCdb_1592 | 31452351 | Glyma.14G160100 Glyma.13G041300 | Peroxidase (Glyma.14G160100 & Glyma.13G041300) [Source: SoyBase] | TCCACTGCAAATACTGGAAG | AGG | Glycine max (L.) Merr. | 0.592 | hairy root | CRISPR-Cas9 |
| PCdb_1593 | 31694550 | PDS | Phytoene desaturase | TCATGGACTTCGTGCTCTGC | AGG | Triticum aestivum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1594 | 37608233 | TM6 | MADS-box protein TM6 | TCATCATGCTATCAAGCACC | AGG | Solanum lycopersicum L. | not found | not found | CRISPR-Cas9 |
| PCdb_1595 | 31757427 | SlUVR8 | seedling development and UV-B stress tolerance | TCATACAACTGCTTACTCGG | AGG | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1596 | 31198943 | miR396-encoding gene | leaf growth and developmental phase transition | TCAGTCCCACGCTACTAAGC | AGG | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1597 | 33015536 | AGO4 & NRPD1a & NRPE1 & RDR2 & RDR4 & RDR6 & CHLI1 & PIE1 | Multi-gene complex: RNA-directed DNA methylation machinery (small RNA biogenesis and chromatin modification) | TCAGACATTTCAAGCACAGA | AGG | Arabidopsis thaliana (L.) Heynh. | 0.05 | seed | CRISPR-Cas9 |
| PCdb_1598 | 33557889 | Gh_A03G1115 | Gh_A03G1115 (Gossypium hirsutum auxin efflux carrier PIN1) [Source: CottonGen] | TCACTTCTATCCCACACAAT | AGG | Gossypium hirsutum L. | 0.5889 | seed | CRISPR-Cas9 |
| PCdb_1599 | 33339449 | miR399d | MicroRNA regulating phosphate homeostasis | TCACCAAAACGGCCTGCCAA | AGG | Oryza sativa L. | 0.13 | protoplast | not found |
| PCdb_1600 | 37346168 | Solyc09g090790 | Tomato protein Solyc09g090790 (uncharacterized) | TCAAGTTGCATGGTGAAGGC | AGG | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1601 | 33557889 | Gh_A02G0932 | Gh_A02G0932 (Gossypium hirsutum dehydrin DHN1, abiotic stress response) [Source: CottonGen] | TCAAGGACTGGATCTTTCGG | AGG | Gossypium hirsutum L. | 0.5889 | seed | CRISPR-Cas9 |
| PCdb_1602 | 35216118 | not found | not found | TCAAGCACCTTGGCATCTTA | AGG | Arabidopsis thaliana (L.) Heynh. | not found | leaf | CRISPR-Cas9 |
| PCdb_1603 | 35216118 | BspTI | Restriction endonuclease from Bacillus species (recognizes and cuts specific DNA sequences) | TCAAGCACCTTGGCATCTTA | AGG | Arabidopsis thaliana (L.) Heynh. | 0.01 | leaf | CRISPR-Cas9 |
| PCdb_1604 | 31452351 | Glyma.14G001600 Glyma.02G311000 | Glutathione S-transferase (Glyma.14G001600 & Glyma.02G311000) [Source: SoyBase] | TCAACAACCCTTGAGAGTGA | AGG | Glycine max (L.) Merr. | 0.592 | hairy root | CRISPR-Cas9 |
| PCdb_1605 | 29884615 | PYRABACTIN RESISTANCE1-LIKE (PYL) | PYRABACTIN RESISTANCE1-LIKE ABA receptor (PYL, abscisic acid signaling) | TATTGCAGAGAGCCTAAAGA | AGG | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1606 | 28790350 | BnaA6.DA1 | Ubiquitin receptor DA1 homolog | TATGTGCAGCCACGCAATAC | AGG | Brassica napus L. | 0.641 | protoplast | CRISPR-Cas9 |
| PCdb_1607 | 27579989 | NbEDS1a + NbEDS1b (exon 2) | Enhanced disease susceptibility 1a/1b exon 2 fragment (plant immunity) [Source: SolGenomics] | TATGCTGCATGTAATCTGAA | AGG | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1608 | 37346168 | Solyc03g119050 | Tomato protein Solyc03g119050 (uncharacterized) | TATCTTTCCACCTGGCTCAG | AGG | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1609 | 26842991 | FGS | FGS (Arabidopsis thaliana FATTY ACID ELONGASE78, very-long-chain fatty acid biosynthesis) [Source: TAIR] | TATCTCATCCATACCTGTTA | AGG | Zea mays L. | 0.0768 | protoplast | CRISPR-Cas9 |
| PCdb_1610 | 26842991 | FGS | FGS (Arabidopsis thaliana FATTY ACID ELONGASE78, very-long-chain fatty acid biosynthesis) [Source: TAIR] | TATCTCATCCATACCTGTTA | AGG | Zea mays L. | 0.0768 | protoplast | CRISPR-Cas9 |
| PCdb_1611 | 38925598 | LOC_Os02g54960 | taste quality | TATATTATTCTCACTATCGG | AGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_1612 | 31694550 | PDS | Phytoene desaturase | TATATCAATCTTTCTGTTTC | AGG | Triticum aestivum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1613 | 27579989 | GUS Reporter | GUS Reporter (-glucuronidase reporter gene) [Source: Addgene] | TATATAAACCCCCTCCAACC | AGG | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1614 | 33557889 | Gh_A06G0936 | Gh_A06G0936 (Gossypium hirsutum phytoene synthase, carotenoid biosynthesis) [Source: CottonGen] | TATACTCCATCTCCGCCCAG | AGG | Gossypium hirsutum L. | 0.5889 | seed | CRISPR-Cas9 |
| PCdb_1615 | 31452351 | Glyma.06G125800 Glyma.04G238100 | Catalase (Glyma.06G125800 & Glyma.04G238100) [Source: SoyBase] | TATAAGGAAGAAAAGCACAG | AGG | Glycine max (L.) Merr. | 0.592 | hairy root | CRISPR-Cas9 |
| PCdb_1616 | 31694550 | PDS | Phytoene desaturase | TAGTGATCGCTTGCAATGGA | AGG | Triticum aestivum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1617 | 28790350 | BnaDA2 | E3 ubiquitin ligase DA2 homolog | TAGTAACTGTCGCAGTTGCC | AGG | Brassica napus L. | BnaA2.DA2:41.2%, BnaC6.DA2: 35.3% | protoplast | CRISPR-Cas9 |
| PCdb_1618 | 38925598 | LOC_Os12g13960 | taste quality | TAGCTTGTTGCGCAACAAGG | AGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_1619 | 35082818 | LeRBOH & LeRBOHE | Respiratory burst oxidase homolog D/E (reactive oxygen species production) [Source: SolGenomics] | TAGCTAGCAAGCTCGAAAAG | AGG | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1620 | 28066464 | DIPM | Disease-Interacting Protein Module (likely involved in plant-pathogen interactions) | TAGCATTGGGACTACGTACA | AGG | Vitis vinifera L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1621 | 36892416 | FT and TFL2CENBFT family | FT (Flowering Locus T, phosphatidylethanolamine-binding protein family) [Source: UniProt] | TAGAGTTGAGATTCGTGGTG | AGG | Populus 脳 canescens 'INRA 717-1B11' | not found | seed | CRISPR-Cas9 |
| PCdb_1622 | 36338470 | BGLU25 | Beta-glucosidase 25 | TACTCCCGAGTTGCCIACG | AGG | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1623 | 31452351 | GmRIC1 | ROP-interactive CRIB motif-containing protein 1 | TACGCATAGGCTCGCACCAG | AGG | Glycine max (L.) Merr. | 0.592 | hairy root | CRISPR-Cas9 |
| PCdb_1624 | 31452351 | Glyma.13G292300 | 尾-glucosidase (Glyma.13G292300) [Source: SoyBase] | TACGCATAGGCTCGCACCAG | AGG | Glycine max (L.) Merr. | 0.592 | hairy root | CRISPR-Cas9 |
| PCdb_1625 | 33557889 | Gh_A04G0456 | Gh_A04G0456 (Gossypium hirsutum gibberellin 2-oxidase, GA inactivation) [Source: CottonGen] | TACCCAGTATAATAATCCCG | AGG | Gossypium hirsutum L. | 0.5889 | seed | CRISPR-Cas9 |
| PCdb_1626 | 38925598 | LOC_Os08g06110 | taste quality | TACCACCGCTTCCTCACCAG | AGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_1627 | 37346168 | Solyc08g081500 | Tomato protein Solyc08g081500 (uncharacterized) | TACATGGAGCTGTAGGCAAC | AGG | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1628 | 38925598 | LOC_Os07g45070 | taste quality | TACATATCCAGACTGACTGG | AGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_1629 | 31694550 | PDS | Phytoene desaturase | TACAGTTATTTAATCAGCAC | AGG | Triticum aestivum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1630 | 35906898 | not found | not found | TACAACCCTCGTGCTGGA | AGG | Oryza sativa L. | not found | seed | CRISPR-Cas9 |
| PCdb_1631 | 31694550 | PDS | Phytoene desaturase | TAATTGCTTGCCTTCTTTGC | AGG | Triticum aestivum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1632 | 26482477 | not found | not found | TAATTAATGAAAAAAAAATG | AGG | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1633 | 39513889 | mPDS and ClPDS | Paired phytoene desaturases from melon (mPDS) and citrus (ClPDS) catalyzing phytoene 鈫?味-carotene in carotenoid biosynthesis; essential for chlorophyll and carotenoid formation and photoprotection. | TAATGGAGAACAGCATCTCG | AGG | Citrullus lanatus (Thunb.) Matsum. & Nakai | not found | protoplast | CRISPR/Cas9 |
| PCdb_1634 | 26842991 | FGS | FGS (Arabidopsis thaliana FATTY ACID ELONGASE80, very-long-chain fatty acid biosynthesis) [Source: TAIR] | TAAGCGACGCATAGACGGTA | AGG | Zea mays L. | 0.1064 | protoplast | CRISPR-Cas9 |
| PCdb_1635 | 27097775 | SlPDS | Phytoene desaturase | TAACGATCGATTGCAATGGAAGG | AGG | Solanum lycopersicum L. | 0.727 | seed | CRISPR-Cas9 |
| PCdb_1636 | 27097775 | SlPDS | Phytoene desaturase | TAACGATCGATTGCAATGGAAGG | AGG | Solanum lycopersicum L. | 0.727 | seed | CRISPR-Cas9 |
| PCdb_1637 | 32821229 | PDS | PDS (Phytoene desaturase) | TAACGATCGATTGCAATGGA | AGG | Solanum lycopersicum L. | 0.1 | cotyledon and leaf | CRISPR-Cas9 |
| PCdb_1638 | 31694550 | PDS | Phytoene desaturase | GTTTGTGGCCAGCGTCTGCC | AGG | Triticum aestivum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1639 | 29331085 | REF6 | RELATIVE OF EARLY FLOWERING 6 (REF6, histone demethylase) | GTTTCTTATGATATAAACAG | AGG | Arabidopsis thaliana (L.) Heynh. | not found | seed | CRISPR-Cas9 |
| PCdb_1640 | 31694550 | PDS | Phytoene desaturase | GTTTCTGGTGTGAATTTTGC | AGG | Triticum aestivum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1641 | 32457787 | GmSNAPO2 | Function of Coproporphyrinogen III Oxidase Homolog in Soybean | GTTTCTCAGAGGAGTGGACG | AGG | Glycine max (L.) Merr. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1642 | 31694550 | PDS | Phytoene desaturase | GTTGTGAAGACACCGAGGTC | AGG | Triticum aestivum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1643 | 31694550 | PDS | Phytoene desaturase | GTTGGTTTTTGCTCCAGCAG | AGG | Triticum aestivum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1644 | 30928637 | OsPDS | Oryza sativa phytoene desaturase (OsPDS, carotenoid biosynthesis) | GTTGGTCTTTGCTCCTGCAG | AGG | Oryza sativa L. | not found | protoplast | xCas9 |
| PCdb_1645 | 30928637 | OsPDS | Oryza sativa phytoene desaturase (OsPDS, carotenoid biosynthesis) | GTTGGTCTTTGCTCCTGCAG | AGG | Oryza sativa L. | not found | protoplast | xCas9 |
| PCdb_1646 | 25232936 | PDS | Phytoene desaturase, carotenoid biosynthesis enzyme and herbicide target | GTTGGTCTTTGCTCCTGCAG | AGG | Oryza sativa L. | not found | protoplast | not found |
| PCdb_1647 | 28416245 | not found | not found | GTTGGTCTTTGCTCCTGCAG | AGG | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1648 | 37679413 | OsPDS | abnormal carotenoid accumulation | GTTGGTCTTTGCTCCTGCAG | AGG | Oryza sativa L. | not found | not found | CRISPR-Cas9 |
| PCdb_1649 | 27212389 | OsPDS | Phytoene desaturase (carotenoid biosynthesis) (OsPDS) | GTTGGTCTTTGCTCCTGCAG | AGG | Oryza sativa L. | 0.38 | callus | CRISPR-Cas9 |
| PCdb_1650 | 23929338 | OsPDS | Oryza sativa phytoene desaturase (OsPDS, carotenoid biosynthesis) | GTTGGTCTTTGCTCCTGCAG | AGG | Oryza sativa L. | 14.5-20.0% | protoplast | cas9 |
| PCdb_1651 | 29230929 | PDS | Phytoene desaturase, key enzyme in carotenoid biosynthesis pathway | GTTGGTCTTGCTCCTGCAG | AGG | Oryza sativa L. | 0.073 | protoplast | CRISPR-Cas9 |
| PCdb_1652 | 29230929 | PDS | Phytoene desaturase, key enzyme in carotenoid biosynthesis pathway | GTTGGTCTTGCTCCTGCAG | AGG | Oryza sativa L. | 0.073 | protoplast | CRISPR-Cas9 |
| PCdb_1653 | 29230929 | GA4a | GA4a (Gibberellin 4-alpha dioxygenase, EC 1.14.11.15, GA biosynthesis) [Source: UniProt] | GTTGGTCTTGCTCCTGCAG | AGG | Brassica oleracea L. | 0.752 | protoplast | CRISPR-Cas9 |
| PCdb_1654 | 29230929 | GA4a | Gibberellin 3-dioxygenase GA4a | GTTGGTCTTGCTCCTGCAG | AGG | Brassica napus L. | 0.568 | protoplast | CRISPR-Cas9 |
| PCdb_1655 | 29230929 | PDS | Phytoene desaturase (PDS, carotenoid biosynthesis) | GTTGGTCTTGCTCCTGCAG | AGG | Nicotiana tabacum L. | 0.15 | protoplast | CRISPR-Cas9 |
| PCdb_1656 | 29230929 | PDS | Phytoene desaturase (PDS, carotenoid biosynthesis) | GTTGGTCTTGCTCCTGCAG | AGG | Setaria viridis (L.) P. Beauv. | 0.102 | protoplast | CRISPR-Cas9 |
| PCdb_1657 | 29230929 | PDS | Phytoene desaturase (PDS, carotenoid biosynthesis) | GTTGGTCTTGCTCCTGCAG | AGG | Bambusa oldhamii Munro | 0.066 | protoplast | CRISPR-Cas9 |
| PCdb_1658 | 29230929 | PDS | Phytoene desaturase (PDS, carotenoid biosynthesis) | GTTGGTCTTGCTCCTGCAG | AGG | Arabidopsis thaliana (L.) Heynh. | 0.065 | protoplast | CRISPR-Cas9 |
| PCdb_1659 | 29230929 | PDS | Phytoene desaturase | GTTGGTCTTGCTCCTGCAG | AGG | Solanum lycopersicum L. | 0.037 | protoplast | CRISPR-Cas9 |
| PCdb_1660 | 29230929 | IPK | Inositol 1,3,4,5,6-pentakisphosphate 2-kinase (phytic acid biosynthesis) [Source: UniProt] | GTTGGTCTTGCTCCTGCAG | AGG | Zea mays L. | 0.002 | protoplast | CRISPR-Cas9 |
| PCdb_1661 | 32508867 | not found | not found | GTTGGTCTTGCTCCTGCAG | AGG | Oryza sativa L. | not found | calli | CRISPR-Cas9 |
| PCdb_1662 | 26842991 | FGS | FGS (Arabidopsis thaliana FATTY ACID ELONGASE7, very-long-chain fatty acid biosynthesis) [Source: TAIR] | GTTGACAAACTCTTCACGTC | AGG | Zea mays L. | 0.48 | protoplast | CRISPR-Cas9 |
| PCdb_1663 | 38925598 | LOC_Os07g32360 | taste quality | GTTCTGCTCAAAGCAGGAAG | AGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_1664 | 30598393 | CRU3 | Cruciferin A seed storage protein | GTTCCGTGACATGCACCAGAAGGTG | AGG | Arabidopsis thaliana (L.) Heynh. | not found | Germ Cells | CRISPR-Cas9,ZFN,TALEN |
| PCdb_1665 | 38925598 | LOC_Os10g35050 | taste quality | GTTCACGGTGGGGCGGAGCG | AGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_1666 | 34834905 | FAD2 | FAD2 (Fatty acid desaturase 2, EC 1.14.19.2, linoleic acid biosynthesis) [Source: UniProt] | GTGTTTGGAACCCTTGAGAG | AGG | Glycine max (L.) Merr. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1667 | 34834905 | FAD2 & FATB | Fatty acid desaturase & Acyl-ACP thioesterase | GTGTTTGGAACCCTTGAGAG | AGG | Glycine max (L.) Merr. | 0.592 | hairy root | CRISPR-Cas9 |
| PCdb_1668 | 27148303 | IR and Rep of CABs | Intergenic region and repetitive elements of chloroplast DNA [Source: NCBI] | GTGTGTACCCCTGGGAGGGT | AGG | Gossypium hirsutum L. | not found | germplasm | CRISPR-Cas9 |
| PCdb_1669 | 26842991 | FGS | FGS (Arabidopsis thaliana FATTY ACID ELONGASE36, very-long-chain fatty acid biosynthesis) [Source: TAIR] | GTGTGATATGCTGGATCAAA | AGG | Zea mays L. | 0.0572 | protoplast | CRISPR-Cas9 |
| PCdb_1670 | 31452351 | Glyma.09G153900 Glyma.16G204600 | Lipoxygenase (Glyma.09G153900 & Glyma.16G204600) [Source: SoyBase] | GTGTCATGGCTAGCCACAGG | AGG | Glycine max (L.) Merr. | 0.592 | hairy root | CRISPR-Cas9 |
| PCdb_1671 | 26842991 | FGS | FGS (Arabidopsis thaliana FATTY ACID ELONGASE68, very-long-chain fatty acid biosynthesis) [Source: TAIR] | GTGGTTCAATACATGAGATA | AGG | Zea mays L. | 0.0214 | protoplast | CRISPR-Cas9 |
| PCdb_1672 | 31547486 | IbGBSSI | Granule-bound starch synthase I (amylose biosynthesis) [Source: UniProt] | GTGGGGTTGGGTCAATTAGCCCTC | AGG | Ipomoea batatas (L.) Lam. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1673 | 33704523 | Rpp1L_TS1 | RPP1-like disease resistance protein | GTGGGATCTTCTGGAGGATG | AGG | Glycine max (L.) Merr. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1674 | 31198943 | miR396-encoding gene | leaf growth and developmental phase transition | GTGGGAAAACATGACAATTC | AGG | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1675 | 28360425 | SlIAA9 | Auxin-responsive Aux/IAA9 transcription factor | GTGGATTAAATCTCA | AGG | Solanum lycopersicum L. | 1 | cotyledon pieces | CRISPR-Cas9 |
| PCdb_1676 | 31991936 | FWL | FWL (FW2-2-like cell number regulator, plasma membrane-associated) [Source: UniProt] | GTGGACGAGGCAGTCGGGGC | AGG | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1677 | 33440058 | Os05circ02465 | Circular RNA (potential regulatory function) | gtggaaaagcagcatatgtgc | AGG | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1678 | 38925598 | LOC_Os12g27930 | taste quality | GTGCTCCTCATGGCTGTCCA | AGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_1679 | 34834905 | FAD2 | Omega-6 fatty acid desaturase | GTGCGGTGGCTTGCAGGTCA | AGG | Glycine max (L.) Merr. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1680 | 34834905 | FAD2 & FATB | Fatty acid desaturase & Acyl-ACP thioesterase | GTGCGGTGGCTTGCAGGTCA | AGG | Glycine max (L.) Merr. | 0.592 | hairy root | CRISPR-Cas9 |
| PCdb_1681 | 36998699 | OsHPP04 | Heavy metalssociated protein (HPP04) | GTGCGACAAGTGCAGGTCGA | AGG | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1682 | 29552023 | TcNPR3 | Theobroma cacao NPR3 (disease resistance) | GTGCAGTTAACATCTGCCAG | AGG | Theobroma cacao L. | 0.27 | leaf | CRISPR-Cas9 |
| PCdb_1683 | 26284791 | GmFEI2 | Leucine-rich repeat receptor-like kinase FEI2 (cell wall integrity) | GTGAGGTGCTTCTCAGCTTT | AGG | Glycine max (L.) Merr. | 0.6 | hairy root | CRISPR-Cas9 |
| PCdb_1684 | 39172289 | OsIPK1 | Regulates grain phosphorus (Pi) homeostasis and starch synthesis; aimed at low phytic acid content while preserving starch accumulation. | gtgacgagccagtgtagctg | AGG | Oryza sativa L. | 0.192 | callus | CRISPR/Cas9 |
| PCdb_1685 | 35371150 | SlNAC063 | Tomato NAC063 transcription factor (stress response) | GTGAAGTTAAGTTTGAAGG | AGG | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1686 | 29735370 | St16DOX | Potato 16-hydroxylase (St16DOX, steroidal glycoalkaloid biosynthesis) | GTCTGGTTTACCAATTACGGTAGG | AGG | Solanum tuberosum L. | not found | hairy root | CRISPR-Cas9 |
| PCdb_1687 | 37993454 | GmSNAPO2 | Soluble NSF attachment protein (vesicle trafficking) | GTCTGAACAGAATATCTCGC | agg | Glycine max (L.) Merr. | not found | not found | CRISPR-Cas9 |
| PCdb_1688 | 28360425 | SlIAA9 | Auxin-responsive Aux/IAA9 transcription factor | GTCTCCCGAAAGAGGTG | AGG | Solanum lycopersicum L. | 1 | cotyledon pieces | CRISPR-Cas9 |
| PCdb_1689 | 32117361 | Mai5 | Maintenance of Mai5 imprinted gene (seed development) [Source: MaizeGDB] | GTCTACGAATATATGCCATT | AGG | Lonchocarpus major M.Sousa | not found | kinetoplastids | CRISPR-Cas9,Base editor |
| PCdb_1690 | 38925598 | LOC_Os05g51400 | taste quality | GTCGTCGTCCAGGAAGACCA | AGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_1691 | 36596996 | GL1 | R2R3-MYB transcription factor GLABRA1 | GTCGTATCAGCTTCGTACG | AGG | Arabidopsis thaliana (L.) Heynh. | 80.9-100% | protoplast | CRISPR-Cas9 |
| PCdb_1692 | 35126421 | SlSPL-CNR | Tomato SPL-CNR transcription factor (fruit ripening regulator) | GTCGGCACATCCTTCTTGCC | AGG | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1693 | 29857174 | LAZY1 | LAZY1 (gravitropism and polar auxin transport regulator) [Source: TAIR] | GTCGCGCCCGGAGTACCTGC | AGG | Oryza sativa L. | 5-78% | calli | cas9 |
| PCdb_1694 | 33440058 | Os02circ25329 | Circular RNA (potential regulatory function) | gtcccgcgcttcaaggaggt | AGG | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1695 | 26039904 | not found | not found | GTCCCGCACCAGAGGALA | AGG | Oryza sativa L. | not found | protoplast | not found |
| PCdb_1696 | 29884615 | PYRABACTIN RESISTANCE1-LIKE (PYL) | PYRABACTIN RESISTANCE1-LIKE ABA receptor (PYL, abscisic acid signaling) | GTATGGCTGCACAAGAAGAA | AGG | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1697 | 33669319 | EAS2 | Elicitor-activated sesquiterpene synthase 2, produces phytoalexins in plant defense | GTATGGCGGGAGTTACTGCA | AGG | Lolium arundinaceum (Schreb.) Darbysh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1698 | 38925598 | LOC_Os03g15940 | taste quality | GTATGGCACTCCTTCAATCG | AGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_1699 | 31452351 | Glyma.15G211800 Glyma.15G210400 | Heat shock protein (Glyma.15G211800 & Glyma.15G210400) [Source: SoyBase] | GTATGCTGAGAAAGCAAGAA | AGG | Glycine max (L.) Merr. | 0.592 | hairy root | CRISPR-Cas9 |
| PCdb_1700 | 32117361 | ADE | Adenine deaminase | GTATGATCCACATTGACAGT | AGG | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1701 | 38925598 | LOC_Os12g44270 | taste quality | GTATCATGTGAGGCCGCTAG | AGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_1702 | 33638281 | TaASN2 | Wheat with greatly reduced accumulation of free asparagine in the grain | GTAGAGCGGCTGGTCGCCGG | AGG | Triticum aestivum L. | 0.64 | protoplast | CRISPR-Cas9 |
| PCdb_1703 | 38005766 | GmNHL1 | salt stress | GTAGACCGTGACGTCTTGG | AGG | Glycine max (L.) Merr. | not found | not found | CRISPR-Cas9 |
| PCdb_1704 | 31452351 | Glyma.14G117700 | Lipoxygenase (Glyma.14G117700) [Source: SoyBase] | GTACTACTAGTGCCAGCTTG | AGG | Glycine max (L.) Merr. | 0.592 | hairy root | CRISPR-Cas9 |
| PCdb_1705 | 31694550 | PDS | Phytoene desaturase | GTACGACCTCCCTTGGCTTA | AGG | Triticum aestivum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1706 | 26842991 | FGS | FGS (Arabidopsis thaliana FATTY ACID ELONGASE29, very-long-chain fatty acid biosynthesis) [Source: TAIR] | GTACCACATTGTGGAGCGCG | AGG | Zea mays L. | 0.0953 | protoplast | CRISPR-Cas9 |
| PCdb_1707 | 38925598 | LOC_Os01g59760 | taste quality | GTACAGCCTCACCCTCGACG | AGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_1708 | 27862889 | FAD2 | Fatty acid desaturase 2 | GTAAGAGAGAGGCTGAGGG | AGG | Arabidopsis thaliana (L.) Heynh. | 0.716 | seed | CRISPR-Cas9 |
| PCdb_1709 | 27862889 | FAD2 | Fatty acid desaturase 2 | GTAAGAGAGAGGCTGAGGG | AGG | Arabidopsis thaliana (L.) Heynh. | 0.716 | seed | CRISPR-Cas9 |
| PCdb_1710 | 31694550 | PDS | Phytoene desaturase | GGTTTTTATTGCAATGTCCA | AGG | Triticum aestivum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1711 | 33557889 | Gh_A13G1627 | Gh_A13G1627 (Gossypium hirsutum cytochrome P450 A13G1627) [Source: CottonGen] | GGTTGAGATCGATCGGACGG | AGG | Gossypium hirsutum L. | 0.5889 | seed | CRISPR-Cas9 |
| PCdb_1712 | 38925598 | LOC_Os01g25450 | taste quality | GGTTCCACATACACCATGTC | AGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_1713 | 33339449 | miR399k | MicroRNA regulating phosphate homeostasis | GGTTACCAGACTACTGCCAA | AGG | Oryza sativa L. | 1 | protoplast | not found |
| PCdb_1714 | 29604159 | eIF4G | Eukaryotic translation initiation factor 4G, scaffold protein for translation machinery | GGTTAATATGGGTGAGGACG | AGG | Oryza sativa L. | 0.36 | immature embryos | cas9 |
| PCdb_1715 | 26837606 | PDS | Phytoene desaturase (PDS, carotenoid biosynthesis) | GGTGTTCATTGCCATGTCAA | AGG | Petunia hybrida (Hook.) E. Vilm. | 0.556 | protoplast | CRISPR-Cas9 |
| PCdb_1716 | 28349304 | DEP1 | G纬 subunit DENSE AND ERECT PANICLE1 | GGTGGTGATGGAGGCGCCG | AGG | Oryza sativa L. | 0.83 | protoplast | CRISPR-Cas9 |
| PCdb_1717 | 30781568 | not found | not found | GGTGGTGATGGAGGCGCCG | AGG | Oryza sativa L. | not found | chloroplast | CRISPR-Cas9 |
| PCdb_1718 | 29573495 | GUS | GUS (尾-glucuronidase reporter enzyme) [Source: Addgene] | GGTGGGTCGACTAGGGATAAC | AGG | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9,SaCas9 |
| PCdb_1719 | 33557889 | Gh_A05G2345 | Gh_A05G2345 (Gossypium hirsutum WRKY transcription factor, defense response) [Source: CottonGen] | GGTGGGAGAAAAAAGTAGAT | AGG | Gossypium hirsutum L. | 0.5889 | seed | CRISPR-Cas9 |
| PCdb_1720 | 38925598 | LOC_Os10g03870 | taste quality | GGTGGAGGATTTCATCGGGG | AGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_1721 | 31547486 | IbGBSSI | starch biosynthetic pathway genes | GGTGGACTTGGAGATGTTCTTGG | AGG | Ipomoea batatas (L.) Lam. | 62-92% | protoplast | CRISPR-Cas9 |
| PCdb_1722 | 31547486 | IbGBSSI | starch biosynthetic pathway genes | GGTGGACTTGGAGATGTTCTTGG | AGG | Ipomoea batatas (L.) Lam. | 62-92% | protoplast | CRISPR-Cas9 |
| PCdb_1723 | 28287154 | GhCLA1 | GhCLA1 (Gossypium hirsutum 1-deoxy-D-xylulose 5-phosphate synthase, chloroplast development) [Source: CottonGen] | GGTGATGGTGCTATGACTGC | AGG | Gossypium hirsutum L. | 47.6-81.8% | protoplast | CRISPR-Cas9 |
| PCdb_1724 | 28287154 | GhVP | GhVP (Gossypium hirsutum vacuolar pyrophosphatase) [Source: CottonGen] | GGTGATGGTGCTATGACTGC | AGG | Gossypium hirsutum L. | 47.6-81.8% | protoplast | CRISPR-Cas9 |
| PCdb_1725 | 36466231 | GhMAPKKK2 & GhCLA1 & GhPDS | GhMAPKKK2, GhCLA1 & GhPDS (Gossypium hirsutum MAP kinase kinase kinase 2, cloroplastos alterados 1, and phytoene desaturase) [Source: CottonGen] | GGTGATGGTGCTATGAACTGC | AGG | Gossypium hirsutum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1726 | 38925598 | LOC_Os11g38850 | taste quality | GGTGATCGTGGCCGACGACG | AGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_1727 | 35481148 | BnVTE4 | Tocopherol methyltransferase (VTE4) | GGTGAGCATATGCCTGACA | AGG | Brassica napus L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1728 | 28412227 | ZmTMS5 | Thermosensitive male sterility protein 5 (pollen development) | GGTGAAGCAGAAGCTTAAGC | AGG | Zea mays L. | 0.048 | maize protoplasts | CRISPR-Cas9 |
| PCdb_1729 | 38925598 | LOC_Os09g25890 | taste quality | GGTCTCGTGCTCCTCGTGGG | AGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_1730 | 28066464 | DIPM | Disease-Interacting Protein Module (likely involved in plant-pathogen interactions) | GGTCGGATGGTGTTCTTCGA | AGG | Vitis vinifera L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1731 | 26269544 | ALS | Acetolactate synthase, target site of ALS-inhibitor herbicides and essential for branched-chain amino acid biosynthesis | GGTCGCCATCACGGGAC | AGG | Zea mays L. | not found | embryo | CRISPR-Cas9 |
| PCdb_1732 | 31684940 | EPSPS | 5-enolpyruvylshikimate-3-phosphate synthase | GGTCGAAAAGGACGCCAAAG | AGG | Triticum aestivum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1733 | 33751803 | Waxy | Granule-bound starch synthase (Waxy, starch biosynthesis) | GGTCAGGAACTGCATGAACC | AGG | Oryza sativa L. | 17.6-96.3% | calli | ABE |
| PCdb_1734 | 36349233 | TSF | FLOWERING LOCUS T homolog (TSF) | GGTCACTTATGGCCATAGAG | AGG | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1735 | 31585004 | SAUR41 subfamily | inducible to modulate cell expansion and salt tolerance | GGTCACGTTCCCGTCAACGT | AGG | Arabidopsis thaliana (L.) Heynh. | not found | seed | CRISPR-Cas9 |
| PCdb_1736 | 33383688 | not found | Gene not detected or not annotated in the database | GGTAGTCGCGGCACTTGCTC | AGG | Oryza sativa L. | not found | protoplast | not found |
| PCdb_1737 | 29735370 | St16DOX | Potato 16伪-hydroxylase (St16DOX, steroidal glycoalkaloid biosynthesis) | GGTAGGTACCTATATCTTGG | AGG | Solanum tuberosum L. | not found | hairy root | CRISPR-Cas9 |
| PCdb_1738 | 35167149 | ZmCOI2a & ZmCOI2b | regulate anther dehiscence and gametophytic male fertility | GGGTTGATGGCTATAGCCCA | AGG | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1739 | 30644027 | DcMYB113 | MYB transcription factor 113 | GGGTGCATGGGGTTCTGATG | AGG | Daucus carota subsp. sativus (Hoffm.) Sch眉bl. & G.Martens | not found | protoplast | CRISPR-Cas9 |
| PCdb_1740 | 35481279 | not found | not found | GGGTATGGTGGTGCAATGGG | AGG | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1741 | 32415890 | OSALS | not found | GGGTATGGTGGTGCAATGGG | AGG | Oryza sativa L. | not found | protoplast | not found |
| PCdb_1742 | 28883826 | OsALS | Acetolactate synthase (ALS) | GGGTATGGTGGTGCAATGGG | AGG | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1743 | 26768120 | not found | not found | GGGTATGGTGGTGCAATGGG | AGG | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1744 | 31974493 | ALS | Acetolactate synthase, target site of ALS-inhibitor herbicides and essential for branched-chain amino acid biosynthesis | GGGTATGGTGGTGCAATGGG | agg | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1745 | 33638281 | TaASN2 | Wheat with greatly reduced accumulation of free asparagine in the grain | GGGGTGCGGCGGCGACGAGTCGC | AGG | Triticum aestivum L. | 0.64 | protoplast | CRISPR-Cas9 |
| PCdb_1746 | 35447826 | not found | not found | GGGGTCGGCAAACTTACACG | AGG | Zea mays L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1747 | 28790350 | BnaFUL | FRUITFULL MADS-box transcription factor | GGGGTAGGGTTCAGCTGAAG | AGG | Brassica napus L. | BnaA9.FUL:85.7%, BnaC2.FUL:81.0%, BnaC7.FUL:85.7% | protoplast | CRISPR-Cas9 |
| PCdb_1748 | 31666960 | AP1 | APETALA1, floral meristem identity gene controlling flowering time | GGGGTAGGGTTCAATTGAAG | AGG | Arabidopsis thaliana (L.) Heynh. | 0.667 | seed | CRISPR/Cas9 |
| PCdb_1749 | 27576893 | IdnDH | L-Idonate 5-dehydrogenase (uronate metabolism) [Source: BRENDA] | GGGGAAAGGAGGCAACTCTG | AGG | Vitis vinifera L. | 1 | induced embryogenic callus, | CRISPR-Cas9 |
| PCdb_1750 | 26842991 | FGS | FGS (Arabidopsis thaliana FATTY ACID ELONGASE35, very-long-chain fatty acid biosynthesis) [Source: TAIR] | GGGCTTTATGCAGGAGCTGC | AGG | Zea mays L. | 0.045 | protoplast | CRISPR-Cas9 |
| PCdb_1751 | 36432766 | AtbZIP62 | Positively Regulate ABA Responses in Arabidopsis | GGGCTTCAAGATACACAAAG | AGG | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1752 | 26842991 | FGS | FGS (Arabidopsis thaliana FATTY ACID ELONGASE52, very-long-chain fatty acid biosynthesis) [Source: TAIR] | GGGCATTCGAGGACAGGTTA | AGG | Zea mays L. | 0.33 | protoplast | CRISPR-Cas9 |
| PCdb_1753 | 39596534 | OsGAPDHC7 | Cytosolic glyceraldehyde-3-phosphate dehydrogenase involved in glycolysis, regulating energy metabolism and stress responses during rice seed development. | GGGATCATAGAGATATGTGT | AGG | Oryza sativa L. | not found | callus | CRISPR/Cas9 |
| PCdb_1754 | 28487703 | ENGase | Endo?尾?N?acetylglucosaminidase (ENGase): key regulator of cell differentiation | GGGAGAGGGGAGCGGCGTGG | AGG | Hordeum vulgare L. | 0.133 | Immature embryos | CRISPR-Cas9 |
| PCdb_1755 | 38925598 | LOC_Os11g38900 | taste quality | GGGACGACCCAGGCGTGTAC | AGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_1756 | 26657719 | StALS1 | Potato acetolactate synthase 1 (StALS1, branched-chain amino acid biosynthesis) | GGGAATGGTGGTTCAATGGG | AGG | Solanum tuberosum L. | 3-60% | protoplast | not found |
| PCdb_1757 | 31923323 | SlSTR1 | Strictosidine synthase (STR1) | GGGAAAGAAGAAACAAGTG | AGG | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1758 | 31694550 | PDS | Phytoene desaturase | GGCTTAAGGAATAAAGTAAA | AGG | Triticum aestivum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1759 | 34042262 | OsALS | Acetolactate synthase | GGCGCGTCCATGGAGATCCACC | AGG | Oryza sativa L. | 0.007 | protoplast | CBE |
| PCdb_1760 | 27579989 | NbPAD4 (exon 2) | Phytoalexin-deficient 4 exon 2 fragment (salicylic acid signaling) [Source: SolGenomics] | GGCGAAGTGGCTATCCACCG | AGG | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1761 | 32939760 | GmKIX8-1 | regulates organ size in soybean | GGCCTTACGAGTGCGTGAGA | AGG | Glycine max (L.) Merr. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1762 | 31452351 | Glyma.05G167100 Glyma.08G125400 | Flavonoid 3'-hydroxylase (Glyma.05G167100 & Glyma.08G125400) [Source: SoyBase] | GGCCATTACTTTTACTATGG | AGG | Glycine max (L.) Merr. | 0.592 | hairy root | CRISPR-Cas9 |
| PCdb_1763 | 26842991 | FGS | FGS (Arabidopsis thaliana FATTY ACID ELONGASE26, very-long-chain fatty acid biosynthesis) [Source: TAIR] | GGCCAACGAGCGCTCCGTGC | AGG | Zea mays L. | 0.1228 | protoplast | CRISPR-Cas9 |
| PCdb_1764 | 38925598 | LOC_Os08g28940 | taste quality | GGCCAAATTATCCAGGCAGA | AGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_1765 | 31694550 | PDS | Phytoene desaturase | GGCATGCATAGCCTTTCAGG | AGG | Triticum aestivum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1766 | 34713215 | PDS | Phytoene desaturase (PDS, carotenoid biosynthesis) | GGCATGCAAAGTCTCTCAGG | AGG | Nicotiana attenuata Torr. ex S.Watson | not found | protoplast | CRISPR-Cas9 |
| PCdb_1767 | 30917862 | Glyma.20g146200 | Isoflavone reductase (Glyma.20g146200) [Source: SoyBase] | GGATTCTCTGGGCATCGCCA | AGG | Glycine max (L.) Merr. | not found | hairy root | CRISPR-Cas9 |
| PCdb_1768 | 31450868 | PDS-2 | Phytoene desaturase | GGATGGTAATCCTCCGGAA | AGG | Arabidopsis thaliana (L.) Heynh. | 38.1-100% | seed | CRISPR-Cas9 |
| PCdb_1769 | 31450868 | PDS | Phytoene desaturase | GGATGGTAATCCTCCGGAA | AGG | Arabidopsis thaliana (L.) Heynh. | 38.1-100% | seed | CRISPR-Cas9 |
| PCdb_1770 | 27033976 | MIR827a | microRNA 827a | GGATCATCTATTGAAGGAAC | AGG | Arabidopsis thaliana (L.) Heynh. | 0.24 | seed | not found |
| PCdb_1771 | 27033976 | AtMIR827a | microRNA 827a | GGATCATCTATTGAAGGAAC | AGG | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1772 | 35163555 | OsIRO3 | the Rice Iron Homeostasis Regulatory Network | GGATAGGCAGAGTAATGGGA | AGG | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1773 | 32854250 | OsBHY, OsEHY, OsWaxy | Rice beta-hydroxyacyl-ACP dehydratase, enoyl-ACP reductase, and granule-bound starch synthase (three enzymes involved in fatty acid and starch biosynthesis | GGATACCAGCGTTGTGGCTG | AGG | Oryza sativa L. | 1 | protoplast | CRISPR-Cas9 |
| PCdb_1774 | 38925598 | LOC_Os01g33350 | taste quality | GGAGTTGTGATGGCTAGTGC | AGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_1775 | 33015536 | AGO4 & NRPD1a & NRPE1 & RDR2 & RDR4 & RDR6 & CHLI1 & PIE1 | Multi-gene complex: RNA-directed DNA methylation machinery (small RNA biogenesis and chromatin modification) | GGAGTGACTGATCTTCAGCC | AGG | Arabidopsis thaliana (L.) Heynh. | 0.49 | seed | CRISPR-Cas9 |
| PCdb_1776 | 36149320 | Os4CL3 | displays diverse lignin alterations | GGAGTCGTACACGTACGCGG | AGG | Oryza sativa L. | not found | Cell Wall | CRISPR-Cas9 |
| PCdb_1777 | 26842991 | FGS | FGS (Arabidopsis thaliana FATTY ACID ELONGASE70, very-long-chain fatty acid biosynthesis) [Source: TAIR] | GGAGGAGGACGATGAGCTCA | AGG | Zea mays L. | 0.0829 | protoplast | CRISPR-Cas9 |
| PCdb_1778 | 36660867 | OsCKX | Rice cytokinin oxidase/dehydrogenase (cytokinin catabolism enzyme) | ggagcttgccggacgcggcg | agg | Oryza sativa L. | not found | protoplast | CRISPR-Cas9,CRISPR-Cas12 |
| PCdb_1779 | 31452351 | GmRIC2 | ROP-interactive CRIB motif-containing protein 2 | GGAGCTCTCACATTATGCTG | AGG | Glycine max (L.) Merr. | 0.592 | hairy root | CRISPR-Cas9 |
| PCdb_1780 | 31452351 | Glyma.06G284100 | Leucine-rich repeat receptor-like kinase (Glyma.06G284100) [Source: SoyBase] | GGAGCTCTCACATTATGCTG | AGG | Glycine max (L.) Merr. | 0.592 | hairy root | CRISPR-Cas9 |
| PCdb_1781 | 31394891 | SCL57 | RNA splicing cofactor | GGAGCCGCAGCCCCAGCAAG | AGG | Oryza sativa L. | not found | callus | CRISPR-Cas9 |
| PCdb_1782 | 26039904 | not found | not found | GGACTGGGATAGGCTGCGAA | AGG | Oryza sativa L. | not found | protoplast | not found |
| PCdb_1783 | 33638281 | TaASN2 | Wheat with greatly reduced accumulation of free asparagine in the grain | GGACTGGAGCGGCCTGCACC | AGG | Triticum aestivum L. | 0.64 | protoplast | CRISPR-Cas9 |
| PCdb_1784 | 36902202 | FAD2-2B | Omega-6 fatty acid desaturase | GGACTAGGAGAGCGGAGTGG | AGG | Glycine max (L.) Merr. | not found | protoplast | CRISPR-Cas9,Base editor |
| PCdb_1785 | 38925598 | LOC_Os09g27590 | taste quality | GGACGCGGTGGCATTGCCGG | AGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_1786 | 31585004 | SAUR41 subfamily | Small auxin-up RNA 41 family protein | GGACACGTACCGGTCTACGT | AGG | Arabidopsis thaliana (L.) Heynh. | not found | seed | CRISPR-Cas9 |
| PCdb_1787 | 30917862 | Glyma.20g146200 | Isoflavone reductase (Glyma.20g146200) [Source: SoyBase] | GGACAATCCGGTAGTCTCGA | AGG | Glycine max (L.) Merr. | not found | hairy root | CRISPR-Cas9 |
| PCdb_1788 | 35167131 | not found | not found | GGACAAGGCTCGCTTGGTGC | AGG | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1789 | 31882637 | not found | Gene not detected or not annotated in the database | GGACAACTTCCTACTCAT | AGG | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1790 | 37315207 | not found | not found | GGAATGGTGGTTCAATGGG | AGG | Solanum lycopersicum L. | 5-8% | protoplast | Base editor |
| PCdb_1791 | 37315207 | not found | not found | GGAATGGTGGTTCAATGGG | AGG | Solanum lycopersicum L. | 5-8% | protoplast | Base editor |
| PCdb_1792 | 33704523 | Rpp1L_TS2 | RPP1-like disease resistance protein | GGAATGGACAGCTGATCTGG | AGG | Glycine max (L.) Merr. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1793 | 32046096 | GmFAD2-2A | Omega-6 fatty acid desaturase (FAD2-2A) | GGAATCACATTTCAAACTT | AGG | Glycine max (L.) Merr. | 0.5556 | protoplast | CRISPR-Cas9 |
| PCdb_1794 | 38925598 | LOC_Os07g34520 | taste quality | GGAAGGGCGGTTCGAGGCGG | AGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_1795 | 25879861 | 11gDDM1 | Decrease in DNA methylation 1 (chromatin remodeling factor) | GGAAGAGGAGGTACAGTGTG | AGG | Glycine max (L.) Merr. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1796 | 31394891 | SR33 | SR-rich splicing regulator | GGAACCTCCCGGGCGACATC | AGG | Oryza sativa L. | not found | callus | CRISPR-Cas9 |
| PCdb_1797 | 28528644 | Solyc12g038510 | Solyc12g038510 putative protein | GGAACAGCTTGAGCGTCAAC | AGG | Solanum lycopersicum L. | 1 | seed | CRISPR-Cas9 |
| PCdb_1798 | 28528644 | Solyc12g038510 | Solyc12g038510 putative protein | GGAACAGCTTGAGCGTCAAC | AGG | Solanum lycopersicum L. | 1 | seed | CRISPR-Cas9 |
| PCdb_1799 | 27033976 | AtTFL1 | TERMINAL FLOWER 1 (floral repressor) | GGAAAACTTGTAAGAGGAAA | AGG | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1800 | 37879575 | GEX1 | Gamete expressed protein 1 | GCTTTCAAAAGCATTCTCCA | AGG | Arabidopsis thaliana (L.) Heynh. | not found | not found | CRISPR-Cas9 |
| PCdb_1801 | 33704523 | Rpp1L_TS3 | RPP1-like disease resistance protein | GCTTGTAGATCTCCCAGTGG | AGG | Glycine max (L.) Merr. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1802 | 31452351 | Glyma.08G246100 | glucosidase (Glyma.08G246100) [Source: SoyBase] | GCTTGGTGGGGCAATTCCGG | AGG | Glycine max (L.) Merr. | 0.592 | hairy root | CRISPR-Cas9 |
| PCdb_1803 | 33440058 | Os03circ00204 | Circular RNA (potential regulatory function) | gcttgcgcacaatcttaacga | AGG | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1804 | 31452351 | Glyma.15G052300 | ERF transcription factor (Glyma.15G052300) [Source: SoyBase] | GCTTCTCTTGAATGAAAAGG | AGG | Glycine max (L.) Merr. | 0.592 | hairy root | CRISPR-Cas9 |
| PCdb_1805 | 39172289 | OsIPK1 | Regulates grain phosphorus (Pi) homeostasis and starch synthesis; aimed at low phytic acid content while preserving starch accumulation. | gcttcctctaggattacctg | AGG | Oryza sativa L. | 0.192 | callus | CRISPR/Cas9 |
| PCdb_1806 | 31273916 | ZmTMS5 | Thermosensitive male sterility protein 5 (pollen development) | GCTTAAGCTTCTGCTTCACC | AGG | Triticum aestivum L. | 48-78% | protoplast | CRISPR-Cas9 |
| PCdb_1807 | 37176936 | FtsZ1 | FtsZ1 (Filamenting temperature-sensitive mutant Z 1, chloroplast division) [Source: UniProt] | GCTSCCTGTTCCCCTAAAAG | AGG | Solanum tuberosum L. | 0.72 | protoplast | CRISPR-Cas9 |
| PCdb_1808 | 34351541 | WRKY3 | WRKY transcription factor 3 (defense response) | GCTGTTGTAACAACATATGA | AGG | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1809 | 38925598 | LOC_Os11g41860 | taste quality | GCTGTCGGTGGTGTTCGCCA | AGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_1810 | 27943461 | sgUbi1 | single-guide RNA under Ubi1 promoter for CRISPR expression | GCTGGTGCAACTGGTGCCC | AGG | Triticum aestivum L. | 12.9-20.7% | protoplast | CRISPR-Cas9 |
| PCdb_1811 | 30733188 | not found | not found | GCTGGCGTAATAGCGAAG | AGG | Oryza sativa L. | not found | protoplast | not found |
| PCdb_1812 | 35937356 | AtCLCa | Chloride channel CLCa (vacuolar nitrate/proton antiport) | GCTGCTTTCAGGTCACCAGT | AGG | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1813 | 30715580 | WaxyGBSSI | Granule-bound starch synthase I (WaxyGBSSI, amylose synthesis) | GCTGCTCCGCCACGGGTTCC | AGG | Oryza sativa L. | not found | protoplast | not found |
| PCdb_1814 | 25879861 | GFP5 | Reporter fluorescent protein | GCTGAAGCACTGCACGCCGT | AGG | Glycine max (L.) Merr. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1815 | 38492487 | SlACOS1 | Pollen development and male fertility | GCTCTTGTTAAGAAGGTAAG | AGG | Solanum lycopersicum L. | not found | protoplast | CRISPR/Cas9 |
| PCdb_1816 | 33557889 | Gh_A03G1524 | Gh_A03G1524 (Gossypium hirsutum WRKY transcription factor 70, defense response) [Source: CottonGen] | GCTCTTCGACAAGTACGGGA | AGG | Gossypium hirsutum L. | 0.5889 | seed | CRISPR-Cas9 |
| PCdb_1817 | 38925598 | LOC_Os09g20340 | taste quality | GCTCGAGCAAGTACAGACGC | AGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_1818 | 32939760 | GmKIX8-1 | regulates organ size in soybean | GCTCCCCGTGGTGGTTCTCA | AGG | Glycine max (L.) Merr. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1819 | 33751803 | Waxy | Granule-bound starch synthase (Waxy, starch biosynthesis) | GCTCAAGAGCATGGAGGAGA | AGG | Oryza sativa L. | 0.75 | calli | ABE |
| PCdb_1820 | 31694550 | PDS | Phytoene desaturase | GCTATCGCGTTTCTGCTCGC | AGG | Triticum aestivum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1821 | 31394891 | RS29 | RNA splicing factor involved in spliceosome assembly | GCTATCCTTTTGGCCCTGGG | AGG | Oryza sativa L. | not found | callus | CRISPR-Cas9 |
| PCdb_1822 | 25879861 | 01gDDM1 | Decrease in DNA methylation 1 (chromatin remodeling factor) | GCTACTTGAAGCTAGGATAA | AGG | Glycine max (L.) Merr. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1823 | 33557889 | Gh_A12G0439 | Gh_A12G0439 (Gossypium hirsutum sucrose synthase A12G0439) [Source: CottonGen] | GCTAATGGTTATCCAAAGAG | AGG | Gossypium hirsutum L. | 0.5889 | seed | CRISPR-Cas9 |
| PCdb_1824 | 31694550 | PDS | Phytoene desaturase | GCTAACTAGCTACAACTTGG | AGG | Triticum aestivum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1825 | 37346168 | Solyc08g082890 | Tomato protein Solyc08g082890 (uncharacterized) | GCTAAAGAAGGATTGCGTAA | AGG | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1826 | 38925598 | LOC_Os03g50250 | taste quality | GCGTTCGTACTCCTCTGTTC | AGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_1827 | 27848933 | LIG | LIGULELESS (ligule and auricle development in maize) [Source: MaizeGDB] | GCGTACGCGTACGTGTG | AGG | Zea mays L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1828 | 29093724 | MePDS | Phytoene desaturase (carotenoid biosynthesis) [Source: UniProt] | GCGTACAAAGCTTCCCAGAT | AGG | Solanum tuberosum L. | 1 | embryos | CRISPR-Cas9 |
| PCdb_1829 | 29036339 | MAF1 | isoforms to temperature-dependent flowering | GCGGTTTTTGGTGTTATGA | AGG | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1830 | 37186469 | OsWRKY10 | activates multiple rice diterpenoid phytoalexin biosynthesis genes to enhance rice blast resistance | GCGGGAACAATGATCAGTA | AGG | Oryza sativa L. | not found | blast,plants | CRISPR-Cas9 |
| PCdb_1831 | 29331085 | REF6 | RELATIVE OF EARLY FLOWERING 6 (REF6, histone demethylase) | GCGGCTGTTGACGCAAACAG | AGG | Arabidopsis thaliana (L.) Heynh. | not found | seed | CRISPR-Cas9 |
| PCdb_1832 | 32191315 | rbcS | Ribulose bisphosphate carboxylase small subunit (rbcS, photosynthesis) | GCGGAGACAAGAGACCCAAGT | AGG | Nicotiana attenuata Torr. ex S.Watson | not found | root | CRISPR-Cas9 |
| PCdb_1833 | 38925598 | LOC_Os03g22120 | taste quality | GCGCTTGAAGCACATCCAGA | AGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_1834 | 37521929 | not found | not found | GCGCTTCGACAGGGACCCCA | AGG | Dendrocalamus latiflorus Munro | not found | callus | CRISPR-Cas9 |
| PCdb_1835 | 37971599 | ZmRL6 | Maize receptor-like kinase 6 (ZmRL6, signaling pathway) | GCGCTGGCGGTGTACGACA | AGG | Zea mays L. | not found | not found | CRISPR-Cas9 |
| PCdb_1836 | 29735370 | St16DOX | Potato 16伪-hydroxylase (St16DOX, steroidal glycoalkaloid biosynthesis) | GCGCTAAGCATTATGATTCAGAGG | AGG | Solanum tuberosum L. | not found | hairy root | CRISPR-Cas9 |
| PCdb_1837 | 33165814 | OsALS | Acetolactate synthase (branched-chain amino acid biosynthesis) | GCGCCCCCACTTGGGATCAT | AGG | Oryza sativa L. | 0.5 | protoplast | not found |
| PCdb_1838 | 34042262 | OsALS | Acetolactate synthase | GCGCCCCCACTTGGGATCAT | AGG | Oryza sativa L. | 0.004 | protoplast | CBE |
| PCdb_1839 | 34191398 | eCDAL | Engineered cytidine deaminase-activating enzyme (likely used in base editing systems) | GCGCCCCCACTTGGGATCAT | AGG | Oryza sativa L. | 0.6 | calli | CBE |
| PCdb_1840 | 30959555 | ALS | Acetolactate synthase, target site of ALS-inhibitor herbicides and essential for branched-chain amino acid biosynthesis | GCGCCCCCACTTGGGATCAT | AGG | Oryza sativa L. | 0.66 | calli | ABE |
| PCdb_1841 | 31002444 | not found | not found | GCGCAAGTGGATGCCATCCA | AGG | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1842 | 35569169 | OsGLYI3 | contributes to seed longevity and salt stress tolerance | GCGAGTGTCATGGCCTCCGA | AGG | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1843 | 30019807 | nCBP-2 | Calmodulin-binding protein 2 (calcium signaling) [Source: UniProt] | GCGAAAGAGAGAACCTTGAG | AGG | Manihot esculenta Crantz | 0.91 | Manihot Mill. (the genome is download from phytozome v7.1) | CRISPR-Cas9 |
| PCdb_1844 | 30729010 | BoMS1 | Male sterility 1 protein, involved in pollen development in Brassica oleracea | GCCTTTTCTAAAACTAGAAGG | AGG | Brassica oleracea var. capitata L. | 0.2778 | hypocotyl | CRISPR-Cas9 |
| PCdb_1845 | 38925598 | LOC_Os08g09230 | taste quality | GCCTTCTATGCCCTCGGAGC | AGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_1846 | 37324668 | HT-B | enhanced self-fertility in diploid Solanum tuberosum | GCCTTCACTTCCATTGCTTG | AGG | Solanum tuberosum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1847 | 29884615 | PYRABACTIN RESISTANCE1-LIKE (PYL) | PYRABACTIN RESISTANCE1-LIKE ABA receptor (PYL, abscisic acid signaling) | GCCTTAACGTATTGATCATT | AGG | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1848 | 30845784 | ClPDS | Phytoene desaturase, involved in carotenoid biosynthesis (converts phytoene to 味-carotene) | GCCTGCAATGTTAGGTGGAC | AGG | Cichorium intybus L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1849 | 33440058 | Os03circ00204 | Circular RNA (potential regulatory function) | gcctatacccttgaagctggg | AGG | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1850 | 38925598 | LOC_Os04g12639 | taste quality | GCCTACCATTGCATGCCCAA | AGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_1851 | 34517842 | MlyI | MlyI restriction endonuclease | GCCGTTAATTTGAGAGTCCA | AGG | Glycine max (L.) Merr. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1852 | 34146158 | UBQ10 | Polyubiquitin 10 (protein degradation reference gene) | GCCGTTAATTTGAGAGTCCA | AGG | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1853 | 25398353 | NbPDS | Phytoene desaturase (carotenoid biosynthesis) [Source: SolGenomics] | GCCGTTAATTTGAGAGTCCA | AGG | Nicotiana tabacum L. | 0.63 | protoplast | CRISPR-Cas9 |
| PCdb_1854 | 38925598 | LOC_Os07g39700 | taste quality | GCCGGTGGACATGGCCGTGA | AGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_1855 | 33570447 | TRE1 | Trehalase 1 | GCCGGGATCCAGGTTCCGGG | AGG | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1856 | 35143673 | not found | not found | GCCGGCGGTCAGTGCATCGC | AGG | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1857 | 31694550 | PDS | Phytoene desaturase | GCCGGCGCCCTTAAATGGTA | AGG | Triticum aestivum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1858 | 28640983 | slyPDS | Phytoene desaturase (tomato) | GCCGGACAGGGTGACAGATG | AGG | Solanum lycopersicum L. | 0.61 | leaf | CRISPR-Cas9 |
| PCdb_1859 | 27066031 | Gn1a | Cytokinin oxidase/dehydrogenase, controls grain number (Gn1a) | GCCGCTCATCCGCGCCGACG | AGG | Oryza sativa L. | 0.425 | Mature seeds | CRISPR-Cas9 |
| PCdb_1860 | 35937858 | not found | not found | GCCCAGCCTCAGCAAGGTTC | AGG | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1861 | 26842991 | FGS | FGS (Arabidopsis thaliana FATTY ACID ELONGASE11, very-long-chain fatty acid biosynthesis) [Source: TAIR] | GCCAGTCAACAATAATTGTA | AGG | Zea mays L. | 0.0183 | protoplast | CRISPR-Cas9 |
| PCdb_1862 | 36960567 | EPFL10 | maintain photosynthesis and improve drought tolerance | GCCACTCTTGTGATTACTGC | AGG | Oryza sativa L. | not found | stomatal | CRISPR-Cas9 |
| PCdb_1863 | 34713265 | AtMAR1 | Arabidopsis MAR1 transporter (metal ion homeostasis) | GCCACTCCTGCTCACCCTG | AGG | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1864 | 34191398 | eCDAL | Engineered cytidine deaminase-activating enzyme (likely used in base editing systems) | GCCACACTGGTGGGAGTGGG | AGG | Oryza sativa L. | not found | calli | CBE |
| PCdb_1865 | 29868058 | AGAMOUS | the poplar homologs of two genes essential to flower formation and morphology | GCCAACTCACTTTCTCCAAA | AGG | Populus sp. | 0.775 | protoplast | CRISPR-Cas9 |
| PCdb_1866 | 37346168 | Solyc01g079620 | Tomato protein Solyc01g079620 (uncharacterized) | GCCAAATCAACTACGGCTTT | AGG | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1867 | 33931634 | VvbZIP36 | Vitis vinifera bZIP transcription factor 36 (VvbZIP36, stress signaling) | GCATCGGCATAGGCATCTGC | AGG | Vitis vinifera L. | not found | calli | CRISPR-Cas9 |
| PCdb_1868 | 36070109 | TaMTL | MATRILINEAL phospholipase-like protein | GCATCCGCTCGCCGATCCTG | AGG | Triticum aestivum L. | 0.77 | leaf | not found |
| PCdb_1869 | 32817425 | ANT1 | modulates vascular development, chloroplast development, photosynthesis, and plant growth | GCATCATGGAGGCCCTCCAT | AGG | Zea mays L. | not found | chloroplast | CRISPR-Cas9 |
| PCdb_1870 | 31694550 | PDS | Phytoene desaturase | GCATATGTTTTTGCAGCACC | AGG | Triticum aestivum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1871 | 36305873 | ZmLBD5 | negatively regulates drought tolerance | GCAGTGGATCAAGTCCCCCG | AGG | Zea mays L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1872 | 28528644 | Solyc04g005320 | 5-enolpyruvylshikimate-3-phosphate synthase | GCAGTCTTCAAAGGATTCAC | AGG | Solanum lycopersicum L. | 1 | seed | CRISPR-Cas9 |
| PCdb_1873 | 38925598 | LOC_Os11g05480 | taste quality | GCAGTAGTTCAGGACATCCA | AGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_1874 | 34025705 | NMCP | displayed reduced growth rate and curly thallus lobes | GCAGGCATGCAGAGTCCGAG | AGG | Marchantia polymorpha L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1875 | 38925598 | LOC_Os03g17550 | taste quality | GCAGGAAGGAGTCCGCGGAG | AGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_1876 | 36994650 | CR4cl | Likely 4-coumarate-CoA ligase, involved in phenylpropanoid metabolism | GCAGCTACCATAGATGTGGA | AGG | Gossypium hirsutum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1877 | 30144341 | SlARF10A | critical for auxin-mediated compound leaf and flower development | GCAGCGGTGAACGTGTAAGA | AGG | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1878 | 30144341 | ARF17 | critical for auxin-mediated compound leaf and flower development | GCAGCGGTGAACGTGTAAGA | agg | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1879 | 35163555 | OsIRO3 | the Rice Iron Homeostasis Regulatory Network | GCAGCCGAGGTACCCAACAG | AGG | Oryza sativa L. | not found | protoplast | not found |
| PCdb_1880 | 30645710 | not found | not found | GCAGCAGATGCTCCTCAAGA | AGG | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1881 | 33557889 | Gh_A07G1559 | Gh_A07G1559 (Gossypium hirsutum heat shock protein 70, HSP70) [Source: CottonGen] | GCAGACACGGATCTGTTATC | AGG | Gossypium hirsutum L. | 0.5889 | seed | CRISPR-Cas9 |
| PCdb_1882 | 34376154 | GUX1 | Glucuronic acid substitution of xylan 1, xylan modification enzyme | GCAGAAGATCACATGAACAG | AGG | Pinus radiata D. Don | not found | embryo | CRISPR-Cas9 |
| PCdb_1883 | 38925598 | LOC_Os04g20774 | taste quality | GCACTCACAGCCACAGCACG | AGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_1884 | 30988404 | ALS | Acetolactate synthase | GCACCACCGCTTGGGATCAT | AGG | Triticum aestivum L. | 0.54 | protoplast | not found |
| PCdb_1885 | 32531863 | ZmPHYC | Phytochrome C light receptor | GCACATCGCACAGCAACGAC | AGG | Zea mays L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1886 | 29579304 | PtoDWF4 | Populus tomentosa DWF4 (sterol C-22 hydroxylase in brassinosteroid biosynthesis) | GCAAGTTTAATCTCCCGCC | AGG | Populus sp. | not found | Cell Wall,Plant Cells | CRISPR-Cas12 |
| PCdb_1887 | 37014117 | not found | not found | GCAAGCACAGGTCAAAGAGG | AGG | Zea mays L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1888 | 30887096 | phyb-1 | Phytochrome B, photoreceptor mediating light responses | GCAACCCGATGTAGGGCTCA | AGG | Oryza sativa L. | not found | leaf | CRISPR-Cas9 |
| PCdb_1889 | 26842991 | FGS | FGS (Arabidopsis thaliana FATTY ACID ELONGASE21, very-long-chain fatty acid biosynthesis) [Source: TAIR] | GCAACACTACTGCTGCTAGC | AGG | Zea mays L. | 0.0318 | protoplast | CRISPR-Cas9 |
| PCdb_1890 | 32220383 | bw2 | Brown wing 2 gene (insect wing pigmentation) | GCAACAAGAAAATTTATACG | AGG | Zea mays L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1891 | 30729010 | BoPDS | Phytoene desaturase, key enzyme in carotenoid biosynthesis pathway | GCAAAGTACCTGGCTGATGC | AGG | Brassica oleracea var. capitata L. | 0.68 | hypocotyl | CRISPR-Cas9 |
| PCdb_1892 | 38925598 | LOC_Os01g42270 | taste quality | GCAAAAGCCTTCCAATCAGA | AGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_1893 | 30086204 | gTraPDS1 | gTraPDS1 (Guide RNA targeting phytoene desaturase 1) [Source: Benchling] | GAUGGAGAUUGGUAUGAGAC | AGG | Tragopogon mirus Ownbey | 87%- | protoplast | CRISPR-Cas9 |
| PCdb_1894 | 36428245 | Glyma05g29080 | on White Mold Resistance and Nodulation Investigations | GATTCTGCCCGAGCTGCTGG | agg | Glycine max (L.) Merr. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1895 | 29279404 | not found | not found | GATTCGCTACGCTTCCCGTA | AGG | Zea mays L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1896 | 33557889 | Gh_A02G0932 | Gh_A02G0932 (Gossypium hirsutum dehydrin DHN1, abiotic stress response) [Source: CottonGen] | GATGTGGTATAGCCTGCCCG | AGG | Gossypium hirsutum L. | 0.5889 | seed | CRISPR-Cas9 |
| PCdb_1897 | 26842992 | GRMZM2G080129 (Hsg4) | Maize genome reference GRMZM2G080129 (Heat shock protein gene Hsg4) [Source: MaizeGDB] | gatgtcttcatcatggatcc | agg | Zea mays L. | 19-31% | protoplast | CRISPR-Cas9 |
| PCdb_1898 | 38925598 | LOC_Os05g48416 | taste quality | GATGTCGTAACTGCCAAGCA | AGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_1899 | 36593415 | not found | not found | GATGGGTTACAACGTGAAGG | AGG | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1900 | 39172289 | OsIPK1 | Regulates grain phosphorus (Pi) homeostasis and starch synthesis; aimed at low phytic acid content while preserving starch accumulation. | gatggaggtggttctgcatg | AGG | Oryza sativa L. | 0.192 | callus | CRISPR/Cas9 |
| PCdb_1901 | 38925598 | LOC_Os04g49720 | taste quality | GATGGAGGCGTCGGATGTGG | AGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_1902 | 31694550 | PDS | Phytoene desaturase | GATGCTGTCCCGCAGGAGCC | AGG | Triticum aestivum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1903 | 29884615 | PYRABACTIN RESISTANCE1-LIKE (PYL) | PYRABACTIN RESISTANCE1-LIKE ABA receptor (PYL, abscisic acid signaling) | GATGAGGAGATATTATCTG | AGG | Arabidopsis thaliana (L.) Heynh. | >80% | protoplast | CRISPR-Cas9 |
| PCdb_1904 | 33931634 | VvbZIP36 | Vitis vinifera bZIP transcription factor 36 (VvbZIP36, stress signaling) | GATGAGAGACGACAACGACG | AGG | Vitis vinifera L. | not found | calli | CRISPR-Cas9 |
| PCdb_1905 | 36526029 | not found | not found | GATGAATCTTGGGCTGATGA | AGG | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1906 | 36467273 | not found | not found | GATGAACTAAGATCCGATAC | AGG | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1907 | 29093724 | MePDS | Phytoene desaturase (carotenoid biosynthesis) [Source: UniProt] | GATCTCTGTAAGGGACGGCA | AGG | Solanum tuberosum L. | 1 | embryos | CRISPR-Cas9 |
| PCdb_1908 | 31694550 | PDS | Phytoene desaturase | GATCGTTGCAGAGGTCGGCA | AGG | Triticum aestivum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1909 | 31452351 | Glyma.08G124800 Glyma.05G166700 | Glutathione S-transferase (Glyma.08G124800 & Glyma.05G166700) [Source: SoyBase] | GATCGTGTGTTGGGGGGAGG | AGG | Glycine max (L.) Merr. | 0.592 | hairy root | CRISPR-Cas9 |
| PCdb_1910 | 36552339 | OsNAC092 | Oryza sativa NAC092 transcription factor (OsNAC092, stress response) | GATCGCCCAATAAGCCGGAA | AGG | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1911 | 26507366 | Avr46 | Avirulence effector (pathogen recognition) | GATCGCATCGTCTGTCACCA | agg | Glycine max (L.) Merr. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1912 | 37584314 | Cl97C03G057690.1 (CIPID) | regulates the initiation and morphogenesis of watermelon lateral organs | GATCCCGTACTCTCAGGAGT | AGG | Citrullus lanatus (Thunb.) Matsum. & Nakai | not found | not found | CRISPR-Cas9 |
| PCdb_1913 | 38925598 | LOC_Os06g22760 | taste quality | GATCAAGCGCATCAAGAATG | AGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_1914 | 35167149 | ZmCOI2a & ZmCOI2b | regulate anther dehiscence and gametophytic male fertility | GATAGGCTCAGAGTAGAGAG | AGG | Zea mays L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1915 | 30917862 | Glyma.03g163500 | Chalcone isomerase (Glyma.03g163500) [Source: SoyBase] | GATAACCGTATAGAGTCAGA | AGG | Glycine max (L.) Merr. | not found | hairy root | CRISPR-Cas9 |
| PCdb_1916 | 30917862 | Glyma.19g164900 | Phenylalanine ammonia-lyase (Glyma.19g164900) [Source: SoyBase] | GATAACCGTATAGAGTCAGA | AGG | Glycine max (L.) Merr. | 0.437 | hairy root | CRISPR-Cas9 |
| PCdb_1917 | 37346168 | Solyc02g087960 | Tomato protein Solyc02g087960 (uncharacterized) | GATAAAACGGGGGTGAAGAA | AGG | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1918 | 36679094 | PAIN-1 | Protein associated with INsensitivity-1 (PAIN-1, stress response) | GAGTTCTTGAGCTTTCTCGC | AGG | Solanum tuberosum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1919 | 30928637 | OsPDS | Oryza sativa phytoene desaturase (OsPDS, carotenoid biosynthesis) | GAGTGAAATCTCTTGTCTTA | AGG | Oryza sativa L. | not found | protoplast | xCas9 |
| PCdb_1920 | 29723918 | OsPDS | Rice phytoene desaturase | GAGTGAAATCTCTTGTCTTA | AGG | Triticum aestivum L. | not found | protoplast | CRISPR-Cas9,TALEN,Base editor |
| PCdb_1921 | 33391326 | GOLS | Galactinol synthase | GAGTCACACCCCTCAGTACA | agg | Glycine max (L.) Merr. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1922 | 31585004 | SAUR41 subfamily | Small auxin-up RNA 41 family protein | GAGTATGGTTACGAGCAAAAA | AGG | Arabidopsis thaliana (L.) Heynh. | not found | seed | CRISPR-Cas9 |
| PCdb_1923 | 35457106 | BnaSVP | MADS-box transcription factor SVP | GAGTAGGATTGCATTCAAG | AGG | Brassica napus L. | not found | seed | CRISPR-Cas9 |
| PCdb_1924 | 34396631 | ADR1 | Activation of defense response 1 (disease resistance) | GAGTAGATCCTTCCGTGGTG | AGG | Arabidopsis thaliana (L.) Heynh. | not found | leaf | CRISPR-Cas9 |
| PCdb_1925 | 28790350 | BnaA9.RGA | DELLA protein RGA homolog | GAGGTCGTCCGAGATGGCCG | AGG | Brassica napus L. | 0.8 | protoplast | CRISPR-Cas9 |
| PCdb_1926 | 27515683 | AP2 | APETALA2 transcription factor, regulates flower and seed development | GAGGGTGATGAAGATAGATG | AGG | Zea mays L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1927 | 38925598 | LOC_Os03g57960 | taste quality | GAGGCCGTACCACTTAGGGG | AGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_1928 | 30455712 | PDS | Phytoene desaturase (PDS, carotenoid biosynthesis) | GAGGAGTGCTGGTCCTTTGC | AGG | Brassica oleracea var. capitata L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1929 | 30019807 | nCBP-1 | Calmodulin-binding protein 1 (calcium signaling) [Source: UniProt] | GAGGAAGCGAGAACCTTGAG | AGG | Manihot esculenta Crantz | 0.91 | Manihot Mill. (the genome is download from phytozome v7.1) | CRISPR-Cas9 |
| PCdb_1930 | 34839574 | OsMORE1a | Oryza sativa MORE1 retrotransposon (OsMORE1a, mobile genetic element) | GAGGAAGACGGTGAGGCTCC | AGG | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1931 | 34839574 | not found | not found | GAGGAAGACGGTGAGGCTCC | AGG | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1932 | 33015536 | AGO4 & NRPD1a & NRPE1 & RDR2 & RDR4 & RDR6 & CHLI1 & PIE1 | Multi-gene complex: RNA-directed DNA methylation machinery (small RNA biogenesis and chromatin modification) | GAGGAAATGGAAGCTGGCGC | AGG | Arabidopsis thaliana (L.) Heynh. | 0.25 | seed | CRISPR-Cas9 |
| PCdb_1933 | 29577545 | FveARF8 | FveARF8 (Fragaria vesca auxin response factor 8, auxin signaling) [Source: UniProt] | GAGCTGTGGCATGCATGCGC | AGG | Fragaria vesca L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1934 | 38925598 | LOC_Os01g62820 | taste quality | GAGCTGATCGGGCTGCGGCG | AGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_1935 | 35665758 | PpAPT | Physcomitrella adenosine phosphoribosyltransferase (PpAPT, purine metabolism) | GAGCGTTACCGCCACCACA | AGG | Physcomitrella patens (Hedw.) Bruch & Schimp. | not found | protoplast | CRISPR-Cas9,TALEN |
| PCdb_1936 | 37346168 | Solyc01g009070 | Tomato protein Solyc01g009070 (uncharacterized) | GAGCATCAAAAGTGAAACCG | AGG | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1937 | 30644027 | DcMYB113 | MYB transcription factor 113 | GAGCACTGGTAATCCTTTGA | AGG | Daucus carota subsp. sativus (Hoffm.) Sch眉bl. & G.Martens | 0.364 | protoplast | CRISPR-Cas9 |
| PCdb_1938 | 27033976 | AtMIR169a | microRNA 169a | GAGATTTTATGCCCCCA閳弬GA | AGG | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1939 | 27033976 | MIR169a | microRNA 169a | GAGATTTTATGCCCCCAAGA | AGG | Arabidopsis thaliana (L.) Heynh. | 0.2 | seed | not found |
| PCdb_1940 | 31694550 | PDS | Phytoene desaturase | GAGAGATCTCTTATTTCAAA | AGG | Triticum aestivum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1941 | 29421512 | RAS | RAS-related protein (small GTPase involved in signaling) | GAGACCCCGCAGCACGTTCG | AGG | Salvia miltiorrhiza Bunge | not found | protoplast | CRISPR-Cas9 |
| PCdb_1942 | 32841372 | BnTT8 | regulates seed production | GAGAATCATCGATGGAAGCG | AGG | Brassica napus L. | not found | seed | CRISPR-Cas9 |
| PCdb_1943 | 31637846 | BnTT8 | TT8 bHLH transcription factor homolog | GAGAATCATCGATGGAAGCG | AGG | Brassica napus L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1944 | 36305009 | BZR1 | BRASSINAZOLE-RESISTANT 1 transcription factor | GAGAAAGGGAGAATAATCGG | AGG | Arabidopsis thaliana (L.) Heynh. | 0.2 | protoplast | CRISPR-Cas9 |
| PCdb_1945 | 33704586 | not found | not found | GAGAAACAAAGCTTTAATCC | AGG | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1946 | 31694550 | PDS | Phytoene desaturase | GACTGAATGTGGTTAACAAT | AGG | Triticum aestivum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1947 | 27510362 | ZmAgo18b | Argonaute protein 18b (ZmAgo18b, RNA silencing pathway) | GACTAAACCTGAGTATGACA | AGG | Zea mays L. | not found | chloroplast | CRISPR-Cas9 |
| PCdb_1948 | 26284791 | GmSHR | SHORT-ROOT transcription factor (root patterning) | GACGGTGCTCAAGTTCCAGG | AGG | Glycine max (L.) Merr. | 0.454 | hairy root | CRISPR-Cas9 |
| PCdb_1949 | 32786832 | not found | not found | GACGGGATGCCGGTTTCAGC | AGG | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1950 | 29036337 | CLE41 | CLE-Peptide-Encoding Genes | GACGCAGCCGCACTTCTAGA | AGG | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1951 | 29036337 | CLE26 | CLE-Peptide-Encoding Genes | GACGCAGCCGCACTTCTAGA | AGG | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1952 | 37658430 | not found | not found | GACGACCTTCCTGTCCCCAG | AGG | Oryza sativa L. | not found | not found | CRISPR-Cas9 |
| PCdb_1953 | 29884615 | PYRABACTIN RESISTANCE1-LIKE (PYL) | PYRABACTIN RESISTANCE1-LIKE ABA receptor (PYL, abscisic acid signaling) | GACCTTCGAGCCGAGCTCGG | AGG | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1954 | 36060110 | SACPD-C | Stearoyl-ACP desaturase C (SACPD-C, fatty acid desaturation) | GACCCGGGCCTGGACCGCCG | agg | Glycine max (L.) Merr. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1955 | 26134856 | DsRed | Discosoma sp. red fluorescent protein, commonly used as a reporter gene | GACCCAGGACTCCTCCCTGC | AGG | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1956 | 32191315 | rbcS | Ribulose bisphosphate carboxylase small subunit (rbcS, photosynthesis) | GACCCAAGTAGGAAAGGTGA | AGG | Nicotiana attenuata Torr. ex S.Watson | not found | root | CRISPR-Cas9 |
| PCdb_1957 | 38925598 | LOC_Os06g21910 | taste quality | GACCATGAAAGCCAAGGCCG | AGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_1958 | 30917862 | Glyma.13g123500 | Isoflavone reductase (Glyma.13g123500) [Source: SoyBase] | GACCACCGCGTTGAGTCCGA | AGG | Glycine max (L.) Merr. | 0.038 | hairy root | CRISPR-Cas9 |
| PCdb_1959 | 38925598 | LOC_Os09g28420 | taste quality | GACAGAGCAAGGCGATAAGG | AGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_1960 | 31932727 | OsODEV | Oryza sativa ODEV transcription factor (OsODEV, chloroplast development) | GACACACACAATAGTCCCAG | AGG | Oryza sativa L. | 0.37 | calli | ABE |
| PCdb_1961 | 31932727 | OsODEV | Oryza sativa ODEV transcription factor (OsODEV, chloroplast development) | GACACACACAATAGTCCCAG | AGG | Oryza sativa L. | 0.17 | calli | ABE |
| PCdb_1962 | 31932727 | OsODEV | Oryza sativa ODEV transcription factor (OsODEV, chloroplast development) | GACACACACAATAGTCCCAG | AGG | Oryza sativa L. | 0.007 | calli | ABE |
| PCdb_1963 | 31932727 | OsODEV | Oryza sativa ODEV transcription factor (OsODEV, chloroplast development) | GACACACACAATAGTCCCAG | AGG | Oryza sativa L. | 0.005 | calli | ABE |
| PCdb_1964 | 30917862 | Glyma.19g164800 | Cinnamate 4-hydroxylase (Glyma.19g164800) [Source: SoyBase] | GACAACCTCATCGAATCCCA | AGG | Glycine max (L.) Merr. | not found | hairy root | CRISPR-Cas9 |
| PCdb_1965 | 25733849 | MPK2 | Mitogen-activated protein kinase 2 (defense response) [Source: TAIR] | GAATGCGCAGACTCGTCAGG | AGG | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1966 | 31452351 | Glyma.10G173000 Glyma.20G217200 | NAC transcription factor (Glyma.10G173000 & Glyma.20G217200) [Source: SoyBase] | GAATAGCTTGCAAACTGCCG | AGG | Glycine max (L.) Merr. | 0.592 | hairy root | CRISPR-Cas9 |
| PCdb_1967 | 31585004 | SAUR41 subfamily | inducible to modulate cell expansion and salt tolerance | GAATACGGTTACGCTCAGAA | AGG | Arabidopsis thaliana (L.) Heynh. | not found | seed | CRISPR-Cas9 |
| PCdb_1968 | 36432766 | AtbZIP62 | Positively Regulate ABA Responses in Arabidopsis | GAAGTAAAGGGAAACGGGTG | AGG | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1969 | 32191315 | rbcS | Ribulose bisphosphate carboxylase small subunit (rbcS, photosynthesis) | GAAGGTGCAAGGCTGTGGTT | AGG | Nicotiana attenuata Torr. ex S.Watson | not found | root | CRISPR-Cas9 |
| PCdb_1970 | 30625150 | RhH6 | Peroxidase RhH6 | GAAGGTATGTGGGTCATTAT | AGG | Arabidopsis thaliana (L.) Heynh. | 0.455 | protoplast | CRISPR-Cas9 |
| PCdb_1971 | 32587597 | RNP | Ribonucleoprotein | GAAGGGCGGCTGTGAGCATG | AGG | Triticum aestivum L. | not found | protoplast | not found |
| PCdb_1972 | 36245499 | Ae1Sbe1 | improves gut barrier function and ameliorates type II diabetes in high-fat diet-fed mice by increasing Akkermansia | GAAGGCGGTCATGGTTCCTG | AGG | Zea mays L. | not found | Ae1 | CRISPR-Cas9 |
| PCdb_1973 | 37014117 | not found | not found | GAAGGAAGAAGCACTCGCACAGG | agg | Zea mays L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1974 | 32191315 | rbcS | Ribulose bisphosphate carboxylase small subunit (rbcS, photosynthesis) | GAAGCTGCTAAAACTTGAGCT | AGG | Nicotiana attenuata Torr. ex S.Watson | not found | root | CRISPR-Cas9 |
| PCdb_1975 | 36070755 | SlMYB3R3 | elongated fruit shape | GAAGCAGTGTCGTGAGAGGT | AGG | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1976 | 29331085 | REF6 | RELATIVE OF EARLY FLOWERING 6 (REF6, histone demethylase) | GAAGCACACTTCTCTGTTTC | AGG | Arabidopsis thaliana (L.) Heynh. | not found | seed | CRISPR-Cas9 |
| PCdb_1977 | 28338870 | StMYB44 | regulates phosphate transport by suppressing expression of PHOSPHATE1 | GAAGATGATACTATCATC | AGG | Solanum tuberosum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1978 | 38925598 | LOC_Os01g25450 | taste quality | GAAGAGCAATGCTGACCTAA | AGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_1979 | 29569825 | smc3 | Structural maintenance of chromosomes protein 3 (smc3, chromosome organization) | GAACCTGCGAAGTGAAGAT | AGG | Zea mays L. | 0.66 | calli | CRISPR-Cas9 |
| PCdb_1980 | 39172289 | OsIPK1 | Regulates grain phosphorus (Pi) homeostasis and starch synthesis; aimed at low phytic acid content while preserving starch accumulation. | gaaccaaagctatgattaca | AGG | Oryza sativa L. | 0.192 | callus | CRISPR/Cas9 |
| PCdb_1981 | 35270079 | BnaMPK 3 | Mitogen-activated protein kinase 3 | GAACAACAACCTCTAGACG | AGG | Brassica napus L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1982 | 37346168 | Solyc05g007160 | Tomato protein Solyc05g007160 (uncharacterized) | GAAATTGCCAAGGTGGTATC | AGG | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1983 | 25879861 | miR1509 | MicroRNA involved in post-transcriptional regulation | GAAATCACGGTTGAGTGTGA | AGG | Glycine max (L.) Merr. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1984 | 27033976 | MIR169a | microRNA 169a | GAAATAGTTTCTAATTCTGG | AGG | Arabidopsis thaliana (L.) Heynh. | 0.2 | seed | not found |
| PCdb_1985 | 27033976 | AtMIR169a | An alternative strategy for targeted gene replacement in plants using a dual-sgRNA/Cas9 design | GAAATAGTTTCTAATTCTGG | AGG | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1986 | 31694550 | PDS | Phytoene desaturase | GAAATACTTGGCTTCCATGG | AGG | Triticum aestivum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1987 | 37346168 | Solyc11g011050 | Tomato protein Solyc11g011050 (unknown function) | GAAAGGTCCATGGACAGCTG | AGG | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1988 | 37346168 | Solyc02g092930 | Tomato protein Solyc02g092930 (uncharacterized) | GAAAGGCTTAGAGAAGTGGG | AGG | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1989 | 37346168 | Solyc10g044680 | Tomato protein Solyc10g044680 (unknown function) | GAAAGGCCTTTGGTGCCCTG | AGG | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1990 | 34059638 | not found | not found | GAAACAATTATCGAGAT | AGG | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1991 | 27071672 | CsLOBP | LOB domainontaining protein | GAAACAAAGTTCAAGGCAAA | agg | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1992 | 35818421 | protopanaxadiol 6-hydroxylase gene | Protopanaxadiol 6-hydroxylase (ginsenoside biosynthesis) | GAAAATGAATTTGTTCCCCG | AGG | Panax ginseng C. A. Mey. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1993 | 38925598 | LOC_Os08g36900 | taste quality | CTTGTGCTAAGCTGGACGCC | AGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_1994 | 38925598 | LOC_Os04g12639 | taste quality | CTTGCGGCAGGAATACAAGA | AGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_1995 | 31666960 | TFL1 | TERMINAL FLOWER 1 (TFL1, flowering time regulation) | CTTCTGTTTCCTCCAAGCCT | AGG | Arabidopsis thaliana (L.) Heynh. | 0.733 | seed | CRISPR/Cas9 |
| PCdb_1996 | 37018323 | PDS | Phytoene desaturase (PDS, carotenoid biosynthesis) | CTTCAGTTCGTGCTTCTAAG | AGG | Vigna unguiculata (L.) Walp. | not found | protoplast | CRISPR-Cas9 |
| PCdb_1997 | 29890017 | not found | not found | CTTCACCCCCAAGCGCCTCG | AGG | Oryza sativa L. | not found | protoplast | not found |
| PCdb_1998 | 31452351 | Glyma.19G030400 | MYB transcription factor (Glyma.19G030400) [Source: SoyBase] | CTGTTCCCGGTTTTGTAGGG | AGG | Glycine max (L.) Merr. | 0.592 | hairy root | CRISPR-Cas9 |
| PCdb_1999 | 32849681 | PDS | PDS (Phytoene desaturase) | CTGTTAACTTGAGAGTCCA | AGG | Solanum lycopersicum L. | 0.035 | leaf | CRISPR-Cas9 |
| PCdb_2000 | 33711164 | APX2 | Ascorbate peroxidase 2, scavenges hydrogen peroxide in chloroplasts under oxidative stress | CTGTGACCACTTG | AGG | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2001 | 38925598 | LOC_Os10g19960 | taste quality | CTGGCTCCATTCACTACCCC | AGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_2002 | 31694550 | PDS | Phytoene desaturase | CTGGACAACTTCATACGCAG | AGG | Triticum aestivum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2003 | 38925598 | LOC_Os11g47520 | taste quality | CTGCTGCTGCTGCGAAGGGG | AGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_2004 | 30610223 | MTL | induce formation of haploid seeds | CTGCCGCCGACGAGCAACA | AGG | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2005 | 31452351 | Glyma.13G196300 | Catalase (Glyma.13G196300) [Source: SoyBase] | CTGCCCAATCTGGCCTATGG | AGG | Glycine max (L.) Merr. | 0.592 | hairy root | CRISPR-Cas9 |
| PCdb_2006 | 31694550 | PDS | Phytoene desaturase | CTGCAACGATCACCGATCGA | AGG | Triticum aestivum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2007 | 28245842 | not found | not found | CTGATCGCGTTAACGTGTCT | AGG | Zea mays L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2008 | 37313423 | BnaNTT2 | regulates ATP homeostasis in plastid to sustain lipid metabolism and plant growth | CTGAGTACTCGTCGGACT | AGG | Brassica napus L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2009 | 34598671 | OsFtsH2 | Oryza sativa Filamentation temperature sensitive H 2 (OsFtsH2, chloroplast protease) | CTCTGTGCAACGCCACTCGA | AGG | Oryza sativa L. | not found | chloroplast | CRISPR-Cas9 |
| PCdb_2010 | 37346168 | Solyc02g088190 | Tomato protein Solyc02g088190 (uncharacterized) | CTCTCTTGATATCAGGCCTA | AGG | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2011 | 29250878 | BnCLV2 | CLAVATA2 receptor-like protein | CTCGTAGCTGAAGGCATTGA | AGG | Brassica napus L. | not found | seed | CRISPR-Cas9 |
| PCdb_2012 | 32841372 | BnCLV2 | regulates seed production | CTCGTAGCTGAAGGCATTGA | AGG | Brassica napus L. | not found | seed | CRISPR-Cas9 |
| PCdb_2013 | 28066464 | DIPM | Disease-Interacting Protein Module (likely involved in plant-pathogen interactions) | CTCGTACCCGGGTTGGGCAG | AGG | Vitis vinifera L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2014 | 28349304 | GW2 | E3 ubiquitin ligase GW2 (grain width) | CTCCGGAAGCTGATCCTCG | AGG | Oryza sativa L. | 0.67 | protoplast | CRISPR-Cas9 |
| PCdb_2015 | 30917862 | Glyma.10g037100 | Phenylalanine ammonia-lyase (Glyma.10g037100) [Source: SoyBase] | CTCCATTCGCGGCTCTTGCG | AGG | Glycine max (L.) Merr. | not found | hairy root | CRISPR-Cas9 |
| PCdb_2016 | 33557889 | Gh_A07G2334 | Gh_A07G2334 (Gossypium hirsutum tubulin beta chain A07G2334) [Source: CottonGen] | CTCATCTTCAGGAAGCGGTG | AGG | Gossypium hirsutum L. | 0.5889 | seed | CRISPR-Cas9 |
| PCdb_2017 | 37346168 | Solyc11g073120 | Tomato protein Solyc11g073120 (unknown function) | CTCAAGCTCTTGCAAGTTGA | AGG | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2018 | 30588320 | NAC1 | a new positive regulator of tomato fruit ripening | CTATTTGGGCGCGCCCCGTT | AGG | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2019 | 38925598 | LOC_Os03g10110 | taste quality | CTATACATTATCGACCGCCG | AGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_2020 | 30622549 | NAP | NAC family transcription factor NAP | CTATAAAGGAAAGCCCCCTA | AGG | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2021 | 38925598 | LOC_Os02g29230 | taste quality | CTAGTTCCCGTCTCAATGGA | AGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_2022 | 32117329 | AT1G09970 | Arabidopsis thaliana gene AT1G09970 (uncharacterized protein) | CTACACTACATGGTAGGCTT | AGG | Arabidopsis thaliana (L.) Heynh. | not found | seed | CRISPR-Cas9 |
| PCdb_2023 | 37346168 | Solyc01g079620 | Tomato protein Solyc01g079620 (uncharacterized) | CTAATGGAGAAGGCTCTTGG | AGG | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2024 | 37421327 | cde1 | Cell death executor 1 | CTAATGAGTTCAAGCCAGAGA | AGG | Brassica napus L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2025 | 38925598 | LOC_Os10g25180 | taste quality | CGTTACCTGATCGCACTCTA | AGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_2026 | 33557889 | Gh_A10G1137 | Gh_A10G1137 (Gossypium hirsutum expansin A10G1137) [Source: CottonGen] | CGTTACCACCATAAACGTGG | AGG | Gossypium hirsutum L. | 0.5889 | seed | CRISPR-Cas9 |
| PCdb_2027 | 31394891 | SC32 | Spliceosome-associated protein (32kD) | CGTGACGGCGCGGGAGCTCG | AGG | Oryza sativa L. | not found | callus | CRISPR-Cas9 |
| PCdb_2028 | 31394891 | RSZ21a | Alternative splicing variant of RSZ21 | CGTGACGGCGCGGGAGCTCG | AGG | Oryza sativa L. | not found | callus | CRISPR-Cas9 |
| PCdb_2029 | 38925598 | LOC_Os01g04110 | taste quality | CGTCGGCGTCGGCCTTCTGG | AGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_2030 | 30928637 | OsPDS | Oryza sativa phytoene desaturase (OsPDS, carotenoid biosynthesis) | CGTCCAACCCATTCCTCTGC | AGG | Oryza sativa L. | not found | protoplast | xCas9 |
| PCdb_2031 | 34191398 | eCDAL | Engineered cytidine deaminase-activating enzyme (likely used in base editing systems) | CGTCCAACCCATTCCTCTGC | AGG | Oryza sativa L. | not found | calli | CBE |
| PCdb_2032 | 37421327 | cde1 | Cell death executor 1 | CGGGCAATCGAGAAGTCACG | AGG | Brassica napus L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2033 | 31965382 | not found | not found | CGGGACAACTTCCTACTCAT | AGG | Oryza sativa L. | not found | protoplast | not found |
| PCdb_2034 | 35512407 | not found | not found | CGGCGGTCAGGCTTATGTTG | AGG | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | Base editor |
| PCdb_2035 | 31752697 | NRT1.1B | Nitrate transporter regulating nitrogen uptake and utilization | CGGCGACGGCGAGCAAGTGG | AGG | Oryza sativa L. | 0.25 | calli | CBE |
| PCdb_2036 | 30959555 | NRT1.1B | Nitrate transporter 1.1B involved in nitrogen uptake [Source: RAP-DB] | CGGCGACGGCGAGCAAGTGG | AGG | Oryza sativa L. | 0.73 | calli | CBE |
| PCdb_2037 | 30819931 | NRT1.1B | Nitrate transporter 1.1B, regulates nitrogen uptake and utilization | CGGCGACGGCGAGCAAGTGG | AGG | Oryza sativa L. | 0.556 | calli | CBE |
| PCdb_2038 | 31634585 | NRT1.1B | Nitrate transporter regulating nitrogen uptake and utilization | CGGCGACGGCGAGCAAGTGG | AGG | Oryza sativa L. | 0.78 | calli | ABE |
| PCdb_2039 | 35646007 | FtMYB45 | FtMYB45 (Fagopyrum tataricum R2R3-MYB transcription factor 45, flavonoid biosynthesis) [Source: UniProt] | CGGCCTGTAAACGAAGTTGA | AGG | Fagopyrum esculentum Moench | 0.5 | seed | CRISPR-Cas9 |
| PCdb_2040 | 38925598 | LOC_Os01g45624 | taste quality | CGGCCGGGGCGGACCGGGTA | AGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_2041 | 35457106 | BnaSVP | MADS-box transcription factor SVP | CGGAGCTCTCGGAGTCAAC | AGG | Brassica napus L. | not found | seed | CRISPR-Cas9 |
| PCdb_2042 | 31694550 | PDS | Phytoene desaturase | CGGACCTGTAACAGCGAGCC | AGG | Triticum aestivum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2043 | 29250878 | BnCLV2 | CLAVATA2 receptor-like protein | CGGAACGTTCGTTAACCTTA | AGG | Brassica napus L. | 0.135 | seed | CRISPR-Cas9 |
| PCdb_2044 | 32841372 | BnCLV2 | regulates seed production | CGGAACGTTCGTTAACCTTA | AGG | Brassica napus L. | not found | seed | CRISPR-Cas9 |
| PCdb_2045 | 30246111 | not found | not found | CGCGTCCATGGAGATCCACC | agg | Oryza sativa L. | not found | protoplast | not found |
| PCdb_2046 | 28346401 | AID | Activation-induced cytidine deaminase | CGCGTCCATGGAGATCCACC | AGG | Oryza sativa L. | not found | protoplast | not found |
| PCdb_2047 | 29778643 | not found | not found | CGCGTCCATGGAGATCCACC | AGG | Oryza sativa L. | not found | protoplast | CRISPR-Cas9,Base editor,Target-AID |
| PCdb_2048 | 31752697 | ALS | Acetolactate synthase (branched-chain amino acid biosynthesis) | CGCGTCCATGGAGATCCACC | AGG | Oryza sativa L. | 0.533 | calli | CBE |
| PCdb_2049 | 31634585 | ALS | Acetolactate synthase (branched-chain amino acid biosynthesis) | CGCGTCCATGGAGATCCACC | AGG | Oryza sativa L. | 0.78 | calli | ABE |
| PCdb_2050 | 38925598 | LOC_Os04g44570 | taste quality | CGCGGGTGGCGCCCGGCACC | AGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_2051 | 28349304 | GS3 | Grain size regulator | CGCGAGATCGGATTCCTCG | AGG | Oryza sativa L. | 1 | protoplast | CRISPR-Cas9 |
| PCdb_2052 | 31452351 | Glyma.20G222600 Glyma.10G166600 | Chalcone synthase (Glyma.20G222600 & Glyma.10G166600) [Source: SoyBase] | CGCCGGAGGTTCTGTTGGGG | AGG | Glycine max (L.) Merr. | 0.592 | hairy root | CRISPR-Cas9 |
| PCdb_2053 | 31991936 | FWL | FWL (FW2-2-like cell number regulator, plasma membrane-associated) [Source: UniProt] | CGCAGCATGGGTCCTCGGGG | AGG | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2054 | 28640983 | SSADH | Succinic semialdehyde dehydrogenase | CGCACTGCTTGCAAGCCCAC | AGG | Solanum lycopersicum L. | 0.61 | leaf | CRISPR-Cas9 |
| PCdb_2055 | 36208371 | oswhy1 | ssential for Early Chloroplast Development in Rice | CGCACCTCCTGCCTAGCCAC | AGG | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2056 | 30319576 | PsMAD1 | MADS-box transcription factor 1 homolog (development) | CGAGGACGACCGCAACCGGC | AGG | Glycine max (L.) Merr. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2057 | 38925598 | LOC_Os01g66290 | taste quality | CGAGAACAAGACGAGCCGTC | AGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_2058 | 31694550 | PDS | Phytoene desaturase | CGACGGGGGCTTCGGATTGC | AGG | Triticum aestivum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2059 | 34887519 | ZmPLD 3 | cause haploid induction | CGACATCGCACAGGCGATCC | AGG | Zea mays L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2060 | 35167131 | not found | not found | CGAAGAGCTGGAAAACTCCC | AGG | Oryza sativa L. | not found | protoplast | not found |
| PCdb_2061 | 37346168 | Solyc02g087960 | Tomato protein Solyc02g087960 (uncharacterized) | CCTTTCCCATTGCCCTCTGG | AGG | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2062 | 27510362 | ZmAgo18b | Argonaute protein 18b (ZmAgo18b, RNA silencing pathway) | CCTTGTCTGGCAGGATGGAA | AGG | Zea mays L. | not found | chloroplast | CRISPR-Cas9 |
| PCdb_2063 | 28528644 | Solyc03g114840 | Solyc03g114840 putative protein | CCTTAAAGCAAATCAGGTCA | AGG | Solanum lycopersicum L. | 1 | seed | CRISPR-Cas9 |
| PCdb_2064 | 38925598 | LOC_Os11g31340 | taste quality | CCTGCACCGTCGCGCCATTC | AGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_2065 | 31001300 | S-Rnase | S-RNase (self-incompatibility protein) | CCTGATATCAAGTGTACTGA | AGG | Solanum tuberosum L. | 93-98% | protoplast | not found |
| PCdb_2066 | 29061908 | SlORRM4 | Organellar RNA recognition motif protein SlORRM4 | CCTGAGTGCCTTGGATGGCC | AGG | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2067 | 34582078 | not found | not found | CCTCCTCTACTTTGATGGCC | AGG | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2068 | 29867128 | AtALS & AtPDS & AtFT & AtLFY | Acetolactate synthase (ALS), Phytoene desaturase (PDS), Flowering locus T (FT), and Leafy (LFY) - Multiple gene targets for plant genetic studies | CCTCCAGATAGCTGCATGGA | AGG | Arabidopsis thaliana (L.) Heynh. | 0.017 | protoplast | ABE |
| PCdb_2069 | 37346168 | Solyc09g010840 | Tomato protein Solyc09g010840 (uncharacterized) | CCGTGGCTACAGACAGATAG | AGG | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2070 | 32587597 | RNP | Ribonucleoprotein | CCGTCATTTCGCTGGGACGA | AGG | Triticum aestivum L. | not found | protoplast | not found |
| PCdb_2071 | 30715580 | WaxyGBSSI | Granule-bound starch synthase I (WaxyGBSSI, amylose synthesis) | CCGGCTTCGGCATCGCCGAC | AGG | Oryza sativa L. | not found | protoplast | not found |
| PCdb_2072 | 34191398 | eCDAL | Engineered cytidine deaminase-activating enzyme (likely used in base editing systems) | CCGAGAACACACTCCTCACA | AGG | Oryza sativa L. | not found | calli | CBE |
| PCdb_2073 | 38925598 | LOC_Os07g43390 | taste quality | CCCTCTCCCGCATCTCACCC | AGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_2074 | 31394891 | RS2Z39 | RNA splicing regulatory factor | CCCGGGATGCAAATGATGCG | AGG | Oryza sativa L. | not found | callus | CRISPR-Cas9 |
| PCdb_2075 | 36070755 | SlMYB3R3 | elongated fruit shape | CCCCTGCGTCACCAACTCAC | AGG | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2076 | 39469217 | TaD27 | DWARF27 carotenoid isomerase catalyzing isomerization of all-trans-尾-carotene to initiate strigolactone biosynthesis, thereby controlling tiller number in wheat. | CCCCCATGCGTGGGCGGAAG | AGG | Triticum aestivum L. | not found | mature embryo | CRISPR/Cas9 |
| PCdb_2077 | 33467172 | ZmJAZ15 | Regulating Maize Immunity to Gibberella Stalk Rot | CCCCAACCTAAGTTCTCG | AGG | Zea mays L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2078 | 37346168 | Solyc02g088190 | Tomato protein Solyc02g088190 (uncharacterized) | CCCACTGAGCCATGTGGCTA | AGG | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2079 | 29807545 | GFP | GFP (Green Fluorescent Protein, Aequorea victoria, transformation control) [Source: Addgene] | CCCAAGTGGGGGCGCATTCA | AGG | Oryza sativa L. | 0.007 | protoplast | ABE |
| PCdb_2080 | 30819931 | ALS | Acetolactate synthase, target site of ALS-inhibitor herbicides and essential for branched-chain amino acid biosynthesis | CCCAAGTGGGGGCGCATTCA | AGG | Oryza sativa L. | 0.212 | calli | ABE |
| PCdb_2081 | 34042262 | not found | not found | CCCAACCCCCACTGACACCT | AGG | Oryza sativa L. | 0.29 | protoplast | CBE |
| PCdb_2082 | 39725167 | GhFT | Prolongs indeterminate growth and alters plant architecture | CCAGTGCAAGTATTCCCTG | AGG | Gossypium spp. | not found | seed | CRISPR/Cas9 |
| PCdb_2083 | 32587597 | RNP | Ribonucleoprotein | CCAGGATGGGGTATTTCTAG | AGG | Triticum aestivum L. | not found | protoplast | not found |
| PCdb_2084 | 38925598 | LOC_Os06g23350 | taste quality | CCAGCTGCAATCCCAGGCCC | AGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_2085 | 36052744 | ERF 16 | EPSPS (5-enolpyruvylshikimate-3-phosphate synthase, EC 2.5.1.19, aromatic amino acid biosynthesis) [Source: UniProt] | CCAGATCTCTGAGTTCAAAG | AGG | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2086 | 38925598 | LOC_Os07g31470 | taste quality | CCACTGCTGCAGCAAGCAGA | AGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_2087 | 29061908 | SlORRM4 | Organellar RNA recognition motif protein SlORRM4 | CCACCATTGTGCGAGGTCCC | AGG | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2088 | 38925598 | LOC_Os04g38550 | taste quality | CCACAACCACATCGTCGGCG | AGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_2089 | 31694550 | PDS | Phytoene desaturase | CCACAAACCCATAGTGCTTG | AGG | Triticum aestivum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2090 | 39596534 | OsGAPDHC7 | Cytosolic glyceraldehyde-3-phosphate dehydrogenase, a key glycolytic enzyme regulating energy metabolism in rice seeds, affecting plant growth (height) and seed carbohydrate/amino acid composition. | CCAAGACTCTGCTCTTGGGG | AGG | Oryza sativa L. | not found | callus | CRISPR/Cas9 |
| PCdb_2091 | 30208656 | BnWRKY70 | WRKY transcription factor 70 homolog | CCAACTCGTTCAAGGCCGCG | AGG | Brassica napus L. | 0.5 | seed | CRISPR-Cas9 |
| PCdb_2092 | 34782822 | StSBE3 | Potato starch branching enzyme 3 (StSBE3, starch biosynthesis) | CCAAAGTTGGATCCAAATTT | AGG | Solanum tuberosum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2093 | 25879861 | miR1514 | MicroRNA involved in post-transcriptional regulation | CATTGGGATAGGAAAGGAAA | AGG | Glycine max (L.) Merr. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2094 | 31694550 | PDS | Phytoene desaturase | CATTCAGTCTTTGGGTGGTG | AGG | Triticum aestivum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2095 | 32859078 | AtGPRP3 | Regulates Plant Growth in Arabidopsis | CATTACCCACCTGCTCAAGG | AGG | Arabidopsis thaliana (L.) Heynh. | not found | Cell Nucleus | CRISPR-Cas9 |
| PCdb_2096 | 38925598 | LOC_Os04g46220 | taste quality | CATGTTGCGGAACCACCCGG | AGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_2097 | 34042262 | OsALS | Acetolactate synthase | CATGCATCCCAAGCATGCGC | AGG | Oryza sativa L. | 0.012 | protoplast | CBE |
| PCdb_2098 | 30272679 | APOBEC1 | Apolipoprotein B mRNA editing enzyme (cytidine deaminase), RNA-editing protein | CATGCATACCCAACATTTGA | AGG | Solanum tuberosum L. | 0.01 | protoplast | PBE |
| PCdb_2099 | 31991936 | FWL | FWL (FW2-2-like cell number regulator, plasma membrane-associated) [Source: UniProt] | CATCTTGCCCCGGTAGACGC | AGG | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2100 | 36840200 | ASR2 | Abscisic acid stress ripening protein 2, involved in stress responses | CATCTCGTTCCCGATCCGA | AGG | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2101 | 36142438 | not found | not found | CATCAGGAAGAACATCTGCA | AGG | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2102 | 31452351 | Glyma.15G050800 Glyma.08G181500 | ABC transporter (Glyma.15G050800 & Glyma.08G181500) [Source: SoyBase] | CATATCAAGTTCCAACAGGG | AGG | Glycine max (L.) Merr. | 0.592 | hairy root | CRISPR-Cas9 |
| PCdb_2103 | 31694550 | PDS | Phytoene desaturase | CATATATGAACATTGATGAC | AGG | Triticum aestivum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2104 | 35292048 | TcEbFS | Theobroma cacao Ebeta-farnesene synthase (TcEbFS, volatile biosynthesis) | CATAGCCTATCATTTCGAAG | AGG | Tanacetum cinerariifolium (Trevir.) Sch.Bip. | 0.07 | hairy root | CRISPR-Cas9 |
| PCdb_2105 | 31394891 | SR40 | Splicing regulatory factor | CATAAGGATATAGATCTTGC | AGG | Oryza sativa L. | not found | callus | CRISPR-Cas9 |
| PCdb_2106 | 30917862 | Glyma.10g246300 | Isoflavone reductase (Glyma.10g246300) [Source: SoyBase] | CAGTGTTGTGGATATGAACG | AGG | Glycine max (L.) Merr. | not found | hairy root | CRISPR-Cas9 |
| PCdb_2107 | 37346168 | Solyc01g111500 | Tomato protein Solyc01g111500 (uncharacterized) | CAGTAAAATTACCGCGTTTA | AGG | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2108 | 35222480 | PeU3.1 | PeU3.1 retrotransposon (mobile genetic element) | CAGGTTGTGATTGCCGGTGC | AGG | Bambusa edulis (Odashima) Keng f. | 0.39 | protoplast | CRISPR-Cas9 |
| PCdb_2109 | 31694550 | PDS | Phytoene desaturase | CAGGTCGTGATTGCTGGTGC | AGG | Triticum aestivum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2110 | 28790350 | BnaC7.RGA | DELLA protein RGA homolog | CAGGTCGTCGGAGATGGCTG | AGG | Brassica napus L. | 0.053 | protoplast | CRISPR-Cas9 |
| PCdb_2111 | 33557889 | Gh_A12G1705 | Gh_A12G1705 (Gossypium hirsutum phytoene desaturase A12G1705) [Source: CottonGen] | CAGGGCGAGTTGATGTTCGG | AGG | Gossypium hirsutum L. | 0.5889 | seed | CRISPR-Cas9 |
| PCdb_2112 | 31694550 | PDS | Phytoene desaturase | CAGCTATGTTCATAGATGAT | AGG | Triticum aestivum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2113 | 34618139 | SolyA7 | Tomato allergen SolyA7 (pollen protein) | CAGCCTCCTAAGCTTAAACT | AGG | Solanum lycopersicum L. | 0.03 | protoplast | Base editor |
| PCdb_2114 | 37346168 | Solyc05g007160 | Tomato protein Solyc05g007160 (uncharacterized) | CAGATGGACTGAAATTGCCA | AGG | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2115 | 36814841 | OsFTL1 | Flowering locus T-like protein 1 | CAGAGGGAGTOTGCAAdCGG | agg | Oryza sativa L. | not found | protoplast | not found |
| PCdb_2116 | 29051052 | TESTA GLABRA4 | TESTA GLABRA4 (seed coat development) | CAGAGAGCTGATGGACCTGC | AGG | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2117 | 35898225 | CYP92B14 | Piperitol/sesamin oxidase (CYP92B14) | CAGAATCGTCAGATCTGAAG | AGG | Sesamum indicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2118 | 33557889 | Gh_A05G0432 | Gh_A05G0432 (Gossypium hirsutum ethylene-responsive transcription factor ERF109) [Source: CottonGen] | CAGAAACAATGTGACATCCG | AGG | Gossypium hirsutum L. | 0.5889 | seed | CRISPR-Cas9 |
| PCdb_2119 | 28066464 | MLO-7 | Mildew resistance locus O 7 (powdery mildew susceptibility) [Source: TAIR] | CACTTGGCACCCTTGTAAAA | AGG | Vitis vinifera L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2120 | 31694550 | PDS | Phytoene desaturase | CACTGCATGGATAACTCGTC | AGG | Triticum aestivum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2121 | 31404128 | PDS | Phytoene desaturase (carotenoid biosynthesis) | CACTGCATGGATAACTCATC | AGG | Oryza sativa L. | not found | protoplast | not found |
| PCdb_2122 | 31404128 | PDS | Phytoene desaturase (PDS, carotenoid biosynthesis) | CACTGCATGGATAACTCATC | AGG | Glycine max (L.) Merr. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2123 | 33557889 | Gh_A05G2345 | Gh_A05G2345 (Gossypium hirsutum WRKY transcription factor, defense response) [Source: CottonGen] | CACGCCTCCTTGATAAGCCG | AGG | Gossypium hirsutum L. | 0.5889 | seed | CRISPR-Cas9 |
| PCdb_2124 | 33557889 | Gh_A13G1012 | Gh_A13G1012 (Gossypium hirsutum heat shock protein A13G1012) [Source: CottonGen] | CACGCCTCCTTGATAAGCCA | AGG | Gossypium hirsutum L. | 0.5889 | seed | CRISPR-Cas9 |
| PCdb_2125 | 35984919 | not found | not found | CACGCAATGTACAAACTCCG | AGG | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2126 | 32512821 | OsCpn60尾1 | Essential for Chloroplast Development in Rice | CACGCAATGCACGCCTTCAG | AGG | Oryza sativa L. | not found | chloroplast | CRISPR-Cas9 |
| PCdb_2127 | 29089547 | OsNramp5 | Rice natural resistance-associated macrophage protein 5, manganese/cadmium transporter | CACCTCCTCCTTCCTTCTCAAGG | AGG | Oryza sativa L. | 0.706 | calli | CRISPR-Cas9 |
| PCdb_2128 | 29089547 | OsNramp5 | Rice natural resistance-associated macrophage protein 5, manganese/cadmium transporter | CACCTCCTCCTTCCTTCTCAAGG | AGG | Oryza sativa L. | 0.706 | calli | CRISPR-Cas9 |
| PCdb_2129 | 28509421 | GmFT2a | Florigen FT homolog | CACAAGTTGTCAACCAACCA | AGG | Glycine max (L.) Merr. | 0.53 | leaf | CRISPR-Cas9 |
| PCdb_2130 | 29807545 | GFP | GFP (Green Fluorescent Protein, Aequorea victoria, transformation control) [Source: Addgene] | CAAGGATCCCAGCCCCGTGA | AGG | Oryza sativa L. | 0.0002 | protoplast | ABE |
| PCdb_2131 | 31634585 | AAT | Amino acid transporter protein | CAAGGATCCCAGCCCCGTGA | AGG | Oryza sativa L. | 0.8 | calli | ABE |
| PCdb_2132 | 38925598 | LOC_Os05g01960 | taste quality | CAAGAACCTGAAGACGAAGG | AGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_2133 | 36232648 | not found | not found | CAACAGTATAAGAGAAGCGC | AGG | Oryza sativa L. | not found | protoplast | not found |
| PCdb_2134 | 29867128 | AtRS31A | Arabidopsis arginine/serine-rich splicing factor 31A, involved in RNA processing | CAACACCTGCATCAATGTGA | AGG | Arabidopsis thaliana (L.) Heynh. | not found | seed | CBE |
| PCdb_2135 | 39339858 | LIR | Resistance to Wheat Dwarf Virus | CAACAAGGACTCCCGAGGTA | AGG | Triticum aestivum L. | not found | protoplast | CRISPR/Cas9 |
| PCdb_2136 | 30565255 | OsGL1 | Responsible for cuticular wax biosynthesis in leaves | CAAATACCTTGTACGCGCCG | AGG | Oryza sativa L. | 0.575 | protoplast | not found |
| PCdb_2137 | 36902202 | FAD2-2C | Omega-6 fatty acid desaturase | ATTTGGCTGAGACTAAATGG | AGG | Glycine max (L.) Merr. | not found | protoplast | CRISPR-Cas9,Base editor |
| PCdb_2138 | 38925598 | LOC_Os10g18370 | taste quality | ATTGGAGGTAAGGAAGCACG | AGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_2139 | 26842991 | FGS | FGS (Arabidopsis thaliana FATTY ACID ELONGASE83, very-long-chain fatty acid biosynthesis) [Source: TAIR] | ATTGCTCTTGGCGCTGCTCG | AGG | Zea mays L. | 0.84 | protoplast | CRISPR-Cas9 |
| PCdb_2140 | 29867128 | LFY | LEAFY (floral meristem identity transcription factor) [Source: TAIR] | ATTGCAAGAAGAGGAGGAAG | AGG | Arabidopsis thaliana (L.) Heynh. | 0.98 | leaf | CBE |
| PCdb_2141 | 31694550 | PDS | Phytoene desaturase | ATTCTAAGATGCTGTCCCGC | AGG | Triticum aestivum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2142 | 27579989 | DM2h exon 3 | DM2 gene (h variant) exon 3 sequence | ATTATCAACCAAAGTGGAAG | AGG | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2143 | 32504260 | OsGT-2 | not found | ATTACTGCAGTATCCTACAC | AGG | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2144 | 32632302 | not found | not found | ATTACTAGCTATAGCTA GGT | AGG | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2145 | 35151447 | PpAPT | Physcomitrella adenosine phosphoribosyltransferase (PpAPT, purine metabolism) | ATGTCTTAGGCCCTGTGATT | AGG | Solanum tuberosum L. | not found | protoplast | CRISPR-Cas9,Prime editor |
| PCdb_2146 | 33421132 | APT | Adenine phosphoribosyltransferase, salvages adenine for nucleotide synthesis | ATGTCTTAGGCCCTGTGATT | AGG | Physcomitrella patens (Hedw.) Bruch & Schimp. | 0.55 | protoplast | CRISPR-Cas9 |
| PCdb_2147 | 30477421 | Pinb | Puroindoline b (grain hardness protein) | ATGTCACTAAGCAATAAATAA | AGG | Triticum aestivum L. | 0.5417 | protoplast | CRISPR-Cas9 |
| PCdb_2148 | 31694550 | PDS | Phytoene desaturase | ATGTATAACCTTACCATTTA | AGG | Triticum aestivum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2149 | 31694550 | PDS | Phytoene desaturase | ATGGAGGGTGCGGTTTTGTC | AGG | Triticum aestivum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2150 | 34984801 | OsSPL14 | Squamosa promoter-binding-like 14 | ATGGAGATGGCCAGTGGAGG | AGG | Oryza sativa L. | not found | protoplast | CRISPR-Cas9,Base editor |
| PCdb_2151 | 34042262 | OsALS | Acetolactate synthase | ATGGACGCGCCGCCCGGGT | AGG | Oryza sativa L. | 0.03 | protoplast | CBE |
| PCdb_2152 | 33449143 | not found | not found | ATGGAATCTTGACAATTCTT | AGG | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2153 | 31666960 | TFL1 | TERMINAL FLOWER 1 (TFL1, flowering time regulation) | ATGATAGACCCAGATGTTCC | AGG | Arabidopsis thaliana (L.) Heynh. | 0.733 | seed | CRISPR-Cas9 |
| PCdb_2154 | 36070109 | TraesCS5A02G473800 | Wheat protein kinase (TraesCS5A02G473800, signal transduction) | ATGAGGAACTGGACCAAGG | AGG | Triticum aestivum L. | 0.77 | leaf | not found |
| PCdb_2155 | 32016614 | OsDEP1 | Oryza sativa Dense and Erect Panicle 1 (OsDEP1, panicle architecture) | ATGAGCTGCAAGAACAATTG | AGG | Oryza sativa L. | not found | protoplast | CRISPR-Cas9,CRISPR-Cas12 |
| PCdb_2156 | 32691446 | not found | not found | ATGACTCGATTCCGATCG | AGG | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2157 | 31694550 | PDS | Phytoene desaturase | ATGACCACCTTCTTTTCAGC | AGG | Triticum aestivum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2158 | 31705705 | BnaA9.WRKY47 | contributes to the adaptation of rape to low boron stress | ATCTTGACCACTACGTACGA | AGG | Brassica napus L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2159 | 34281579 | PDS | encoding an essential enzyme involved in carotenoid biosynthesis pathway | ATCTCTCGCTTCTAGTAGTAT | AGG | Malus x domestica Bork. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2160 | 38925598 | LOC_Os05g40790 | taste quality | ATCTCCATCAAAGTCGACAC | AGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_2161 | 40528015 | ZmWRKY125 | WRKY transcription factor involved in regulation of stress responses and developmental processes in maize. | ATCGCTCCGAGCCCCGGCCA | AGG | Zea mays L. | not found | hairy root | CRISPR/Cas9 |
| PCdb_2162 | 31450868 | CPC | R3 MYB transcription factor CAPRICE | ATCCCGGGACGGACGCCGGAGG | AGG | Arabidopsis thaliana (L.) Heynh. | 38.1-100% | seed | CRISPR-Cas9 |
| PCdb_2163 | 31450868 | CPC | R3 MYB transcription factor CAPRICE | ATCCCGGGACGGACGCCGG | AGG | Arabidopsis thaliana (L.) Heynh. | 38.1-100% | seed | CRISPR-Cas9 |
| PCdb_2164 | 27579989 | NbEDS1a + NbEDS1b (exon 2) | Enhanced disease susceptibility 1a/1b exon 2 fragment (plant immunity) [Source: SolGenomics] | ATCCCGGAATTATCAGCACG | AGG | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2165 | 38925598 | LOC_Os01g13360 | taste quality | ATCCACGACGAACCGCTGTG | AGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_2166 | 34191398 | eCDAL | Engineered cytidine deaminase-activating enzyme (likely used in base editing systems) | ATCACACCCTGGTGTAGACA | AGG | Oryza sativa L. | not found | calli | CBE |
| PCdb_2167 | 36614293 | not found | not found | ATCAACCCAACTACACCGAT | AGG | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2168 | 31694550 | PDS | Phytoene desaturase | ATAGGCATGCATAGCCTTTC | AGG | Triticum aestivum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2169 | 33557889 | Gh_A03G0760 | Gh_A03G0760 (Gossypium hirsutum 9-cis-epoxycarotenoid dioxygenase, ABA biosynthesis) [Source: CottonGen] | ATAGGCATGACACTGGACAT | AGG | Gossypium hirsutum L. | 0.5889 | seed | CRISPR-Cas9 |
| PCdb_2170 | 38925598 | LOC_Os03g50480 | taste quality | ATACAGCTGGAGTAGACATG | AGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_2171 | 37346168 | Solyc01g009070 | Tomato protein Solyc01g009070 (uncharacterized) | ATAAAGAGACGACAACGTGC | AGG | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2172 | 29731757 | SPL3 | SQUAMOSA-promoter binding-like 3 | AGTTTAAGAGAAATGAGTG | AGG | Brassica napus L. | 96.8%-100.0% | seed | CRISPR-Cas9 |
| PCdb_2173 | 36660867 | OsCKX | Rice cytokinin oxidase/dehydrogenase (cytokinin catabolism enzyme) | agttgtcacctgctcgcacg | agg | Oryza sativa L. | not found | protoplast | CRISPR-Cas9,CRISPR-Cas12 |
| PCdb_2174 | 32849681 | Eif4e | Eif4e (Eukaryotic translation initiation factor 4E) | AGTTGAAGGCCGCCGATGG | AGG | Solanum lycopersicum L. | 0.035 | leaf | CRISPR-Cas9 |
| PCdb_2175 | 26022141 | Glyma12g37050 | Unknown protein | AGTTCTTGAATGAATTCTAA | AGG | Glycine max (L.) Merr. | 0.592 | hairy root | CRISPR-Cas9 |
| PCdb_2176 | 37346168 | Solyc04g009950 | Tomato protein Solyc04g009950 (uncharacterized) | AGTTCTAGAGAAGCAATGGG | AGG | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2177 | 37346168 | Solyc03g112390 | Tomato protein Solyc03g112390 (uncharacterized) | AGTTCAGTCCCTAAATTAGC | AGG | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2178 | 31634585 | DELLA | Gibberellin signaling repressor regulating plant height | AGTGCACGGTGTCCGTGGCC | AGG | Oryza sativa L. | 0.69 | calli | ABE |
| PCdb_2179 | 33346897 | Pp3c16_18760V3.1 (PHY3) | Physcomitrella phytochrome 3 (Pp3c16_18760V3.1, light sensing) | AGTCGAAGGCCCACAGCGTG | AGG | Physcomitrella patens (Hedw.) Bruch & Schimp. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2180 | 32213123 | CVIF1 | Capsicum virus-induced factor 1 (plant-virus interaction) | AGTCCCACAGCCGACACAAA | AGG | Arabidopsis thaliana (L.) Heynh. | not found | seed | CRISPR-Cas9 |
| PCdb_2181 | 33557889 | Gh_A05G2316 | Gh_A05G2316 (Gossypium hirsutum peroxidase 72, cell wall reinforcement) [Source: CottonGen] | AGTCAACAGAGAGACTACGG | AGG | Gossypium hirsutum L. | 0.5889 | seed | CRISPR-Cas9 |
| PCdb_2182 | 33015536 | AGO4 & NRPD1a & NRPE1 & RDR2 & RDR4 & RDR6 & CHLI1 & PIE1 | Multi-gene complex: RNA-directed DNA methylation machinery (small RNA biogenesis and chromatin modification) | AGTAGGTCAAGATCATGGAG | AGG | Arabidopsis thaliana (L.) Heynh. | 0.36 | seed | CRISPR-Cas9 |
| PCdb_2183 | 34890109 | not found | not found | AGTACGACGTGAAGAACAAC | AGG | Oryza sativa L. | not found | protoplast | not found |
| PCdb_2184 | 34899806 | GmAITR5 | Enhanced Salinity Stress Tolerance | AGGTTTCACGTGCAGGGTG | AGG | Glycine max (L.) Merr. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2185 | 38925598 | LOC_Os02g47950 | taste quality | AGGTGGTTGTCAAGTCCAAG | AGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_2186 | 31694550 | PDS | Phytoene desaturase | AGGTACTAACTTGATGATTT | AGG | Triticum aestivum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2187 | 37346168 | Solyc02g067340 | Tomato protein Solyc02g067340 (uncharacterized) | AGGGCACTTCCCACTAAAAC | AGG | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2188 | 31852439 | GmLHY | alters plant height and internode length | AGGGAACGATGGACAGAGG | agg | Glycine max (L.) Merr. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2189 | 36616184 | OsOr | Oryza sativa Orange protein (OsOr, carotenoid accumulation) | AGGAGATTCAGGATAATATT | AGG | Oryza sativa L. | not found | protoplast | not found |
| PCdb_2190 | 30272679 | APOBEC1 | Apolipoprotein B mRNA editing enzyme (cytidine deaminase), RNA-editing protein | AGGAATCTATTTGAATGCCA | AGG | Solanum tuberosum L. | 0.11 | protoplast | PBE |
| PCdb_2191 | 35903231 | CPR5 | Constitutive Pathogen Response 5, regulates plant immunity and stress responses | AGCTTTAGTAATCCGCTCGT | AGG | Glycine max (L.) Merr. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2192 | 37841627 | CPR5 | Defense regulator CPR5 | AGCTTIAGTAATCCGCTCGT | AGG | Glycine max (L.) Merr. | not found | not found | CRISPR-Cas9 |
| PCdb_2193 | 35779674 | SlMADS1 | regulate tomato sepal growth | AGCTCCTCCAACGATCTCAG | AGG | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2194 | 33557889 | Gh_A05G2345 | Gh_A05G2345 (Gossypium hirsutum WRKY transcription factor, defense response) [Source: CottonGen] | AGCCGAGGCTTAACATAGAG | AGG | Gossypium hirsutum L. | 0.5889 | seed | CRISPR-Cas9 |
| PCdb_2195 | 32841372 | BnIND | regulates seed production | AGCCGAACCGCCGTAACGTA | AGG | Brassica napus L. | not found | seed | CRISPR-Cas9 |
| PCdb_2196 | 30980103 | BnALC | ALCATRAZ homolog transcription factor | AGCCGAACCGCCGTAACGTA | AGG | Brassica napus L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2197 | 30819931 | ACC | Acetyl-CoA carboxylase, rate-limiting enzyme in fatty acid synthesis | AGCCATGGGAATGTAGACAA | AGG | Oryza sativa L. | 0.4 | calli | CBE |
| PCdb_2198 | 37346168 | Solyc09g010840 | Tomato protein Solyc09g010840 (uncharacterized) | AGCCACGGAATGCCAGGTGT | AGG | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2199 | 32799324 | SITLFP8 | Lipid transfer protein (SITLFP8) | AGCATGTGCCGCAGTCTGT | AGG | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2200 | 36181413 | not found | not found | AGCATCCAAGAATGGAGTCA | AGG | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2201 | 33557889 | Gh_A06G1733 | Gh_A06G1733 (Gossypium hirsutum lipid transfer protein, LTP) [Source: CottonGen] | AGCAGCTTGCTGCAGATTAG | AGG | Gossypium hirsutum L. | 0.5889 | seed | CRISPR-Cas9 |
| PCdb_2202 | 38925598 | LOC_Os12g41790 | taste quality | AGCACAAGCTTGACACCTTG | AGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_2203 | 27543262 | not found | not found | AGCAAATGCGGCCGCCCGTT | AGG | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2204 | 37346168 | Solyc12g049300 | Tomato protein Solyc12g049300 (unknown function) | AGCAAATATTGTGAATCCTG | AGG | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2205 | 38925598 | LOC_Os05g48560 | taste quality | AGATGTGGTGAGTAGTGTGC | AGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_2206 | 29572657 | OSBBS1OsRLCK109 | played vital roles in leaf senescence and the salt stress response. | AGATGCCGCCGAGGCAGTGG | AGG | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2207 | 30013582 | Gh14-3-3d | 14-3-3 protein | AGATGAAGGGAGATTACCAT | AGG | Gossypium hirsutum L. | 0.516 | calli | CRISPR-Cas9 |
| PCdb_2208 | 34042262 | OsGS3 | GRAIN SIZE 3 protein (negative regulator of grain length) | AGATCCAGGAGAGGTAGCTG | AGG | Oryza sativa L. | not found | seed | CBE |
| PCdb_2209 | 31666960 | AP1 | APETALA1, floral meristem identity gene controlling flowering time | AGATACTTGAACGCTATGAG | AGG | Arabidopsis thaliana (L.) Heynh. | 0.667 | seed | CRISPR-Cas9 |
| PCdb_2210 | 36968417 | ZmG6PDH1 | enhances cold stress tolerance | AGAGTTCAGGAAGCTATCGC | AGG | Zea mays L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2211 | 31428115 | OsMGD2 | Monogalactosyldiacylglycerol Synthase Gene | AGAGGATGAGGCGCAAGTTC | AGG | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2212 | 31694550 | PDS | Phytoene desaturase | AGAGCTTACAAAAAATATGA | AGG | Triticum aestivum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2213 | 27510362 | ZmAgo18b | Argonaute protein 18b (ZmAgo18b, RNA silencing pathway) | AGAGCTGCCCTTCAAGACCA | AGG | Zea mays L. | not found | chloroplast | CRISPR-Cas9 |
| PCdb_2214 | 30644027 | DcPDS | Phytoene desaturase | AGAGATGTTCTTGGCGGAA | AGG | Daucus carota subsp. sativus (Hoffm.) Sch眉bl. & G.Martens | not found | protoplast | CRISPR-Cas9 |
| PCdb_2215 | 31852439 | GmLHY | alters plant height and internode length | AGAGAACGATGGACAGAGG | agg | Glycine max (L.) Merr. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2216 | 33015536 | AGO4 & NRPD1a & NRPE1 & RDR2 & RDR4 & RDR6 & CHLI1 & PIE1 | Multi-gene complex: RNA-directed DNA methylation machinery (small RNA biogenesis and chromatin modification) | AGACGTTATACCTCTGGAAG | AGG | Arabidopsis thaliana (L.) Heynh. | 0.31 | seed | CRISPR-Cas9 |
| PCdb_2217 | 37346168 | Solyc10g055410 | Tomato protein Solyc10g055410 (unknown function) | AGACGAAAGCTCTTGAGTCG | AGG | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2218 | 31694550 | PDS | Phytoene desaturase | AGACATGTCTTTAGCGTGCA | AGG | Triticum aestivum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2219 | 38925598 | LOC_Os12g06850 | taste quality | AGACATGGACATCACCTACA | AGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_2220 | 31694550 | PDS | Phytoene desaturase | AGACATACCTGCTGAAAAGA | AGG | Triticum aestivum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2221 | 31452351 | Glyma.08G121900 Glyma.05G164500 | Heat shock protein (Glyma.08G121900 & Glyma.05G164500) [Source: SoyBase] | AGACAGGCCGGAATTAGAGG | AGG | Glycine max (L.) Merr. | 0.592 | hairy root | CRISPR-Cas9 |
| PCdb_2222 | 37636104 | f2kp2 | f2kp1 (Fructose-6-phosphate,2-kinase/fructose-2,6-bisphosphatase 1, sugar metabolism) [Source: UniProt] | AGACACCCCGTGCATCATTG | AGG | Oryza sativa L. | not found | not found | not found |
| PCdb_2223 | 37346168 | Solyc11g073120 | Tomato protein Solyc11g073120 (unknown function) | AGAATTGCCCGAAAAATACC | AGG | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2224 | 28640983 | GABA | Gamma-aminobutyric acid (GABA) receptor | AGAATGCCATCCGGCAGTGA | AGG | Solanum lycopersicum L. | 0.61 | leaf | CRISPR-Cas9 |
| PCdb_2225 | 30917862 | Glyma.10g246300 | Isoflavone reductase (Glyma.10g246300) [Source: SoyBase] | AGAAGAAGAAGACCAAGACG | AGG | Glycine max (L.) Merr. | not found | hairy root | CRISPR-Cas9 |
| PCdb_2226 | 31073866 | LSSR1 | promoting fertilization | AGAACCCCGACGACTGGTAC | AGG | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2227 | 38925598 | LOC_Os01g28300 | taste quality | ACTTGTATGGAAGACGAGAG | AGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_2228 | 31694550 | PDS | Phytoene desaturase | ACTTCCTGGCTCGCTGTTAC | AGG | Triticum aestivum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2229 | 29884615 | PYRABACTIN RESISTANCE1-LIKE (PYL) | PYRABACTIN RESISTANCE1-LIKE ABA receptor (PYL, abscisic acid signaling) | ACTTCCCAAAATGACTCCAG | AGG | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2230 | 31666960 | SVP | SHORT VEGETATIVE PHASE (SVP, flowering time) | ACTGCAAGTTATGCCTCTCT | AGG | Arabidopsis thaliana (L.) Heynh. | 0.8 | seed | CRISPR-Cas9 |
| PCdb_2231 | 32841372 | BnALC | regulates seed production | ACTGATACCCAATTCCAACA | AGG | Brassica napus L. | not found | seed | CRISPR-Cas9 |
| PCdb_2232 | 29331077 | AcPDS | Phytoene desaturase | ACTCGATGGATGATGATATAAGG | AGG | Actinidia chinensis Planch. | 0.9167 | leaf | CRISPR-Cas9 |
| PCdb_2233 | 27118985 | AGAMOUS | MADS-box transcription factor AGAMOUS | ACTCCGCAACTTAGCTGTCGTGT | AGG | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2234 | 31757427 | SlUVR8 | UV-B photoreceptor (UVR8) | ACTAGGCCTTGGAACCACGG | AGG | Solanum lycopersicum L. | not found | protoplast | not found |
| PCdb_2235 | 29807545 | GFP | GFP (Green Fluorescent Protein, Aequorea victoria, transformation control) [Source: Addgene] | ACTAGATATCTAAACCATTA | AGG | Oryza sativa L. | 0.0048 | protoplast | ABE |
| PCdb_2236 | 31634585 | NRT1.1B-T4 | Nitrate transporter transgenic line (T4 generation) | ACTAGATATCTAAACCATTA | AGG | Oryza sativa L. | 0.06 | calli | ABE |
| PCdb_2237 | 33557889 | Gh_A07G1559 | Gh_A07G1559 (Gossypium hirsutum heat shock protein 70, HSP70) [Source: CottonGen] | ACGTGCGAAGAAAGCCGCCA | AGG | Gossypium hirsutum L. | 0.5889 | seed | CRISPR-Cas9 |
| PCdb_2238 | 30887096 | ehd1 | Early heading date 1, promotes flowering under short-day conditions | ACGGTGCAACTGCGTGGTCC | AGG | Oryza sativa L. | not found | leaf | CRISPR-Cas9 |
| PCdb_2239 | 28066464 | DIPM | Disease-Interacting Protein Module (likely involved in plant-pathogen interactions) | ACGGTACAAACGCGACGGAC | AGG | Vitis vinifera L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2240 | 37346168 | Solyc03g119050 | Tomato protein Solyc03g119050 (uncharacterized) | ACGGCGCTCAATAGCACGTA | AGG | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2241 | 36596996 | CAPRICE (CPC) | R3 MYB transcription factor CAPRICE | ACGGAGACAGAGCAAAGCCA | AGG | Arabidopsis thaliana (L.) Heynh. | 80.9-100% | protoplast | CRISPR-Cas9 |
| PCdb_2242 | 28066464 | DIPM | Disease-Interacting Protein Module (likely involved in plant-pathogen interactions) | ACGGAAGAGAGAGGTTGCGG | AGG | Vitis vinifera L. | 0.5-6.9% | protoplast | CRISPR-Cas9 |
| PCdb_2243 | 36534157 | TaGAMYB | regulates flowering time and fertility | ACGCCGTTCAGAAAAACAC | AGG | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2244 | 31694550 | PDS | Phytoene desaturase | ACGCCCCAGTAAACCATTAC | AGG | Triticum aestivum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2245 | 33050591 | MOF1a | MOF1a (putative transcription factor, specific function requires confirmation) | ACGCACTGTCTTGGCCACCG | AGG | Oryza sativa L. | not found | chloroplast | CRISPR-Cas9 |
| PCdb_2246 | 35222464 | BnaCRTISO | Alters the Color of Petals and Leaves | ACGAAGAGAGAAAGTGG | AGG | Brassica napus L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2247 | 40152981 | BnaA5.TAC1 | TILLER ANGLE CONTROL 1 homolog controlling branch/tiller angle in rapeseed, thereby influencing tiller number and overall yield. | ACGAAAGCTATACTGGATC | AGG | Brassica napus L. | not found | hypocotyl | CRISPR/Cas9 |
| PCdb_2248 | 30625150 | RhCAT | Catalase enzyme RhCAT | ACCTTGTAAGGATCCATGGA | AGG | Arabidopsis thaliana (L.) Heynh. | 0.789 | protoplast | CRISPR-Cas9 |
| PCdb_2249 | 38925598 | LOC_Os06g42910 | taste quality | ACCTGTACCCAAGAAGAGGA | AGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_2250 | 27530958 | PDS | Phytoene desaturase (PDS, carotenoid biosynthesis) | ACCTGATCGAGTAACTACAC | AGG | Malus x domestica Bork. | 0.318 | leaf | CRISPR-Cas9 |
| PCdb_2251 | 34281579 | PDS | encoding an essential enzyme involved in carotenoid biosynthesis pathway | ACCTCTGTAGTTACTCGATC | AGG | Malus x domestica Bork. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2252 | 31694550 | PDS | Phytoene desaturase | ACCTCGTCGTTGACTCGATC | AGG | Triticum aestivum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2253 | 38925598 | LOC_Os02g30910 | taste quality | ACCTAAGATGCCAAAGGTGA | AGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_2254 | 26842992 | GRMZM2G135228 (Hsg10) | Maize genome reference GRMZM2G135228 (Heat shock protein gene Hsg10) [Source: MaizeGDB] | accgagctcagcagggatcc | agg | Zea mays L. | 19-31% | protoplast | CRISPR-Cas9 |
| PCdb_2255 | 34266944 | OsPDCD5 | negatively regulates plant architecture and grain yield in rice | ACCCAGAGTTGGAAGCTATC | AGG | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2256 | 33176692 | Glyma.08G116300.1 | Sucrose synthase (Glyma.08G116300.1) [Source: SoyBase] | ACCCAAGTAAAGTACCA | AGG | Glycine max (L.) Merr. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2257 | 31694550 | PDS | Phytoene desaturase | ACCATGTTGTGAAGACACCG | AGG | Triticum aestivum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2258 | 32889758 | not found | regulating heading date in rice | ACCATGAGGCTCCTGAGGTA | AGG | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2259 | 32865887 | not found | not found | TGTAAAACGACGGCCAGT | TTTV | Arabidopsis thaliana (L.) Heynh. | not found | seed | CRISPR-Cas9,CRISPR-Cas12,SaCas9 |
| PCdb_2260 | 32865887 | not found | not found | CACCATGTTATCACATCAATCC | TTTV | Arabidopsis thaliana (L.) Heynh. | not found | seed | CRISPR-Cas9,CRISPR-Cas12,SaCas9 |
| PCdb_2261 | 32865887 | not found | not found | TCCCAGGATTAGAATGATTAGG | TTTV | Arabidopsis thaliana (L.) Heynh. | not found | seed | CRISPR-Cas9,CRISPR-Cas12,SaCas9 |
| PCdb_2262 | 32854160 | LbCpf 1-GhCLA 1 | CRISPR-associated endonuclease Cpf1 (LbCpf1) | GTCATGGGGCGATGGCTATTTTCG | TTTT | Gossypium hirsutum L. | not found | protoplast | CRISPR-Cas12 |
| PCdb_2263 | 36847422 | WT | Wild-type control | TTTCTACTGTTGTAGAT | TTTN | Oryza sativa L. | not found | protoplast | CRISPR-Cas9,CRISPR-Cas12 |
| PCdb_2264 | 28349358 | EPFL9 | Epidermal Patterning Factor-Like 9 (stomatal density) | TTTGAAGAAGGGTTATGGCCAAT | TTTG | Oryza sativa L. | 0.69 | embryo | CRISPR-Cas9 |
| PCdb_2265 | 36660867 | OsCKX | Rice cytokinin oxidase/dehydrogenase (cytokinin catabolism enzyme) | ttcaggtgagcatgtgataacat | tttg | Oryza sativa L. | not found | protoplast | CRISPR-Cas9,CRISPR-Cas12 |
| PCdb_2266 | 36660867 | OsCKX | Rice cytokinin oxidase/dehydrogenase (cytokinin catabolism enzyme) | gtgtagcatgtacaatatggcca | tttg | Oryza sativa L. | not found | protoplast | CRISPR-Cas9,CRISPR-Cas12 |
| PCdb_2267 | 36382936 | Cen3 | Centromere-specific histone H3 variant | GGTCTATATTGTCTGTTGTTAACA | TTTG | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas12 |
| PCdb_2268 | 31350780 | HDS22 | HDS22 (Heavy metal-associated domain protein 22) [Source: UniProt] | GGCAGTGAGCACCCCATTCGAGTG | TTTG | Physcomitrella patens (Hedw.) Bruch & Schimp. | not found | Protoplast | CRISPR-Cas9,CRISPR-Cas12 |
| PCdb_2269 | 31350780 | HDS22 | HDS22 (Heavy metal-associated domain protein 22) [Source: UniProt] | GGCAGTGAGCACCCCATTCGAGTG | TTTG | Physcomitrella patens (Hedw.) Bruch & Schimp. | not found | Protoplast | CRISPR-Cas9,CRISPR-Cas12 |
| PCdb_2270 | 36660867 | OsCKX | Rice cytokinin oxidase/dehydrogenase (cytokinin catabolism enzyme) | ggatcatcaccagggctcggatt | tttg | Oryza sativa L. | not found | protoplast | CRISPR-Cas9,CRISPR-Cas12 |
| PCdb_2271 | 31730252 | not found | Gene not detected or not annotated in the database | GCCTCCCTGCTGCAGCTGGTGCT | TTTG | Oryza sativa L. | not found | protoplast | CRISPR-Cas12 |
| PCdb_2272 | 36660867 | OsCKX | Rice cytokinin oxidase/dehydrogenase (cytokinin catabolism enzyme) | gcacgaacacattgagccatggg | tttg | Oryza sativa L. | not found | protoplast | CRISPR-Cas9,CRISPR-Cas12 |
| PCdb_2273 | 30610641 | OSPDS | Oryza sativa phytoene desaturase (OsPDS, carotenoid biosynthesis) | GAGTGAAATCTCTTGTCTTAAGG | TTTG | Oryza sativa L. | not found | protoplast | CRISPR-Cas12 |
| PCdb_2274 | 31350780 | HSFA1 | Heat shock transcription factor A1 (heat shock protein induction) [Source: TAIR] | GAAGAAAGTATGGGACAGGAACGG | TTTG | Physcomitrella patens (Hedw.) Bruch & Schimp. | not found | Protoplast | CRISPR-Cas9,CRISPR-Cas12 |
| PCdb_2275 | 36639800 | not found | not found | CTGAAGCACTACACGCCGTAGGT | TTTG | Zea mays L. | not found | protoplast | CRISPR-Cas12,Base editor |
| PCdb_2276 | 33710467 | PDS | Phytoene desaturase | CTCACCTTCCTATTACTCATCG | TTTG | Triticum aestivum L. | not found | protoplast | cpf1 |
| PCdb_2277 | 30610641 | OsDEP1 | Oryza sativa Dense and Erect Panicle 1 (OsDEP1, panicle architecture) | CTACTGTTGCAAGTGCTCACCCA | TTTG | Oryza sativa L. | not found | protoplast | CRISPR-Cas12 |
| PCdb_2278 | 33898973 | GW7T14 | Grain width regulator GW7 homolog | cggggacggccttggtggtcctgTCGA | TTTG | Triticum aestivum L. | not found | protoplast | CRISPR-Cas9,Prime editor,CRISPRi,CRISPRa,Base editor |
| PCdb_2279 | 33898973 | SPL16T2 | SQUAMOSA-promoter binding-like protein 16 | ccggagctgacagaagagagagaGCAC | TTTG | Triticum aestivum L. | not found | protoplast | CRISPR-Cas9,Prime editor,CRISPRi,CRISPRa,Base editor |
| PCdb_2280 | 33898973 | GSE5T10 | Grain size gene GSE5 homolog | caggctaagaaggcgctgcgtgcGCTC | TTTG | Triticum aestivum L. | not found | protoplast | CRISPR-Cas9,Prime editor,CRISPRi,CRISPRa,Base editor |
| PCdb_2281 | 33898973 | GS3T11 | Grain size regulator GS3 homolog | cagcatatggaggcagcatggagCCCT | TTTG | Triticum aestivum L. | not found | protoplast | CRISPR-Cas9,Prime editor,CRISPRi,CRISPRa,Base editor |
| PCdb_2282 | 30610641 | AtMIR159b | MicroRNA 159b, regulates gene expression through mRNA degradation/translation inhibition | ATTGTATGAATATATGAGTTAGT | TTTG | Oryza sativa L. | not found | protoplast | not found |
| PCdb_2283 | 37901282 | L9-TTTG | Tomato dwarf leaf 9 (L9-TTTG) regulator | AAGAAGGGTTATGGCCAATGCTT | TTTG | Solanum lycopersicum L. | not found | not found | CRISPR-Cas12,CRISPR-Cas9 |
| PCdb_2284 | 31350780 | HSFA2 | Heat shock transcription factor A2 (heat stress response) [Source: TAIR] | TTGCCAAAGCTATGCAGAATCCAA | TTTC | Physcomitrella patens (Hedw.) Bruch & Schimp. | not found | Protoplast | CRISPR-Cas9,CRISPR-Cas12 |
| PCdb_2285 | 31350780 | HDS21 | HDS21 (Heavy metal-associated domain protein 21) [Source: UniProt] | TTATAAAGTCGAAGTCCTGATCG | TTTC | Physcomitrella patens (Hedw.) Bruch & Schimp. | not found | Protoplast | CRISPR-Cas9,CRISPR-Cas12 |
| PCdb_2286 | 31350780 | HDS21 | HDS21 (possibly hydroxymethylglutaryl-CoA synthase, requires verification) | TTATAAAGTCGAAGTCCTGATCG | TTTC | Physcomitrella patens (Hedw.) Bruch & Schimp. | 26.5-100% | Protoplast | CRISPR-Cas9,CRISPR-Cas12 |
| PCdb_2287 | 36660867 | OsCKX | Rice cytokinin oxidase/dehydrogenase (cytokinin catabolism enzyme) | tgtggagcttcctgcagcaggat | tttc | Oryza sativa L. | not found | protoplast | CRISPR-Cas9,CRISPR-Cas12 |
| PCdb_2288 | 30610641 | OSROC5 | Oryza sativa ROC5 transcription factor (OSROC5, leaf rolling regulation) | TGCTTCCTGCAATGCCGGTAGAC | TTTC | Oryza sativa L. | not found | protoplast | not found |
| PCdb_2289 | 36382936 | ECA3 | Endoplasmic reticulum-type Ca??-ATPase 3 | TGATTCTCAGGTATGAACCTGTTG | TTTC | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas12 |
| PCdb_2290 | 37901282 | CC1-TTTC | Coiled-coil plant resistance protein CC1-TTTC | TCCTGAGGAGCAAGAGCCATCAC | TTTC | Solanum lycopersicum L. | not found | not found | CRISPR-Cas12,CRISPR-Cas9 |
| PCdb_2291 | 33898973 | GW2T6 | E3 ubiquitin ligase GW2 homolog | tagaggaggagctgcaacgaatgCCTG | TTTC | Triticum aestivum L. | not found | protoplast | CRISPR-Cas9,Prime editor,CRISPRi,CRISPRa,Base editor |
| PCdb_2292 | 36382936 | Cen4 | Centromere-specific histone H3 variant | GGAATTACCCATAATTACTCGCAT | TTTC | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas12 |
| PCdb_2293 | 36626407 | xopN | Xanthomonas outer protein N (xopN, bacterial virulence effector) | GCAGCCTGCAGTGTCGCCGAATA | TTTC | Oryza sativa L. | not found | protoplast | CRISPR-Cas12 |
| PCdb_2294 | 31350780 | HDS19 | HDS19 (Heavy metal-associated domain protein 19) [Source: UniProt] | GAGCTTAAAGAAGATGGACTCGT | TTTC | Physcomitrella patens (Hedw.) Bruch & Schimp. | not found | Protoplast | CRISPR-Cas9,CRISPR-Cas12 |
| PCdb_2295 | 36660867 | OsCKX | Rice cytokinin oxidase/dehydrogenase (cytokinin catabolism enzyme) | gacattgataggcttgcgggact | tttc | Oryza sativa L. | not found | protoplast | CRISPR-Cas9,CRISPR-Cas12 |
| PCdb_2296 | 36382936 | Cen3 | Centromere-specific histone H3 variant | CTCTAAGAGTATAATGATCCAAAA | TTTC | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas12 |
| PCdb_2297 | 36382936 | ECA3 | Endoplasmic reticulum-type Ca??-ATPase 3 | CTAGCTTATCGTGATAGATCTTCC | TTTC | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas12 |
| PCdb_2298 | 36660867 | OsCKX | Cytokinin oxidase/dehydrogenase | cgcgggcggccacggtcaggtgc | tttc | Oryza sativa L. | not found | protoplast | CRISPR-Cas9,CRISPR-Cas12 |
| PCdb_2299 | 36660867 | OsCKX | Rice cytokinin oxidase/dehydrogenase (cytokinin catabolism enzyme) | caacgtgctagagctcgacgtca | tttc | Oryza sativa L. | not found | protoplast | CRISPR-Cas9,CRISPR-Cas12 |
| PCdb_2300 | 32854160 | LbCpf 1-GhCLA 1 | CRISPR-associated endonuclease Cpf1 (LbCpf1) | AGGTGATCAAAAGGAGCGGATT | TTTC | Gossypium hirsutum L. | not found | protoplast | CRISPR-Cas12 |
| PCdb_2301 | 36382936 | Cen4 | Centromere-specific histone H3 variant | ACTATAATTTATTTTACTTAATTT | TTTC | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas12 |
| PCdb_2302 | 36660867 | OsCKX | Rice cytokinin oxidase/dehydrogenase (cytokinin catabolism enzyme) | gtgaacgtggccacatccgagta | ttta | Oryza sativa L. | not found | protoplast | CRISPR-Cas9,CRISPR-Cas12 |
| PCdb_2303 | 36382936 | Cen1 | Centromere-specific histone H3 variant | GGTTGGAAGGTGATGTGATTTAAG | TTTA | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas12 |
| PCdb_2304 | 36660867 | OsCKX | Rice cytokinin oxidase/dehydrogenase (cytokinin catabolism enzyme) | cctgctgatcgccgcgctgatcg | ttta | Oryza sativa L. | not found | protoplast | CRISPR-Cas9,CRISPR-Cas12 |
| PCdb_2305 | 33898973 | An1T11 | Antirrhinum transcription factor T11 (flower development) | cccgcagtacagcccagttgctcCGTC | TTTA | Triticum aestivum L. | not found | protoplast | CRISPR-Cas9,Prime editor,CRISPRi,CRISPRa,Base editor |
| PCdb_2306 | 33898973 | GASR7T2 | Gibberellin-stimulated regulator protein 7 homolog | ccccatggcttgagcttgccgccGCCG | TTTA | Triticum aestivum L. | not found | protoplast | CRISPR-Cas9,Prime editor,CRISPRi,CRISPRa,Base editor |
| PCdb_2307 | 33710467 | PDS | Phytoene desaturase | CAAGCAGTCAACCCCCCAGTAAA | TTTA | Triticum aestivum L. | not found | protoplast | cpf1 |
| PCdb_2308 | 37032710 | not found | not found | AGTTGGAGCTTATCCCAACA | TTTA | Oryza sativa L. | not found | protoplast | not found |
| PCdb_2309 | 36766144 | not found | not found | CTGTTGAATTACGTTAAGCA | ttt | Glycine max (L.) Merr. | not found | protoplast | CRISPR-Cas12 |
| PCdb_2310 | 33724663 | Inf1 | INF1 elicitin protein from Phytophthora, triggers plant defense responses | CGTGCTCTGTTCGCTGCCACCGTT | TTT | Solanum tuberosum L. | 0.13 | chloroplast | CRISPR-Cas9,CRISPR-Cas12 |
| PCdb_2311 | 33724663 | Inf1 | INF1 elicitin protein from Phytophthora, triggers plant defense responses | AATCAGTGCTCGACGGACTCCGGC | TTT | Solanum tuberosum L. | 0.13 | chloroplast | CRISPR-Cas9,CRISPR-Cas12 |
| PCdb_2312 | 32438486 | GhCLA | Phytoene desaturase | GTGCAGATGGTCCAACACAT | TTG | Gossypium hirsutum L. | not found | protoplast | CRISPR-Cas9,CRISPR-Cas12 |
| PCdb_2313 | 34713233 | DL | DROOPING LEAF gene, controls carpel specification and midrib formation in rice | GGGAGAGCGGCTGCACCATCGGCGGCCGCG | TTG | Oryza sativa L. | not found | protoplast | CRISPR/Cas12a |
| PCdb_2314 | 34713233 | DL | DROOPING LEAF gene, controls carpel specification and midrib formation in rice | GGGAGAGCGGCTGCACCATCGGCG | TTG | Oryza sativa L. | not found | protoplast | CRISPR/Cas12a |
| PCdb_2315 | 34713233 | DL | DROOPING LEAF gene, controls carpel specification and midrib formation in rice | GGGAGAGCGGCTGCACCA | TTG | Oryza sativa L. | not found | protoplast | CRISPR/Cas12a |
| PCdb_2316 | 27905529 | OsAO1 | Aldehyde oxidase (ABA biosynthesis) | GCAATGCTGTGTCATATGTTAATT | TTG | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2317 | 33398158 | OsPDS | Phytoene desaturase (carotenoid biosynthesis) | GCAATAATAGAGTACAAAGG | TTG | Oryza sativa L. | 0.008 | protoplast | not found |
| PCdb_2318 | 27905529 | OSALS | ADP-glucose pyrophosphorylase small subunit | CCAACATACAGATTATAGATTAAT | TTG | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2319 | 32640102 | ALS | Acetolactate synthase | CAGGTCCTCGCCGGATGAT | TTG | Brassica napus L. | >20% | seed | A3A-PBE |
| PCdb_2320 | 34479620 | CCR 1 | Cinnamoyl-CoA reductase 1 | ACCGTCTGCGTCACCGGAGC | ttg | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2321 | 34713233 | DL | DROOPING LEAF gene, controls carpel specification and midrib formation in rice | GTCTTTTGGGTAGCTGCAGGTTGGAGTCCC | TTC | Oryza sativa L. | not found | protoplast | CRISPR/Cas12a |
| PCdb_2322 | 27905529 | OsDL | Homeobox protein DROOPING LEAF (midrib formation) | GTCTTTTGGGTAGCTGCAGGTTGG | TTC | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2323 | 34713233 | DL | DROOPING LEAF gene, controls carpel specification and midrib formation in rice | GTCTTTTGGGTAGCTGCAGGTTGG | TTC | Oryza sativa L. | not found | protoplast | CRISPR/Cas12a |
| PCdb_2324 | 34713233 | DL | DROOPING LEAF gene, controls carpel specification and midrib formation in rice | GTCTTTTGGGTAGCTGCA | TTC | Oryza sativa L. | not found | protoplast | CRISPR/Cas12a |
| PCdb_2325 | 27905529 | OsNCED1 | 9-cis-epoxycarotenoid dioxygenase (ABA biosynthesis) | CCCAAGGCCATTGGGACTCCAT | TTC | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2326 | 36992681 | LOC_Os03g51600 | Unknown/hypothetical protein | ACTGTGTACCCATCCCCTCA | TTC | Oryza sativa L. | 0.288 | calli | not found |
| PCdb_2327 | 27905529 | OSALS | ADP-glucose pyrophosphorylase small subunit | ACTCTTCTTTGTTACACGGACTC | TTC | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2328 | 36992681 | LOC_Os03g51600 | Unknown/hypothetical protein | AAAAGACTGACCCACAATAA | TTC | Oryza sativa L. | 0.556 | calli | not found |
| PCdb_2329 | 31469505 | OsSPL13 | SQUAMOSA promoter binding protein-like 13 (developmental regulator) | GACAGAAGAGAGGGAGCATGC | TTAGGT | Oryza sativa L. | 0.022 | calli | ABE |
| PCdb_2330 | 27905529 | OsDL | Homeobox protein DROOPING LEAF (midrib formation) | GGGACCTTGCACTGACTGCAGGAG | TTA | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2331 | 30928637 | OsPDS | Oryza sativa phytoene desaturase (OsPDS, carotenoid biosynthesis) | gtcgtccacaacagtacata | TGT | Oryza sativa L. | not found | protoplast | xCas9 |
| PCdb_2332 | 30928637 | OsDEP1 | Oryza sativa Dense and Erect Panicle 1 (OsDEP1, panicle architecture) | GCCGCCGAGGTACCCGGACC | TGT | Oryza sativa L. | not found | protoplast | xCas9 |
| PCdb_2333 | 34713242 | OsMPK5 | Oryza sativa mitogen-activated protein kinase 5 (OsMPK5, stress signaling) | CATCCGCTCCAACCAAGAAC | TGT | Oryza sativa L. | 0.684 | calli | CRISPR-xCas9 |
| PCdb_2334 | 34713242 | OsMPK5 | Oryza sativa mitogen-activated protein kinase 5 (OsMPK5, stress signaling) | CATCCGCTCCAACCAAGAAC | TGT | Oryza sativa L. | 0.684 | calli | CRISPR-xCas9 |
| PCdb_2335 | 31545544 | OsMPK5 | Mitogen-activated protein kinase 5 (defense responses) | CATCCGCTCCAACCAAGAAC | TGT | Oryza sativa L. | 0.125 | seed | CBE |
| PCdb_2336 | 34984801 | OsWaxy | Granule-bound starch synthase I | ATCTCTGCACTGAATTGAAT | TGT | Oryza sativa L. | not found | protoplast | CRISPR-Cas9,Base editor |
| PCdb_2337 | 33152517 | APOBEC3A | the APOBEC family of cytidine deaminases | ATCTCTGCACTGAATTGAAT | TGT | Oryza sativa L. | 0.448 | protoplast | CBE |
| PCdb_2338 | 31932727 | OsODEV | Oryza sativa ODEV transcription factor (OsODEV, chloroplast development) | ACTAGTACCTCTGGGACTAT | TGT | Oryza sativa L. | 0.36 | calli | ABE |
| PCdb_2339 | 31932727 | OsODEV | Oryza sativa ODEV transcription factor (OsODEV, chloroplast development) | ACTAGTACCTCTGGGACTAT | TGT | Oryza sativa L. | 0.07 | calli | ABE |
| PCdb_2340 | 33152517 | APOBEC3A | the APOBEC family of cytidine deaminases | ACCGCCACCGTCGTCGCCAA | TGT | Oryza sativa L. | 0.5 | protoplast | CBE |
| PCdb_2341 | 30928637 | OsDEP1 | Oryza sativa Dense and Erect Panicle 1 (OsDEP1, panicle architecture) | ACCGAAAAAGACGGCAAGATC | TGT | Oryza sativa L. | not found | protoplast | xCas9 |
| PCdb_2342 | 30537191 | IPA1 | Ideal Plant Architecture 1 (OsSPL14), controls tillering and panicle branching | TCTCTTCTGTCAACCCAGCCA | TGGGAT | Oryza sativa L. | 0.15 | calli | CBE |
| PCdb_2343 | 30537191 | IPA1 | Ideal Plant Architecture 1 (OsSPL14), controls tillering and panicle branching | TCTCTTCTGTCAACCCAGCCA | TGGGAT | Oryza sativa L. | 0.051 | calli | CBE |
| PCdb_2344 | 30537191 | OsSPL17 | SQUAMOSA promoter binding protein-like 17, regulates leaf angle | CATGAAGAGAGAGAGCACAGC | TGGAGT | Oryza sativa L. | 0.09 | calli | CBE |
| PCdb_2345 | 33015536 | AGO4 & NRPD1a & NRPE1 & RDR2 & RDR4 & RDR6 & CHLI1 & PIE1 | Multi-gene complex: RNA-directed DNA methylation machinery (small RNA biogenesis and chromatin modification) | TGTGCCCTAGAAAAATGGGA | TGG | Arabidopsis thaliana (L.) Heynh. | 0.82 | seed | CRISPR-Cas9 |
| PCdb_2346 | 33396568 | CRTISO | Induced Somatic Recombination | TAAAATCAAGGAATCATGAA | tgg | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2347 | 36764921 | not found | not found | GACCAGAGATCTTTTAGTCT | TGG | Oryza sativa L. | not found | protoplast | CRISPR-Cas9,CRISPRi |
| PCdb_2348 | 33440058 | Os06circ02797 | Circular RNA (potential regulatory function) | gaatgcaacccctgcaaacat | TGG | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2349 | 33440058 | Os06circ02797 | Circular RNA (potential regulatory function) | gaactatccgaggagcagtac | TGG | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2350 | 28790350 | BnaC7.RGA | DELLA protein RGA homolog | ACCCTGCTGAGCTCTACTCT | TGG | Brassica napus L. | 0.421 | protoplast | CRISPR-Cas9 |
| PCdb_2351 | 34713242 | OsMPK2 | Oryza sativa mitogen-activated protein kinase 2 (OsMPK2, stress signaling) | ACACTGCAGCTATTGATATC | TGG | Oryza sativa L. | 0.95 | calli | CRISPR-xCas9 |
| PCdb_2352 | 31694550 | PDS | Phytoene desaturase | TTTTTTGTAAGCTCTGGTTC | TGG | Triticum aestivum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2353 | 31694550 | PDS | Phytoene desaturase | TTTTTGCTCCAGCAGAGGAA | TGG | Triticum aestivum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2354 | 31694550 | PDS | Phytoene desaturase | TTTTCAGCAGGTATGTCTTT | TGG | Triticum aestivum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2355 | 33642575 | PDS | Phytoene desaturase | TTTGTCTACTGCAAAATATT | TGG | Arabidopsis thaliana (L.) Heynh. | 0.1 | protoplast | CRISPR-Cas9 |
| PCdb_2356 | 28542349 | PDS | Phytoene desaturase (PDS, carotenoid biosynthesis) | TTTGTCTACTGCAAAATATT | TGG | Vitis vinifera L. | 0.615 | protoplast | CRISPR-Cas9 |
| PCdb_2357 | 31452351 | Glyma.15G052000 Glyma.08G180400 | Leucine-rich repeat receptor-like kinase (Glyma.15G052000 & Glyma.08G180400) [Source: SoyBase] | TTTGCCACATATTCACAAGG | TGG | Glycine max (L.) Merr. | 0.592 | hairy root | CRISPR-Cas9 |
| PCdb_2358 | 27579989 | AtEDS1 (Col) right | Enhanced disease susceptibility 1 protein (Col-0 ecotype), right genomic position | TTTGAGATGTCACTCTCGGT | TGG | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2359 | 40040541 | ACS4 | 1-Aminocyclopropane-1-carboxylate synthase isoform 4 involved in ethylene biosynthesis during fruit development and stress signaling. | TTTGAATGGGGTTATTCAGA | TGG | Solanum lycopersicum L. | not found | protoplast | CRISPR/Cas9 |
| PCdb_2360 | 34360533 | Lj尾 CA 1 | Lotus japonicus 尾-carbonic anhydrase 1, involved in CO? hydration/metabolism | TTTCTACAGCTGAGGTACAG | TGG | Lotus japonicus (Regel) K.Larsen | not found | protoplast | not found |
| PCdb_2361 | 36942473 | CmCNIH1 | improves salt tolerance | TTTCCTCTTCACAGGCCAC | TGG | Cucurbita maxima 脳 C. moschata | not found | protoplast | CRISPR-Cas9 |
| PCdb_2362 | 31316687 | PGM | Phosphoglucomutase | TTTCCGTGCTGGTCCTAAGG | TGG | Arabidopsis thaliana (L.) Heynh. | not found | seed | CRISPR-Cas9 |
| PCdb_2363 | 33550455 | SIHWS | Tomato HWS histone methyltransferase (SIHWS, epigenetic regulation) | TTTCCCCTTCAGCTCTTTAC | TGG | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2364 | 31694550 | PDS | Phytoene desaturase | TTTCAAAAGGCTGGATAAGT | TGG | Triticum aestivum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2365 | 33557889 | Gh_D06G1026 | Gh_D06G1026 (Gossypium hirsutum NAC transcription factor D06G1026) [Source: CottonGen] | TTTAGCAGCCTTTCACCTAA | TGG | Gossypium hirsutum L. | 0.5889 | seed | CRISPR-Cas9 |
| PCdb_2366 | 36968183 | SlDCD2 | participates in tomato fruit ripening | TTGTTGCATCCTTTGGTGAA | TGG | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2367 | 32527862 | AT5G42000 | WRKY transcription factor 40 (AT5G42000, defense response regulation) | TTGTTCCCCTGGAATGGCT | TGG | Arabidopsis thaliana (L.) Heynh. | not found | Subcellular Fractions | CRISPR-Cas9 |
| PCdb_2368 | 29036337 | CLE16 | CLE-Peptide-Encoding Genes | TTGTGAGATGACTCACGTGT | TGG | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2369 | 30291759 | MYB44 | MYB transcription factor 44 | TTGGCTGCTCACTGTGTTTA | TGG | Gossypium hirsutum L. | 0.701 | leaf | CRISPR-Cas9 |
| PCdb_2370 | 30291759 | MYB44 | MYB transcription factor 44 | TTGGCTGCTCACTGTGTTTA | TGG | Gossypium hirsutum L. | 0.701 | leaf | CRISPR-Cas9 |
| PCdb_2371 | 40040541 | ACS4 | 1-Aminocyclopropane-1-carboxylate synthase isoform 4 involved in ethylene biosynthesis during fruit development and stress signaling. | TTGGCTAGTAACGAACAACA | TGG | Solanum lycopersicum L. | not found | protoplast | CRISPR/Cas9 |
| PCdb_2372 | 40040541 | ACS2 | 1-Aminocyclopropane-1-carboxylate synthase catalyzing the rate-limiting step in ethylene biosynthesis, regulating fruit ripening and stress responses. | TTGGCTACTAATGAAGAGCA | TGG | Solanum lycopersicum L. | not found | protoplast | CRISPR/Cas9 |
| PCdb_2373 | 33557889 | Gh_A10G1868 | Gh_A10G1868 (Gossypium hirsutum cellulose synthase A10G1868) [Source: CottonGen] | TTGAATGGTCGAGACTTAGA | TGG | Gossypium hirsutum L. | 0.5889 | seed | CRISPR-Cas9 |
| PCdb_2374 | 36460630 | not found | not found | TTGAAGCAGGTTCCCGTTA | TGG | Rosa hybrida E.H.L.Krause | not found | protoplast | CRISPR-Cas9 |
| PCdb_2375 | 31452351 | Glyma.08G182700 Glyma.15G049800 | MYB transcription factor (Glyma.08G182700 & Glyma.15G049800) [Source: SoyBase] | TTGAAAGGGATTTGAGTCAG | TGG | Glycine max (L.) Merr. | 0.592 | hairy root | CRISPR-Cas9 |
| PCdb_2376 | 31694550 | PDS | Phytoene desaturase | TTCTCCTGGTTTGTTTGGCA | TGG | Triticum aestivum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2377 | 31452351 | Glyma.06G088600 Glyma.04G086900 | Gibberellin 20-oxidase (Glyma.06G088600 & Glyma.04G086900) [Source: SoyBase] | TTCTACCTTGAAGGAAAGGG | TGG | Glycine max (L.) Merr. | 0.592 | hairy root | CRISPR-Cas9 |
| PCdb_2378 | 31694550 | PDS | Phytoene desaturase | TTCTAAACGACGAAGAAAGC | TGG | Triticum aestivum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2379 | 33859403 | OsCDC48-T1 | Rice cell division control protein 48 (AAA+ ATPase involved in cell cycle regulation) | TTCCTCGTGCTGGACAAGTG | TGG | Oryza sativa L. | not found | protoplast | not found |
| PCdb_2380 | 30819931 | ACC | Acetyl-CoA carboxylase, rate-limiting enzyme in fatty acid synthesis | TTCCTCGTGCTGGACAAGTG | TGG | Oryza sativa L. | 0.625 | calli | CBE |
| PCdb_2381 | 30819931 | ACC | Acetyl-CoA carboxylase, rate-limiting enzyme in fatty acid synthesis | TTCCTCGTGCTGGACAAGTG | TGG | Oryza sativa L. | 0.875 | calli | ABE |
| PCdb_2382 | 27148303 | IR and Rep of CABs | Intergenic region and repetitive elements of chloroplast DNA [Source: NCBI] | TTCCCCTGTGCGTGAATCCA | TGG | Gossypium hirsutum L. | not found | germplasm | CRISPR-Cas9 |
| PCdb_2383 | 31694550 | PDS | Phytoene desaturase | TTCATATTTTTTGTAAGCTC | TGG | Triticum aestivum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2384 | 28542349 | PDS | Phytoene desaturase (PDS, carotenoid biosynthesis) | TTCAGAACTCCCAATGTACC | TGG | Vitis vinifera L. | 0.615 | protoplast | CRISPR-Cas9 |
| PCdb_2385 | 36833415 | XSP10 & SlSAMT | Xylem sap protein 10 & SAM synthase (XSP10 & SlSAMT, stress response) | TTCACTTCAATGATCTCCCTGG | TGG | Solanum lycopersicum L. | 0.346 | seed | CRISPR-Cas9 |
| PCdb_2386 | 36833415 | XSP10 & SlSAMT | Xylem sap protein 10 & SAM synthase (XSP10 & SlSAMT, stress response) | TTCACTTCAATGATCTCCCTGG | TGG | Solanum lycopersicum L. | 0.1923 | seed | CRISPR-Cas9 |
| PCdb_2387 | 38925598 | LOC_Os11g15620 | taste quality | TTATTGTCGATTACCCGAGA | TGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_2388 | 30673841 | CURL3 | Copper transporter-like protein CURL3 | TTATCATTCAACAAATTTGT | TGG | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2389 | 33015536 | AGO4 & NRPD1a & NRPE1 & RDR2 & RDR4 & RDR6 & CHLI1 & PIE1 | Multi-gene complex: RNA-directed DNA methylation machinery (small RNA biogenesis and chromatin modification) | TTAGTAATGGCGTCTAAAGG | TGG | Arabidopsis thaliana (L.) Heynh. | 0.42 | seed | CRISPR-Cas9 |
| PCdb_2390 | 37346168 | Solyc04g079360 | Tomato protein Solyc04g079360 (uncharacterized) | TTAGCTGCTCATGCTAAATA | TGG | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2391 | 33916717 | CENH3 | Centromere-specific histone H3 variant, essential for kinetochore assembly and chromosome segregation | TTAGCAGTGTCCAAGTCTTC | TGG | Cannabis sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2392 | 32816057 | BnA10.RCO | Reduced-complexity leaf-shape regulator (RCO homolog) | TTAGACTCCAGCCACTGAAG | TGG | Brassica napus L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2393 | 31694550 | PDS | Phytoene desaturase | TTACACAAAGCAGAAATACT | TGG | Triticum aestivum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2394 | 32117329 | AT3G17320 | Arabidopsis thaliana gene AT3G17320 (uncharacterized protein) | TTAAAGGTGGTACCAGCAGT | TGG | Arabidopsis thaliana (L.) Heynh. | not found | seed | CRISPR-Cas9 |
| PCdb_2395 | 31394891 | RS2Z38 | RNA splicing factor (zinc finger domain protein) | TGTTTTAACTGTGGGATTGA | TGG | Oryza sativa L. | not found | callus | CRISPR-Cas9 |
| PCdb_2396 | 31394891 | RS2Z36 | RNA splicing factor (zinc finger type) | TGTTTTAACTGTGGGATTGA | TGG | Oryza sativa L. | not found | callus | CRISPR-Cas9 |
| PCdb_2397 | 27699473 | GBSS | GBSS (Granule-bound starch synthase, EC 2.4.1.242, amylose biosynthesis) [Source: UniProt] | TGTTGACAAGGGTGTTGAAT | TGG | Solanum tuberosum L. | 0.046 | Protoplast | CRISPR-Cas9 |
| PCdb_2398 | 33557889 | Gh_A10G0929 | Gh_A10G0929 (Gossypium hirsutum aquaporin TIP2;1 A10G0929) [Source: CottonGen] | TGTTCATGAGTGATGCAGGA | TGG | Gossypium hirsutum L. | 0.5889 | seed | CRISPR-Cas9 |
| PCdb_2399 | 29036337 | CLE42 | CLE-Peptide-Encoding Genes | TGTTCAACATGTCAGTGACA | TGG | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2400 | 29036337 | CLE27 | CLE-Peptide-Encoding Genes | TGTTCAACATGTCAGTGACA | TGG | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2401 | 31694550 | PDS | Phytoene desaturase | TGTTAACCACATTCAGTCTT | TGG | Triticum aestivum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2402 | 27148303 | IR and Rep of CABs | Intergenic region and repetitive elements of chloroplast DNA [Source: NCBI] | TGTGCGTGAATCCATGGTTG | TGG | Gossypium hirsutum L. | not found | germplasm | CRISPR-Cas9 |
| PCdb_2403 | 36982409 | not found | not found | TGTGCACCACTGTGAGATCA | TGG | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2404 | 32527862 | LCB1 | Serine palmitoyltransferase LCB1 subunit | TGTGAATCGGAACACAGAG | TGG | Arabidopsis thaliana (L.) Heynh. | not found | Subcellular Fractions | CRISPR-Cas9 |
| PCdb_2405 | 31116473 | GhCLA | Phytoene desaturase | TGTCACCTTTGCTGCAGGCT | tgg | Gossypium hirsutum L. | not found | protoplast | CRISPR-Cas9,Base editor |
| PCdb_2406 | 33557889 | Gh_A05G2345 | Gh_A05G2345 (Gossypium hirsutum WRKY transcription factor, defense response) [Source: CottonGen] | TGTAGAACTTTGAAGCTAGC | TGG | Gossypium hirsutum L. | 0.5889 | seed | CRISPR-Cas9 |
| PCdb_2407 | 33015536 | AGO4 & NRPD1a & NRPE1 & RDR2 & RDR4 & RDR6 & CHLI1 & PIE1 | Multi-gene complex: RNA-directed DNA methylation machinery (small RNA biogenesis and chromatin modification) | TGGTTTCTTTGAGCAGGAGA | TGG | Arabidopsis thaliana (L.) Heynh. | 0.3 | seed | CRISPR-Cas9 |
| PCdb_2408 | 31694550 | PDS | Phytoene desaturase | TGGTGTGAATTTTGCAGGAC | TGG | Triticum aestivum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2409 | 26842992 | GRMZM2G170577 (Hsg5) | Maize genome reference GRMZM2G170577 (Heat shock protein gene Hsg5) [Source: MaizeGDB] | tggtaatccatttgcgcagc | tgg | Zea mays L. | 19-31% | protoplast | CRISPR-Cas9 |
| PCdb_2410 | 31452351 | Glyma.08G181700 Glyma.08G076400 Glyma.15G050600 | ABC transporter (Glyma.08G181700, Glyma.08G076400, Glyma.15G050600) [Source: SoyBase] | TGGGGCTATATAACAAACTG | TGG | Glycine max (L.) Merr. | 0.592 | hairy root | CRISPR-Cas9 |
| PCdb_2411 | 31991936 | FWL | FWL (FW2-2-like cell number regulator, plasma membrane-associated) [Source: UniProt] | TGGGCAGGTCGCTGACATCG | TGG | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2412 | 32841372 | BnIND | regulates seed production | TGGCTTAGGGTTTCGGAAGG | TGG | Brassica napus L. | not found | seed | CRISPR-Cas9 |
| PCdb_2413 | 31694550 | PDS | Phytoene desaturase | TGGCTCGAAAATGGCATTCT | TGG | Triticum aestivum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2414 | 29250878 | BnCLV1 | CLAVATA1 receptor-like kinase | TGGATATCTCCGTAACTCTC | TGG | Brassica napus L. | not found | seed | CRISPR-Cas9 |
| PCdb_2415 | 32841372 | BnCLV1 | regulates seed production | TGGATATCTCCGTAACTCTC | TGG | Brassica napus L. | not found | seed | CRISPR-Cas9 |
| PCdb_2416 | 35973580 | not found | not found | TGGAAAAGCTGCTGACTCGG | TGG | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2417 | 36046590 | NtNAC028 | a regulator of leaf senescence and stress responses | TGCTCCGAGGAGCTTCCTCC | TGG | Nicotiana tabacum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2418 | 32314481 | OZS3 | hypersensitivity to zinc excess, cold and UV stress | TGCGTCCGTTTAGATGACGG | TGG | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2419 | 38925598 | LOC_Os07g17300 | taste quality | TGCGCTCAAGATAATCAGTA | TGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_2420 | 27579989 | DM2Ler left | DM2 gene left flanking region in Arabidopsis Landsberg erecta ecotype | TGCGCCTTCGGATTCTCGGG | TGG | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2421 | 39000251 | OsPUB9 | Modulates ubiquitination via U-box E3 ubiquitin ligase to enhance resistance to bacterial leaf blight. | TGCGAAGTTTGATATTGCAG | TGG | Oryza sativa L. | 0.556 | calli | CRISPR/Cas9 |
| PCdb_2422 | 37309421 | not found | not found | TGCATGTCCACAAAGGGTCA | TGG | Solanum lycopersicum L. | not found | trichome,seedling,hypocotyl | CRISPR-Cas9 |
| PCdb_2423 | 39985809 | SlSWEET12c | SWEET family sucrose transporter mediating phloem loading and sugar allocation during tomato fruit development. | TGCAGCACCTCTTAGCATCG | TGG | Solanum lycopersicum L. | not found | root | CRISPR/Cas9 |
| PCdb_2424 | 33015536 | AGO4 & NRPD1a & NRPE1 & RDR2 & RDR4 & RDR6 & CHLI1 & PIE1 | Multi-gene complex: RNA-directed DNA methylation machinery (small RNA biogenesis and chromatin modification) | TGCAAGAGGAACGTGTGAGG | TGG | Arabidopsis thaliana (L.) Heynh. | 0.4 | seed | CRISPR-Cas9 |
| PCdb_2425 | 33015536 | AGO4 & NRPD1a & NRPE1 & RDR2 & RDR4 & RDR6 & CHLI1 & PIE1 | Multi-gene complex: RNA-directed DNA methylation machinery (small RNA biogenesis and chromatin modification) | TGCAAGAGGAACGTGTGAGG | TGG | Arabidopsis thaliana (L.) Heynh. | 0.03 | seed | CRISPR-Cas9 |
| PCdb_2426 | 33015536 | AGO4 & NRPD1a & NRPE1 & RDR2 & RDR4 & RDR6 & CHLI1 & PIE1 | Multi-gene complex: RNA-directed DNA methylation machinery (small RNA biogenesis and chromatin modification) | TGCAAGAGGAACGTGTGAGG | TGG | Arabidopsis thaliana (L.) Heynh. | 0.01 | seed | CRISPR-Cas9 |
| PCdb_2427 | 33015536 | AGO4 & NRPD1a & NRPE1 & RDR2 & RDR4 & RDR6 & CHLI1 & PIE1 | Multi-gene complex: RNA-directed DNA methylation machinery (small RNA biogenesis and chromatin modification) | TGCAAGAGGAACGTGTGAGG | TGG | Arabidopsis thaliana (L.) Heynh. | 0.01 | seed | CRISPR-Cas9 |
| PCdb_2428 | 38925598 | LOC_Os01g67310 | taste quality | TGATTGGCATTGCCCAGTGA | TGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_2429 | 30585636 | ADR1 | Activated Disease Resistance 1 (CC-NB-LRR protein) | TGATTCATTTGCATCAAGT | TGG | Arabidopsis thaliana (L.) Heynh. | not found | Cytosol | CRISPR-Cas9 |
| PCdb_2430 | 30272679 | APOBEC1 | Apolipoprotein B mRNA editing enzyme (cytidine deaminase), RNA-editing protein | TGATCGAGTTACTGGTAAAT | TGG | Solanum tuberosum L. | 0.045 | protoplast | PBE |
| PCdb_2431 | 31694550 | PDS | Phytoene desaturase | TGATCCAAACCGTTCGATGC | TGG | Triticum aestivum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2432 | 32719704 | PDS | Phytoene desaturase (PDS, carotenoid biosynthesis) | TGAGTGCGTTGAACTTGGGC | TGG | Populus sp. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2433 | 38023936 | not found | not found | TGAGGTCGGATGGGTCGGCG | TGG | Oryza sativa L. | not found | not found | CRISPR-Cas9 |
| PCdb_2434 | 32841372 | BnIND | regulates seed production | TGAGGCTCCATCATGACTAT | TGG | Brassica napus L. | not found | seed | CRISPR-Cas9 |
| PCdb_2435 | 30980103 | BnIND | INDEHISCENT homolog bHLH transcription factor | TGAGGCTCCATCATGACTAT | TGG | Brassica napus L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2436 | 38925598 | LOC_Os06g33490 | taste quality | TGAGCCTCCAGCAGGCACAG | TGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_2437 | 31694550 | PDS | Phytoene desaturase | TGACAAAACCGCACCCTCCA | TGG | Triticum aestivum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2438 | 32257291 | Tox3 | Parastagonospora nodorum necrotrophic effector protein | TGAATATCTCCGGTCCACG | TGG | Triticum aestivum L. | 1 | protoplast | not found |
| PCdb_2439 | 30603093 | SlGRAS8 | GRAS family transcription factor | TGAAGTAAAAGGCAGCTCGT | TGG | Solanum lycopersicum L. | 1 | Germ Cells | CRISPR-Cas9 |
| PCdb_2440 | 36679094 | PAIN-1 | Protein associated with INsensitivity-1 (PAIN-1, stress response) | TGAAGCATCGTGGACCGGAT | TGG | Solanum tuberosum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2441 | 31452351 | Glyma.11G125500 Glyma.15G027900 Glyma.12G050100 Glyma.13G346300 | Heat shock protein (Glyma.11G125500, Glyma.15G027900, Glyma.12G050100, Glyma.13G346300) [Source: SoyBase] | TGAAGAGGAATGGGTGATGT | TGG | Glycine max (L.) Merr. | 0.592 | hairy root | CRISPR-Cas9 |
| PCdb_2442 | 36445461 | not found | not found | TGAACGACGCGTACAAGCTGAA | TGG | Oryza sativa L. | not found | protoplast | not found |
| PCdb_2443 | 29040704 | not found | not found | TCTTTTGGGTAGCTGCAGGT | TGG | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2444 | 26617267 | not found | not found | tcttttgggtagctgcagGT | TGG | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2445 | 37346168 | Solyc10g055410 | Tomato protein Solyc10g055410 (unknown function) | TCTTTTGGACTATAGAACTT | TGG | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2446 | 28502081 | T-EDR1 | Enhanced disease resistance 1 kinase | TCTTTATTATGACAACC | TGG | Triticum aestivum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2447 | 31694550 | PDS | Phytoene desaturase | TCTTGAAAATAAATCGCACC | TGG | Triticum aestivum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2448 | 36142495 | GmIPK1 | Glycine max inositol 1,3,4,5,6-pentakisphosphate 2-kinase 1 (phytic acid metabolism) [Source: SoyBase] | TCTTCAGACAAGGAAATAGT | TGG | Glycine max (L.) Merr. | 0.1-4.3% | seed | CRISPR-Cas9 |
| PCdb_2449 | 37346168 | Solyc03g112390 | Tomato protein Solyc03g112390 (uncharacterized) | TCTGCTTCACACTACAAGAA | TGG | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2450 | 33557889 | Gh_A11G2112 | Gh_A11G2112 (Gossypium hirsutum DREB transcription factor A11G2112) [Source: CottonGen] | TCTGAGGTAGGAGTAGGGGCC | TGG | Gossypium hirsutum L. | 0.5889 | seed | CRISPR-Cas9 |
| PCdb_2451 | 29036337 | CLE12 | CLE-Peptide-Encoding Genes | TCTCTACTCTCTAAACGCGG | TGG | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2452 | 33557889 | Gh_Sca070505G01 | Gh_Sca070505G01 (Gossypium hirsutum scaffold070505G01 uncharacterized gene) [Source: CottonGen] | TCTCGTTACCACCATAAACG | TGG | Gossypium hirsutum L. | 0.5889 | seed | CRISPR-Cas9 |
| PCdb_2453 | 38925598 | LOC_Os04g35490 | taste quality | TCTCGCCATGATGAACGTGG | TGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_2454 | 37111880 | PDS | Phytoene desaturase (PDS, carotenoid biosynthesis) | TCTCAAGTTGCCTTGAGATG | TGG | Populus 脳 generosa | not found | shoot | CRISPR-Cas9 |
| PCdb_2455 | 31694550 | PDS | Phytoene desaturase | TCTATCAACTGCAAAATACC | TGG | Triticum aestivum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2456 | 38925598 | LOC_Os05g26040 | taste quality | TCTACCCGAGTTAGGTCGGA | TGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_2457 | 25733849 | MPK5 | Mitogen-activated protein kinase 5 (stress signaling) [Source: TAIR] | TCTACATCGCCACGGAGCTCA | TGG | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2458 | 37346168 | Solyc01g102340 | Tomato protein Solyc01g102340 (uncharacterized) | TCGTTCTCTAGTTCGGAAAG | TGG | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2459 | 38925598 | LOC_Os03g58400 | taste quality | TCGTTCAGCAGCCTCAGAAG | TGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_2460 | 40578131 | SlWRKY75 | WRKY transcription factor regulating disease resistance, leaf senescence, and phosphate starvation responses in tomato. | TCGTCGTCGTCTCATCACGA | TGG | Solanum lycopersicum L. | not found | seed | CRISPR/Cas9 |
| PCdb_2461 | 30917862 | Glyma.19g164800 | Cinnamate 4-hydroxylase (Glyma.19g164800) [Source: SoyBase] | TCGGTGTTCAGCGGCGCTGT | TGG | Glycine max (L.) Merr. | not found | hairy root | CRISPR-Cas9 |
| PCdb_2462 | 30917862 | Glyma.13g123500 | Isoflavone reductase (Glyma.13g123500) [Source: SoyBase] | TCGGGCCTGCTTGGTCGCTG | TGG | Glycine max (L.) Merr. | not found | hairy root | CRISPR-Cas9 |
| PCdb_2463 | 35646007 | FtMYB45 | FtMYB45 (Fagopyrum tataricum R2R3-MYB transcription factor 45, flavonoid biosynthesis) [Source: UniProt] | TCGCGTTTTGCTGCAATAAC | TGG | Fagopyrum esculentum Moench | 0.5 | seed | CRISPR-Cas9 |
| PCdb_2464 | 38925598 | LOC_Os01g53550 | taste quality | TCGCCTCCCGTCCCTGACAT | TGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_2465 | 38925598 | LOC_Os12g27940 | taste quality | TCGATGCTTGATGGCCCGCA | TGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_2466 | 31694550 | PDS | Phytoene desaturase | TCGAAAATGGCATTCTTGGA | TGG | Triticum aestivum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2467 | 26842991 | FGS | FGS (Arabidopsis thaliana FATTY ACID ELONGASE77, very-long-chain fatty acid biosynthesis) [Source: TAIR] | TCCTTAATAAGTAACTTGGG | TGG | Zea mays L. | 0.0229 | protoplast | CRISPR-Cas9 |
| PCdb_2468 | 32632302 | not found | not found | TCCTCCTCATCAGTAATCCA | TGG | Oryza sativa L. | not found | protoplast | not found |
| PCdb_2469 | 32191373 | BnITPK | Inositol trisphosphate kinase | TCCGGTGATAGCTAAGCCCT | TGG | Brassica napus L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2470 | 26842992 | GRMZM2G342426 (Hsg11) | Maize genome reference GRMZM2G342426 (Heat shock protein gene Hsg11) [Source: MaizeGDB] | tccggtatggtttgaagctt | tgg | Zea mays L. | 19-31% | protoplast | CRISPR-Cas9 |
| PCdb_2471 | 33557889 | Gh_A11G3271 | Gh_A11G3271 (Gossypium hirsutum chitinase A11G3271) [Source: CottonGen] | TCCCTTGTATTGTACCCTGA | TGG | Gossypium hirsutum L. | 0.5889 | seed | CRISPR-Cas9 |
| PCdb_2472 | 36834483 | WRKY66 | Increase the Sensitivity to Salt Stress | TCCCAAGAAATTACCATGG | TGG | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2473 | 36834483 | CAT2 | Increase the Sensitivity to Salt Stress | TCCCAAGAAATTACCATGG | TGG | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2474 | 36834483 | AT5G40153 | Increase the Sensitivity to Salt Stress | TCCCAAGAAATTACCA | TGG | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2475 | 38925598 | LOC_Os02g56720 | taste quality | TCCATTTCCAACGACAACAA | TGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_2476 | 27579989 | DM2c promoter to exon 1 | DM2 gene (c variant) promoter through exon 1 sequence | TCCATTAGAATGGTGAAGGA | TGG | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2477 | 38925598 | LOC_Os11g27470 | taste quality | TCCACTGTGTCCTACCAGGG | TGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_2478 | 38925598 | LOC_Os04g41980 | taste quality | TCCACTACCAGCAATCCATT | TGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_2479 | 30819931 | ACC | Acetyl-CoA carboxylase, rate-limiting enzyme in fatty acid synthesis | TCCACAGCTATCACACCCAC | TGG | Oryza sativa L. | 0.6 | calli | CBE |
| PCdb_2480 | 38925598 | LOC_Os10g29549 | taste quality | TCCAACACACGACTAAACAC | TGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_2481 | 38925598 | LOC_Os03g01910 | taste quality | TCCAACAATCATCAACCAGT | TGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_2482 | 33557889 | Gh_A05G0975 | Gh_A05G0975 (Gossypium hirsutum sucrose-phosphate synthase, carbohydrate metabolism) [Source: CottonGen] | TCATCCGGTCCACAATCTGG | TGG | Gossypium hirsutum L. | 0.5889 | seed | CRISPR-Cas9 |
| PCdb_2483 | 30291759 | ARC | NB-ARC domain disease resistance protein | TCATAATCCTCGATGATTTG | TGG | Gossypium hirsutum L. | 0.701 | leaf | CRISPR-Cas9 |
| PCdb_2484 | 30291759 | ARC | NB-ARC domain disease resistance protein | TCATAATCCTCGATGATTTG | TGG | Gossypium hirsutum L. | 0.701 | leaf | CRISPR-Cas9 |
| PCdb_2485 | 37299168 | LOC 0s09g15240 | Transcriptional activator protein (Os09g15240 locus) [Source: RAP-DB] | TCAGGAGAGCTAGTCATTTT | TGG | Oryza sativa L. | not found | protoplast | not found |
| PCdb_2486 | 27579989 | NbPAD4 (exon 34) | Phytoalexin-deficient 4 exon 34 fragment (salicylic acid signaling) [Source: SolGenomics] | TCAGCTATTCCGCGTTGTGT | TGG | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2487 | 37346168 | Solyc01g009070 | Tomato protein Solyc01g009070 (uncharacterized) | TCACCAGATGAAGCTAGCGG | TGG | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2488 | 30959555 | not found | not found | TCACCACCACATTGGTCCAA | TGG | Oryza sativa L. | 0.73 | calli | ABE |
| PCdb_2489 | 31452351 | Glyma.08G183500 Glyma.15G049200 | ERF transcription factor (Glyma.08G183500 & Glyma.15G049200) [Source: SoyBase] | TCACACTGAATGCCATAACG | TGG | Glycine max (L.) Merr. | 0.592 | hairy root | CRISPR-Cas9 |
| PCdb_2490 | 36679080 | BnCYP704B1 | Confers Male Sterility in Rapeseed | TCAATTCAGATGGAGAGCTC | TGG | Brassica napus L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2491 | 33925088 | MIR172d | Required for Floral Organ Identity and Number in Tomato | TCAAGTCAATTTTTTGCGGG | TGG | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2492 | 33557889 | Gh_A02G1276 | Gh_A02G1276 (Gossypium hirsutum cytochrome P450 CYP82D, secondary metabolism) [Source: CottonGen] | TCAAGGAAGCGACAGCTTGG | TGG | Gossypium hirsutum L. | 0.5889 | seed | CRISPR-Cas9 |
| PCdb_2493 | 31694550 | PDS | Phytoene desaturase | TCAAAACGGCTGTATTCTCC | TGG | Triticum aestivum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2494 | 26842991 | FGS | FGS (Arabidopsis thaliana FATTY ACID ELONGASE76, very-long-chain fatty acid biosynthesis) [Source: TAIR] | TATTTCCTTAATAAGTAACT | TGG | Zea mays L. | 0.0409 | protoplast | CRISPR-Cas9 |
| PCdb_2495 | 32785241 | OsBADH2 | Betaine aldehyde dehydrogenase, key enzyme for 2-acetyl-1-pyrroline synthesis (fragrant rice compound) [Source: Gramene] | TATGGCTTCAGCTGCTCCTA | TGG | Oryza sativa L. | 56.6-96.8% | maturing panicles | not found |
| PCdb_2496 | 36466231 | GhMAPKKK2 & GhCLA1 & GhPDS | GhMAPKKK2, GhCLA1 & GhPDS (Gossypium hirsutum MAP kinase kinase kinase 2, cloroplastos alterados 1, and phytoene desaturase) [Source: CottonGen] | TATGCTCGTGGAATGATCAG | TGG | Gossypium hirsutum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2497 | 28824692 | GhCLA1 | Phytoene desaturase | TATGCTCGCGAATGATCAG | TGG | Gossypium hirsutum L. | 0.64 | cotyledon | CRISPR-Cas9 |
| PCdb_2498 | 33557889 | Gh_A13G1012 | Gh_A13G1012 (Gossypium hirsutum heat shock protein A13G1012) [Source: CottonGen] | TATGCGGCAATGGTACCAAC | TGG | Gossypium hirsutum L. | 0.5889 | seed | CRISPR-Cas9 |
| PCdb_2499 | 33557889 | Gh_A09G1085 | Gh_A09G1085 (Gossypium hirsutum pectin methylesterase A09G1085) [Source: CottonGen] | TATGCGGCAATGGTACCAAC | TGG | Gossypium hirsutum L. | 0.5889 | seed | CRISPR-Cas9 |
| PCdb_2500 | 35262369 | HaABCC 2 | HaABCC2 (ATP-binding cassette transporter subfamily C member 2) [Source: NCBI] | TATGCCGCGTGTGTGCGC | TGG | Gossypium hirsutum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2501 | 33557889 | Gh_A02G1275 | Gh_A02G1275 (Gossypium hirsutum UDP-glucosyltransferase UGT73C5, flavonoid modification) [Source: CottonGen] | TATCTCAGTCTGAATAGTGG | TGG | Gossypium hirsutum L. | 0.5889 | seed | CRISPR-Cas9 |
| PCdb_2502 | 27579989 | NbPAD4 | Phytoalexin deficient 4 lipase homolog | TATAGAGATTAGAAGCTTCA | TGG | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2503 | 31694550 | PDS | Phytoene desaturase | TAGTTAATCGTGTTCTCTAG | TGG | Triticum aestivum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2504 | 30819931 | CDC48 | AAA-type ATPase involved in protein degradation and ER-associated degradation | TAGCACCCATGACAATGACA | TGG | Oryza sativa L. | 0.308 | calli | CBE |
| PCdb_2505 | 29807545 | GFP | GFP (Green Fluorescent Protein, Aequorea victoria, transformation control) [Source: Addgene] | TAGCACCCATGACAATGACA | TGG | Oryza sativa L. | 0.0311 | protoplast | ABE |
| PCdb_2506 | 31634585 | CDC48 | AAA-type ATPase involved in protein degradation | TAGCACCCATGACAATGACA | TGG | Oryza sativa L. | 0.85 | calli | ABE |
| PCdb_2507 | 26842991 | FGS | FGS (Arabidopsis thaliana FATTY ACID ELONGASE74, very-long-chain fatty acid biosynthesis) [Source: TAIR] | TAGAGCTTAGTTGGCCATGG | TGG | Zea mays L. | 0.0279 | protoplast | CRISPR-Cas9 |
| PCdb_2508 | 31125376 | not found | not found | TACTATAACTGTCGATCCGG | tgg | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2509 | 29807545 | GFP | GFP (Green Fluorescent Protein, Aequorea victoria, transformation control) [Source: Addgene] | TACTAGTCACACTTGCACTG | TGG | Oryza sativa L. | 0.005 | protoplast | ABE |
| PCdb_2510 | 30214055 | GBSS | GBSS (Granule-bound starch synthase, EC 2.4.1.242, amylose biosynthesis) [Source: UniProt] | TACTAAGGTAACACCCAAGA | TGG | Solanum tuberosum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2511 | 31452351 | Glyma.15G049300 Glyma.08G183400 | WRKY transcription factor (Glyma.15G049300 & Glyma.08G183400) [Source: SoyBase] | TACGGCTTATTAGGAACCAG | TGG | Glycine max (L.) Merr. | 0.592 | hairy root | CRISPR-Cas9 |
| PCdb_2512 | 26842991 | FGS | FGS (Arabidopsis thaliana FATTY ACID ELONGASE75, very-long-chain fatty acid biosynthesis) [Source: TAIR] | TAATATGCAATCTGCTAGCA | TGG | Zea mays L. | 0.51 | protoplast | CRISPR-Cas9 |
| PCdb_2513 | 36726806 | not found | not found | TAAGTATGTGGCGGCGGTGA | TGG | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2514 | 30959555 | not found | not found | TAAGATATCAGTTTCATGCA | TGG | Oryza sativa L. | 0.802 | calli | ABE |
| PCdb_2515 | 31694550 | PDS | Phytoene desaturase | TAAGAATCTTTGCTTTACTC | TGG | Triticum aestivum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2516 | 27579989 | DM2Ler left | DM2 gene left flanking region in Arabidopsis Landsberg erecta ecotype | TAACCGTCGGCTCGGGTCCT | TGG | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2517 | 30275376 | GhALARP | Cotton ALOG-domain protein (plant architecture regulation) | GTTTGTTGTGTCCGGGACCA | tgg | Gossypium hirsutum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2518 | 31694550 | PDS | Phytoene desaturase | GTTTGGCATGGCAAATATCA | TGG | Triticum aestivum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2519 | 37608233 | DFR | Dihydroflavonol 4-reductase | GTTTGCGTCACAGGAGCAGC | TGG | Solanum lycopersicum L. | not found | not found | CRISPR-Cas9 |
| PCdb_2520 | 31694550 | PDS | Phytoene desaturase | GTTTATGAAATTCAGTGCCT | TGG | Triticum aestivum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2521 | 30287957 | CRTL-B | Lycopene cyclase, converts lycopene to -carotene | GTTGTGGATCTTGCTGTGGT | TGG | Physalis pruinosa L. | not found | leaf | CRISPR-Cas9 |
| PCdb_2522 | 26284791 | GmFEI2 | Leucine-rich repeat receptor-like kinase FEI2 (cell wall integrity) | GTTGGACCTATACCTGCTGA | TGG | Glycine max (L.) Merr. | 0.933 | hairy root | CRISPR-Cas9 |
| PCdb_2523 | 38925598 | LOC_Os02g12840 | taste quality | GTTGCTGGCGCACAACTATT | TGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_2524 | 25225186 | ARGONAUTE7 | Argonaute 7 | GTTGCTCAGCCACTTCCCTC | TGG | Solanum lycopersicum L. | 0.48 | seed | CRISPR-Cas9 |
| PCdb_2525 | 31991936 | FWL | FWL (FW2-2-like cell number regulator, plasma membrane-associated) [Source: UniProt] | GTTGAGGTGCCATCCGAGCT | TGG | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2526 | 29735370 | St16DOX | Potato 16伪-hydroxylase (St16DOX, steroidal glycoalkaloid biosynthesis) | GTTGAAGGATGACAAATGGATTGG | TGG | Solanum tuberosum L. | not found | hairy root | CRISPR-Cas9 |
| PCdb_2527 | 36643290 | GhPDS | GhPDS (Gossypium hirsutum phytoene desaturase) [Source: CottonGen] | GTTCTACCTGCACCATTAAA | TGG | Gossypium hirsutum L. | 0.3 | hairy root | CRISPR-Cas9 |
| PCdb_2528 | 27579989 | NbPAD4 (exon 2) | Phytoalexin-deficient 4 exon 2 fragment (salicylic acid signaling) [Source: SolGenomics] | GTTCGAGTCGAGCGAAACGT | TGG | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2529 | 36840200 | ASR1 | Abscisic acid stress ripening protein 1, involved in stress responses | GTTCCCTATCCAACGATCT | TGG | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2530 | 31694550 | PDS | Phytoene desaturase | GTTCATAGATGATAGGCAGC | TGG | Triticum aestivum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2531 | 37346168 | Solyc06g065100 | Tomato protein Solyc06g065100 (uncharacterized) | GTTATAGCCGGAAGATTACC | TGG | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2532 | 27579989 | DM2Ler right | DM2 gene right flanking region in Arabidopsis Landsberg erecta ecotype | GTTAGGTCCTACGCAGTAAC | TGG | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2533 | 26842991 | FGS | FGS (Arabidopsis thaliana FATTY ACID ELONGASE64, very-long-chain fatty acid biosynthesis) [Source: TAIR] | GTTAGGGTTCCCCGTAGCCA | TGG | Zea mays L. | 0.2094 | protoplast | CRISPR-Cas9 |
| PCdb_2534 | 35067308 | OsLHY | regulating flowering | GTTACTGGCTTTCAAGCCAC | TGG | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2535 | 27442592 | LOC541664 | improve maize grain yield under field drought stress conditions | GTTACT TCTCTAAGCA CGGC | TGG | Zea mays L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2536 | 31694550 | PDS | Phytoene desaturase | GTGTTCTCTAGTGGAGGCCT | TGG | Triticum aestivum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2537 | 36009753 | C4H | Cinnamate 4-hydroxylase, key enzyme in phenylpropanoid pathway for lignin/flavonoid biosynthesis | GTGTGGAGAAAAGAAACTTGGGAGT | TGG | Nicotiana tabacum L. | not found | protoplast | not found |
| PCdb_2538 | 36009753 | C4H | Cinnamate 4-hydroxylase, key enzyme in phenylpropanoid pathway for lignin/flavonoid biosynthesis | GTGTGCGTTAATATTAACGGAGAGT | TGG | Nicotiana tabacum L. | not found | protoplast | not found |
| PCdb_2539 | 26842991 | FGS | FGS (Arabidopsis thaliana FATTY ACID ELONGASE34, very-long-chain fatty acid biosynthesis) [Source: TAIR] | GTGTGCGAGTTGGAGAAACA | TGG | Zea mays L. | 0.2462 | protoplast | CRISPR-Cas9 |
| PCdb_2540 | 25879861 | 07g14530 | Uncharacterized gene 07g14530 (predicted function varies by species) | GTGTGAATGTTTATTGTGGT | TGG | Glycine max (L.) Merr. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2541 | 31452351 | Glyma.18G267000 | Gibberellin 20-oxidase (Glyma.18G267000) [Source: SoyBase] | GTGTCAAGGAATACGCTCGG | TGG | Glycine max (L.) Merr. | 0.592 | hairy root | CRISPR-Cas9 |
| PCdb_2542 | 34899806 | GmAITR2 | Enhanced Salinity Stress Tolerance | GTGGTGTTCGT GTGTGACGG | TGG | Glycine max (L.) Merr. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2543 | 30406958 | regA | RegA translational repressor protein (viral gene expression regulation) | GTGGCTGCGTACCCCCGCAG | TGG | Volvox carteri F.Stein | not found | protoplast | CRISPR-Cas9 |
| PCdb_2544 | 31694550 | PDS | Phytoene desaturase | GTGGAGGCCTTGGAAAATCT | TGG | Triticum aestivum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2545 | 36457532 | not found | not found | GTGGAAAAGACAGAACCCGATGG | TGG | Glycine max (L.) Merr. | 0.592 | hairy root | CRISPR-Cas9 |
| PCdb_2546 | 34347875 | not found | Gene not detected or not annotated in the database | GTGCGACTCTACATGAATTC | TGG | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2547 | 26842991 | FGS | FGS (Arabidopsis thaliana FATTY ACID ELONGASE73, very-long-chain fatty acid biosynthesis) [Source: TAIR] | GTGCATCATGCGCACCAACA | TGG | Zea mays L. | 0.3809 | protoplast | CRISPR-Cas9 |
| PCdb_2548 | 33396568 | CRTISO | Induced Somatic Recombination | GTGCAAGAATACCACAGTAC | tgg | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2549 | 32117361 | WRKY9b | WRKY transcription factor 9b (WRKY9b, defense response) | GTGATTTCTCTTGGCCTCTT | TGG | Lysimachia mexicana R.Knuth | not found | kinetoplastids | CRISPR-Cas9,Base editor |
| PCdb_2550 | 30459263 | PG2a | Polygalacturonase 2a | GTGATTAATGTACTTAGCTT | TGG | Solanum lycopersicum L. | not found | Plantlets | CRISPR-Cas9 |
| PCdb_2551 | 38925598 | LOC_Os02g12310 | taste quality | GTGATGTCGGGAGTAACGCA | TGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_2552 | 38925598 | LOC_Os04g35010 | taste quality | GTGACAACGGCGGTGTGATA | TGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_2553 | 31694550 | PDS | Phytoene desaturase | GTGAATTTTGCAGGACTGGC | TGG | Triticum aestivum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2554 | 28499063 | GhCLA1 | GhCLA1 (Gossypium hirsutum 1-deoxy-D-xylulose 5-phosphate synthase, chloroplast development) [Source: CottonGen] | GTGAAGTTCGATCCGGCAAC | TGG | Gossypium hirsutum L. | 1 | hypocotyl | CRISPR-Cas9 |
| PCdb_2555 | 29569825 | zyp1 | Zipper protein 1 (synaptonemal complex component) | GTGAAGACTGATCTAGAAA | TGG | Zea mays L. | 0.66 | calli | CRISPR-Cas9 |
| PCdb_2556 | 36457532 | not found | not found | GTGAAATTAACCAGCTGCAG | TGG | Glycine max (L.) Merr. | 0.592 | hairy root | CRISPR-Cas9 |
| PCdb_2557 | 26022141 | Glyma06g14180 | Unknown protein | GTGAAATTAACCAGCTGCAG | TGG | Glycine max (L.) Merr. | 0.592 | hairy root | CRISPR-Cas9 |
| PCdb_2558 | 26842991 | FGS | FGS (Arabidopsis thaliana FATTY ACID ELONGASE42, very-long-chain fatty acid biosynthesis) [Source: TAIR] | GTCTTGTTGGAGAGTGGTCA | TGG | Zea mays L. | 0.1122 | protoplast | CRISPR-Cas9 |
| PCdb_2559 | 35903231 | CPR5 | Constitutive Pathogen Response 5, regulates plant immunity and stress responses | GTCTCCCAGTCATCTTTCGA | TGG | Glycine max (L.) Merr. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2560 | 28256588 | GhMYB25 | GhMYB25 (Gossypium hirsutum MYB transcription factor for fiber development) [Source: CottonGen] | GTCTCCATGTAGCGACAAGG | TGG | Gossypium hirsutum L. | 1 | protoplast | CRISPR-Cas9 |
| PCdb_2561 | 27118985 | AGAMOUS | MADS-box transcription factor AGAMOUS | GTCTCACACTATCTATT | TGG | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2562 | 40601421 | SlPRR1 | Pseudo-response regulator 1 controlling circadian clock and photoperiodic flowering in tomato. | GTCGTTAAGTGCCTCAAATT | TGG | Solanum lycopersicum L. | not found | protoplast | CRISPR/Cas9 |
| PCdb_2563 | 30144341 | SlARF10A | critical for auxin-mediated compound leaf and flower development | GTCGTGTACACGTATATGCC | TGG | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2564 | 30144341 | ARF16 | critical for auxin-mediated compound leaf and flower development | GTCGTGTACACGTATATGCC | TGG | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2565 | 33557889 | Gh_A08G1108 | Gh_A08G1108 (Gossypium hirsutum xyloglucan endotransglucosylase/hydrolase A08G1108) [Source: CottonGen] | GTCGTCAGCTCCTTTCTCCG | TGG | Gossypium hirsutum L. | 0.5889 | seed | CRISPR-Cas9 |
| PCdb_2566 | 28487703 | ENGase | Endoacetylglucosaminidase (ENGase): key regulator of cell differentiation | GTCGGTGATGGGGTAGGAGA | TGG | Hordeum vulgare L. | 0.489 | Immature embryos | CRISPR-Cas9 |
| PCdb_2567 | 30715580 | WaxyGBSSI | induce allele-specific and zygosity-dependent feedback effects on endosperm starch biosynthesis | GTCGGCGATGCCGAAGCCGG | TGG | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2568 | 32854250 | OsBHY, OsEHY, OsWaxy | Rice beta-hydroxyacyl-ACP dehydratase, enoyl-ACP reductase, and granule-bound starch synthase (three enzymes involved in fatty acid and starch biosynthesis) | GTCGGAGCGGCGCACGTACC | TGG | Oryza sativa L. | 1 | protoplast | CRISPR-Cas9 |
| PCdb_2569 | 30406958 | glsA | Glutamate synthase (nitrogen assimilation) [Source: TAIR] | GTCGCCGGGCCAGTTCCATA | TGG | Volvox carteri F.Stein | <0.01% | protoplast | CRISPR-Cas9 |
| PCdb_2570 | 38925598 | LOC_Os04g44470 | taste quality | GTCGCCGACATGCCACTCGG | TGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_2571 | 39985809 | SlSWEET12c | SWEET family sucrose transporter mediating phloem loading and sugar allocation during tomato fruit development. | GTCCTACGCGTACAAGTTGT | TGG | Solanum lycopersicum L. | not found | root | CRISPR/Cas9 |
| PCdb_2572 | 36338470 | BGLU25 | Beta-glucosidase 25 | GTCCGCTAAGAATCTGCTTC | TGG | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2573 | 37598130 | AUX1, PIN3, and TAA1 | maintain fertility in Arabidopsis | GTCCGATTTCGTGGTCAATC | TGG | Arabidopsis thaliana (L.) Heynh. | not found | not found | CRISPR-Cas9 |
| PCdb_2574 | 27862889 | FAD2 | Fatty acid desaturase 2 | GTCCAGTTTGTCCTCGGG | TGG | Arabidopsis thaliana (L.) Heynh. | 0.716 | seed | CRISPR-Cas9 |
| PCdb_2575 | 27862889 | FAD2 | Fatty acid desaturase 2 | GTCCAGTTTGTCCTCGGG | TGG | Arabidopsis thaliana (L.) Heynh. | 0.716 | seed | CRISPR-Cas9 |
| PCdb_2576 | 31548867 | BnLPAT2 | Lysophosphatidic acid acyltransferase 2 | GTCATAGGCTGGTCAATG | TGG | Brassica napus L. | not found | seed | CRISPR-Cas9 |
| PCdb_2577 | 33346897 | Pp3c16_20280V1.1 (PHY2) | Physcomitrella phytochrome 2 (Pp3c16_20280V1.1, light sensing) | GTCAAAGCATAGTGTCCGGG | TGG | Physcomitrella patens (Hedw.) Bruch & Schimp. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2578 | 31694550 | PDS | Phytoene desaturase | GTATTAGTGATCGCTTGCAA | TGG | Triticum aestivum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2579 | 32595669 | PPR756 | loss of function of which could influence the activities of the mitochondrial electron transport chain complexes and result in dysfunctional pollen. | GTATCCTGCTACGTGCGGGC | TGG | Oryza sativa L. | not found | Mitochondrion | not found |
| PCdb_2580 | 27579989 | AtEDS1 (Col) left | Enhanced disease susceptibility 1 protein (Col-0 ecotype), left genomic position | GTATCCACGTGAGCGTATGA | TGG | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2581 | 28696528 | not found | not found | GTATCAGATCGTCTCAACAC | TGG | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2582 | 34347875 | not found | Gene not detected or not annotated in the database | GTAGTGCCTCAGTCAAGCTT | TGG | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2583 | 26842991 | FGS | FGS (Arabidopsis thaliana FATTY ACID ELONGASE38, very-long-chain fatty acid biosynthesis) [Source: TAIR] | GTAGGCTCTTGCTGTCTAGT | TGG | Zea mays L. | 0.0637 | protoplast | CRISPR-Cas9 |
| PCdb_2584 | 38925598 | LOC_Os04g22240 | taste quality | GTAGCACCTGTGCTACGCCA | TGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_2585 | 33557889 | Gh_A06G2107 | Gh_A06G2107 (Gossypium hirsutum expansin-like protein, cell wall modification) [Source: CottonGen] | GTAGCAATGCCCTATACTGG | TGG | Gossypium hirsutum L. | 0.5889 | seed | CRISPR-Cas9 |
| PCdb_2586 | 31998338 | StPPO2 | Potato polyphenol oxidase 2 (StPPO2, enzymatic browning) | GTACTTCCACGAGAGAATCG | TGG | Solanum tuberosum L. | 0.68 | potato protoplasts | not found |
| PCdb_2587 | 31694550 | PDS | Phytoene desaturase | GTAAATGTGTAGGAGAAGCA | TGG | Triticum aestivum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2588 | 33557889 | Gh_A09G1085 | Gh_A09G1085 (Gossypium hirsutum pectin methylesterase A09G1085) [Source: CottonGen] | GTAAACACCTTGATCCACGT | TGG | Gossypium hirsutum L. | 0.5889 | seed | CRISPR-Cas9 |
| PCdb_2589 | 37346168 | Solyc01g111500 | Tomato protein Solyc01g111500 (uncharacterized) | GTAAAAGTTGCCGTCTCCGA | TGG | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2590 | 37346168 | Solyc01g009070 | Tomato protein Solyc01g009070 (uncharacterized) | GTAAAAGTTGCCGCTTGCGG | TGG | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2591 | 32213123 | CVIF1 | response and salt tolerance in Arabidopsis | GGTTCCTGCCGACACTTC | TGG | Arabidopsis thaliana (L.) Heynh. | not found | seed | CRISPR-Cas9 |
| PCdb_2592 | 31694550 | PDS | Phytoene desaturase | GGTTAGTTGATTTAAATGTT | TGG | Triticum aestivum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2593 | 38925598 | LOC_Os09g24290 | taste quality | GGTGGTGAGCGCTAGCACGA | TGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_2594 | 38925598 | LOC_Os02g47950 | taste quality | GGTGGCCATGGACTGCCTGG | TGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_2595 | 37346168 | Solyc02g092930 | Tomato protein Solyc02g092930 (uncharacterized) | GGTGGAGGAATCTGCATCGG | TGG | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2596 | 29872452 | not found | not found | GGTGGACTTCTTGCTAGGTA | TGG | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2597 | 29036337 | CLE4 | CLE-Peptide-Encoding Genes | GGTGCATCAATGCCGACCAC | TGG | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2598 | 29036337 | CLE3 | CLE-Peptide-Encoding Genes | GGTGCACGAATGTCGACCAT | TGG | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2599 | 30287957 | CLV1 | CLAVATA1, receptor kinase regulating shoot meristem development | GGTGAAATTCCTCCAAGTCT | TGG | Physalis pruinosa L. | not found | leaf | CRISPR-Cas9 |
| PCdb_2600 | 38925598 | LOC_Os03g62590 | taste quality | GGTCGTCAAGACGCTCACCG | TGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_2601 | 37188058 | not found | not found | GGTCGAGGACAAGGCCGTGG | TGG | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2602 | 31776399 | BSrI | Restriction endonuclease from Bacillus stearothermophilus (recognizes specific DNA sequences) | GGTCCTTGGAGCAAAAC | TGG | Solanum tuberosum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2603 | 39831348 | Brachytic2 | ABC transporter affecting auxin transport and internode elongation; loss-of-function results in reduced plant height in maize. | GGTCATCGACGACGGCAAGG | TGG | Zea mays L. | 0.49-1.12% | protoplast | CRISPR/Cas9 |
| PCdb_2604 | 33324433 | TaPDS | Phytoene desaturase | GGTCAACGGCGAGGCGCGC | TGG | Triticum aestivum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2605 | 36499273 | BnaCOL9 | Advances the Flowering Time | GGTATGGATGAAGTTGACT | TGG | Brassica napus L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2606 | 31452351 | Glyma.15G049900 Glyma.08G182500 | NAC domain transcription factor (Glyma.15G049900 & Glyma.08G182500) [Source: SoyBase] | GGTACATTAATTGGAATTGG | TGG | Glycine max (L.) Merr. | 0.592 | hairy root | CRISPR-Cas9 |
| PCdb_2607 | 35171288 | SlDML 2 | promote tomato fruit ripening | GGTACACTACCACCAGCGCA | TGG | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2608 | 31694550 | PDS | Phytoene desaturase | GGTAAGGTTATACATAGTCC | TGG | Triticum aestivum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2609 | 30317650 | SAUL1 | Plant U-box ubiquitin ligase SAUL1 | GGGTGTTTTGTGAGGAAGAC | TGG | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2610 | 29884615 | PYRABACTIN RESISTANCE1-LIKE (PYL) | PYRABACTIN RESISTANCE1-LIKE ABA receptor (PYL, abscisic acid signaling) | GGGTCATCGTTGCTTCTCAG | TGG | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2611 | 31694550 | PDS | Phytoene desaturase | GGGCTTCTACCAGCAATGCT | TGG | Triticum aestivum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2612 | 29157799 | SlMYB12 | R2R3-MYB transcription factor SlMYB12 | GGGCATCAAGAGAGGCAGA | TGG | Solanum lycopersicum L. | 88.9-100% | red-fruited materials | CRISPR-Cas9 |
| PCdb_2613 | 28258551 | GFP | GFP (Green Fluorescent Protein, Aequorea victoria, transformation control) [Source: Addgene] | GGGCACAAATTTTCTGTCAG | TGG | Gossypium hirsutum L. | 0.06 | seed | CRISPR-Cas9 |
| PCdb_2614 | 39172289 | OsIPK1 | Regulates grain phosphorus (Pi) homeostasis and starch synthesis; aimed at low phytic acid content while preserving starch accumulation. | gggcaagatcccaggattgt | TGG | Oryza sativa L. | 0.192 | callus | CRISPR/Cas9 |
| PCdb_2615 | 35026009 | FLOWERING LOCUS T | floral induction and endodormancy release | GGGCAAAGAGAAGTGAGCAA | TGG | Gentiana triflora Pall. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2616 | 36430644 | Sp126 | Spinach protein Sp126 (chloroplast-associated, unknown function) | GGGATTAGCAGACATGTTGG | TGG | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2617 | 31634585 | WRKY45 | WRKY transcription factor involved in disease resistance | GGGAGGACGTGACATCGCCC | TGG | Oryza sativa L. | 0.51 | calli | ABE |
| PCdb_2618 | 28790350 | BnaA2.DA2 | E3 ubiquitin ligase DA2 homolog | GGGAGCTAAGTACGTAGACT | TGG | Brassica napus L. | 0.439 | protoplast | CRISPR-Cas9 |
| PCdb_2619 | 29884615 | PYRABACTIN RESISTANCE1-LIKE (PYL) | PYRABACTIN RESISTANCE1-LIKE ABA receptor (PYL, abscisic acid signaling) | GGGACTGTTAAGTGCAAGCT | TGG | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2620 | 30845784 | ClPDS | Phytoene desaturase, involved in carotenoid biosynthesis (converts phytoene to 味-carotene) | GGGAACAATGAAATGCTGACG | TGG | Cichorium intybus L. | 0.045 | protoplast | CRISPR-Cas9 |
| PCdb_2621 | 38925598 | LOC_Os10g30944 | taste quality | GGCTTCAGCGACAAGCCCCA | TGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_2622 | 34396631 | EXO70B1 | Exocyst subunit EXO70B1 | GGCTCGACGTTGTAAAAGAT | TGG | Arabidopsis thaliana (L.) Heynh. | not found | leaf | CRISPR-Cas9 |
| PCdb_2623 | 35262369 | HaABCC 2 | HaABCC2 (ATP-binding cassette transporter subfamily C member 2) [Source: NCBI] | GGCTACTCTGCCATACAATT | TGG | Gossypium hirsutum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2624 | 31656725 | OsGA20ox2 | Gibberellin 20-oxidase 2 regulating plant height | GGCGGTGTGOGACCTGAGA | TGG | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2625 | 38925598 | LOC_Os04g46200 | taste quality | GGCGGCGGCTACGGTGACCG | TGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_2626 | 40578131 | SlWRKY75 | WRKY transcription factor regulating disease resistance, leaf senescence, and phosphate starvation responses in tomato. | GGCCGGTTTCTTGGGACTAA | TGG | Solanum lycopersicum L. | not found | seed | CRISPR/Cas9 |
| PCdb_2627 | 38925598 | LOC_Os09g36470 | taste quality | GGCCGCTACCGCTTTGGCTA | TGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_2628 | 39172289 | OsIPK1 | Regulates grain phosphorus (Pi) homeostasis and starch synthesis; aimed at low phytic acid content while preserving starch accumulation. | ggccataggacatgcatccc | TGG | Oryza sativa L. | 0.192 | callus | CRISPR/Cas9 |
| PCdb_2629 | 30459263 | TBG4 | galactosidase TBG4 | GGCCATACAATCTGCCCCA | TGG | Solanum lycopersicum L. | not found | Plantlets | CRISPR-Cas9 |
| PCdb_2630 | 38925598 | LOC_Os03g07226 | taste quality | GGCCAGCGATAAGCTCACCG | TGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_2631 | 25879861 | Met1-04g | DNA (cytosine-5)-methyltransferase | GGCATGGTGCGGTCTATGAG | TGG | Glycine max (L.) Merr. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2632 | 28128458 | NtPIN4 | a key regulator of axillary bud growth | ggcatatggttctgtccgatgg | tgg | Nicotiana tabacum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2633 | 30729010 | BoSRK3 | S-receptor kinase 3, involved in self-incompatibility response in Brassica oleracea | GGCAATAATCTTGTCCTCCT | TGG | Brassica oleracea var. capitata L. | 1 | hypocotyl | CRISPR-Cas9 |
| PCdb_2634 | 34042262 | OsEPSPS | 5-Enolpyruvylshikimate-3-phosphate synthase | GGATGTCGACTGTTTCCT | TGG | Oryza sativa L. | 0.02 | protoplast | CBE |
| PCdb_2635 | 34899806 | GmAITR2 | Enhanced Salinity Stress Tolerance | GGATGCACCGGGTACATACC | TGG | Glycine max (L.) Merr. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2636 | 29797460 | PROCERA | DELLA protein PROCERA | GGATGAGCTTTTAGCTGTTT | TGG | Solanum lycopersicum L. | not found | root | CRISPR-Cas9 |
| PCdb_2637 | 29331077 | AcPDS | Phytoene desaturase | GGAGTCTGATACTGGCTTAGTGG | TGG | Actinidia chinensis Planch. | not found | leaf | CRISPR-Cas9 |
| PCdb_2638 | 32859078 | AtGPRP3 | Regulates Plant Growth in Arabidopsis | GGAGGATACCCTTGTTGTGG | TGG | Arabidopsis thaliana (L.) Heynh. | not found | Cell Nucleus | CRISPR-Cas9 |
| PCdb_2639 | 33759354 | LHCF | LHCF (light-harvesting complex protein in photosynthetic organisms) | GGAGACGGTCGAACTTCTCC | TGG | Phaeodactylum tricornutum Bohlin | 50-70% | protoplast | CRISPR-Cas9 |
| PCdb_2640 | 35143673 | not found | not found | GGAGACAGGGTTGGAACACT | TGG | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2641 | 31694550 | PDS | Phytoene desaturase | GGAGAAGCATGGCTCGAAAA | TGG | Triticum aestivum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2642 | 27097775 | SlPDS | Phytoene desaturase | GGACTCTTGCCAGCAATGCTTGG | TGG | Solanum lycopersicum L. | 1 | seed | CRISPR-Cas9 |
| PCdb_2643 | 32398038 | PDS | PHYTOENE DESATURASE | GGACTCTTGCCAGCAATGCT | TGG | Solanum tuberosum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2644 | 28640983 | slyPDS | Phytoene desaturase (tomato) | GGACTCTTGCCAGCAATGCT | TGG | Solanum lycopersicum L. | 0.61 | leaf | CRISPR-Cas9 |
| PCdb_2645 | 38984692 | PDS | Phytoene desaturase catalyzing the conversion of phytoene to 味-carotene in carotenoid biosynthesis; essential for chlorophyll and carotenoid formation and photoprotection. | GGACTCTTGCCAGCAATGCT | TGG | Capsicum annuum var. glabriusculum (Dunal) Heiser & Pickersgill | 60-80% | leaf | CRISPR/Cas9 |
| PCdb_2646 | 27226176 | GL1 | R2R3-MYB transcription factor GL1 | GGACTATGTTCTTAATCA | TGG | Arabidopsis thaliana (L.) Heynh. | 1 | mature leaves | CRISPR-Cas9 |
| PCdb_2647 | 31101972 | StGBSSI | Potato granule-bound starch synthase I (StGBSSI, amylose synthesis) | GGACTAGGTGATGTTCTTGG | TGG | Solanum tuberosum L. | 8.6%|8.6% | leaf | CBE |
| PCdb_2648 | 27579989 | DM2c exon 2 | DM2 gene (c variant) exon 2 sequence | GGACAAAAGCACCCAAATGA | TGG | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2649 | 31694550 | PDS | Phytoene desaturase | GGAAGGATGAAGATGGTGAT | TGG | Triticum aestivum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2650 | 34681568 | PDS | Phytoene desaturase (PDS, carotenoid biosynthesis) | GGAAGGATGAAGATGGAGAT | TGG | Oryza sativa L. | not found | protoplast | not found |
| PCdb_2651 | 26294043 | ALS | Acetolactate synthase (branched-chain amino acid biosynthesis) | GGAACTGACACACGACATGA | TGG | Glycine max (L.) Merr. | 0.593 | protoplast | CRISPR-Cas9 |
| PCdb_2652 | 26408904 | RIN | Ripening inhibitor (RIN) transcription factor | GGAACAGCTTGAACGTCAAT | TGG | Solanum lycopersicum L. | 0-100% | fruit | CRISPR-Cas9 |
| PCdb_2653 | 32117361 | PGA1-like | Gibberellin receptor PGA1-like (GA signaling) | GCTTTGTTCAGAAGAAACCA | TGG | Loxogramme mexicana (F茅e) C.Chr. | not found | kinetoplastids | CRISPR-Cas9,Base editor |
| PCdb_2654 | 37313529 | BnaA09.ZEP and BnaC09.ZEP | regulate pollen tube guidance | GCTTTGGTTCGCAATCTTGG | TGG | Brassica napus L. | not found | pollen grains,anther,Pollen tube,microspore,pollen,flower,plasma,pollen tube,style | CRISPR-Cas9 |
| PCdb_2655 | 31694550 | PDS | Phytoene desaturase | GCTTGGCCACCAAGCATTGC | TGG | Triticum aestivum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2656 | 38925598 | LOC_Os06g04200 | taste quality | GCTTGAGGCCCTGGAACCCG | TGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_2657 | 31694550 | PDS | Phytoene desaturase | GCTTGAGGCAAGAGATGTGT | TGG | Triticum aestivum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2658 | 37084283 | GmPDCTs | Phosphatidylcholine:diacylglycerol cholinephosphotransferase | GCTTCTCTTCTTCATGGCCG | tgg | Glycine max (L.) Merr. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2659 | 31656725 | OsGA20ox2 | Gibberellin 20-oxidase 2 regulating plant height | GCTTCGCCTCCAAGCTCCCA | TGG | Oryza sativa L. | not found | protoplast | not found |
| PCdb_2660 | 30625150 | RhPDS | Phytoene desaturase | GCTTCCACCACATCGAGTAC | TGG | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2661 | 31694550 | PDS | Phytoene desaturase | GCTTACGTTGAAGCTCAAGA | TGG | Triticum aestivum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2662 | 31452351 | Glyma.04G198400 Glyma.08G010000 Glyma.04G198500 Glyma.05G202700 | 尾-amylase (Glyma.04G198400, Glyma.08G010000, Glyma.04G198500, Glyma.05G202700) [Source: SoyBase] | GCTGTTATGTGGTTCTTCTA | TGG | Glycine max (L.) Merr. | 0.592 | hairy root | CRISPR-Cas9 |
| PCdb_2663 | 34246291 | GUS | 尾-Glucuronidase reporter enzyme (GUS) | GCTGTGAAATTAACCAGCTGCAG | TGG | Glycine max (L.) Merr. | 58-64% | hairy root | CRISPR-Cas9 |
| PCdb_2664 | 34498373 | BnaA03.BP | compact architecture to rapeseed | GCTGTCTAGAGACCCCGAAT | TGG | Brassica napus L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2665 | 33557889 | Gh_A03G1622 | Gh_A03G1622 (Gossypium hirsutum NAC domain protein NST1, secondary wall thickening) [Source: CottonGen] | GCTGTCAGTCTTTGAAGCCG | TGG | Gossypium hirsutum L. | 0.5889 | seed | CRISPR-Cas9 |
| PCdb_2666 | 28066464 | DIPM | Disease-Interacting Protein Module (likely involved in plant-pathogen interactions) | GCTGTATTCCGCATGAATCC | TGG | Vitis vinifera L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2667 | 38925598 | LOC_Os09g02690 | taste quality | GCTGGCTCAGATGCAGCAGC | TGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_2668 | 29572657 | OSBBS1OsRLCK109 | played vital roles in leaf senescence and the salt stress response. | GCTGGCGGAGGTGATCTTCT | TGG | Oryza sativa L. | not found | protoplast | not found |
| PCdb_2669 | 27848933 | ALS | Acetolactate synthase, target site of ALS-inhibitor herbicides and essential for branched-chain amino acid biosynthesis | GCTGCTCGATTCCGTCCCCA | TGG | Zea mays L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2670 | 26842991 | FGS | FGS (Arabidopsis thaliana FATTY ACID ELONGASE30, very-long-chain fatty acid biosynthesis) [Source: TAIR] | GCTGCTACAGCAAGGCCTGA | TGG | Zea mays L. | 0.7883 | protoplast | CRISPR-Cas9 |
| PCdb_2671 | 31694550 | PDS | Phytoene desaturase | GCTGCATGGAAGGATGAAGA | TGG | Triticum aestivum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2672 | 29531752 | PDS | Phytoene desaturase (PDS, carotenoid biosynthesis) | GCTGCATGGAAAGATGATGA | TGG | Nicotiana tabacum L. | 0.671 | protoplast | CRISPR-Cas9 |
| PCdb_2673 | 29531752 | PDS | Phytoene desaturase (PDS, carotenoid biosynthesis) | GCTGCATGGAAAGATGATGA | TGG | Nicotiana tabacum L. | 0.671 | protoplast | CRISPR-Cas9 |
| PCdb_2674 | 38925598 | LOC_Os10g41160 | taste quality | GCTGATGATGTTCCACACGA | TGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_2675 | 28905515 | VvWRKY52 | Vitis vinifera WRKY transcription factor 52 (VvWRKY52, defense response) | GCTGAGGTGTAGCGGCCCAG | TGG | Vitis vinifera L. | 0.0555 | protoplast | CRISPR-Cas9 |
| PCdb_2676 | 33931634 | VvbZIP36 | Vitis vinifera bZIP transcription factor 36 (VvbZIP36, stress signaling) | GCTGAGGTGTAGCGGCCCAG | TGG | Vitis vinifera L. | not found | calli | CRISPR-Cas9 |
| PCdb_2677 | 26842991 | FGS | FGS (Arabidopsis thaliana FATTY ACID ELONGASE54, very-long-chain fatty acid biosynthesis) [Source: TAIR] | GCTGAAGGGGATGAAGAGCT | TGG | Zea mays L. | 0.1985 | protoplast | CRISPR-Cas9 |
| PCdb_2678 | 26039904 | not found | not found | GCTCCTTCCTCGACAGVTC | TGG | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2679 | 36499605 | NtAITRs | Enhanced Drought Tolerance in Tobacco | GCTCCTAAACCAGCCGCTGG | TGG | Nicotiana tabacum L. | 0.2 | protoplast | CRISPR-Cas9 |
| PCdb_2680 | 35410430 | Sb-Lgs1 | during rapid de novo shoot regeneration | GCTCCCTCCCTAGCACGGAA | TGG | Hemisorghum C.E.Hubb. ex Bor | not found | embryo | CRISPR-Cas9 |
| PCdb_2681 | 36058302 | GluA1 | Glutenin subunit A1 (seed storage protein) [Source: UniProt] | GCTCATTGGTGCTACAATGA | TGG | Oryza sativa L. | not found | calli | not found |
| PCdb_2682 | 35906898 | not found | not found | GCTCATTGGTGCTACAATGA | TGG | Oryza sativa L. | not found | seed | CRISPR-Cas9 |
| PCdb_2683 | 28360425 | SlIAA9 | Auxin-responsive Aux/IAA9 transcription factor | GCTCAGGCTCGGTCTACC | TGG | Solanum lycopersicum L. | 1 | cotyledon pieces | CRISPR-Cas9 |
| PCdb_2684 | 35829752 | PHR1 | Phosphate starvation response transcription factor PHR1 | GCTATATCCATTCAGAGATC | TGG | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2685 | 28696528 | not found | not found | GCTAAAGTCAGGTAAACCGA | TGG | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2686 | 38925598 | LOC_Os11g08220 | taste quality | GCGTTCAGGACGCTCGAATA | TGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_2687 | 26842991 | FGS | FGS (Arabidopsis thaliana FATTY ACID ELONGASE18, very-long-chain fatty acid biosynthesis) [Source: TAIR] | GCGTCCTCCCATCCTCGCCA | TGG | Zea mays L. | 0.0216 | protoplast | CRISPR-Cas9 |
| PCdb_2688 | 26842991 | FGS | FGS (Arabidopsis thaliana FATTY ACID ELONGASE17, very-long-chain fatty acid biosynthesis) [Source: TAIR] | GCGGGGACTCCGAGCGCTGC | TGG | Zea mays L. | 0.0369 | protoplast | CRISPR-Cas9 |
| PCdb_2689 | 29101356 | Sc-ib1 | Subtilisin-chymotrypsin inhibitor-1, protease inhibitor in wheat | GCGGAAGGCGATCAGGGTAG | TGG | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2690 | 28432338 | AGO2 | Argonaute 2, involved in RNA interference and antiviral defense | GCGCTGGCCAGTTGACAG | TGG | Arabidopsis thaliana (L.) Heynh. | 0.25 | Nicotiana benthamiana (The reference genome is Niben101 which download from ftp:ftp.solgenomics.netgenomesNicotiana_benthamiana) | not found |
| PCdb_2691 | 38925598 | LOC_Os05g48610 | taste quality | GCGCGGCGAGCTCTGGTCGC | TGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_2692 | 38925598 | LOC_Os02g28580 | taste quality | GCGCCTGCGCCTGTTGCATA | TGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_2693 | 26842991 | FGS | FGS (Arabidopsis thaliana FATTY ACID ELONGASE22, very-long-chain fatty acid biosynthesis) [Source: TAIR] | GCGCCTGCACCTCCGGAGGT | TGG | Zea mays L. | 0.1592 | protoplast | CRISPR-Cas9 |
| PCdb_2694 | 26842991 | FGS | FGS (Arabidopsis thaliana FATTY ACID ELONGASE33, very-long-chain fatty acid biosynthesis) [Source: TAIR] | GCGCAGTCGTCACAAAGATC | TGG | Zea mays L. | 1 | protoplast | CRISPR-Cas9 |
| PCdb_2695 | 26842991 | FGS | FGS (Arabidopsis thaliana FATTY ACID ELONGASE28, very-long-chain fatty acid biosynthesis) [Source: TAIR] | GCGCACACAGTTTCCAAAGC | TGG | Zea mays L. | 0.0219 | protoplast | CRISPR-Cas9 |
| PCdb_2696 | 38925598 | LOC_Os10g19960 | taste quality | GCGATGTTCTTCCAGATGCG | TGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_2697 | 30272679 | APOBEC1 | Apolipoprotein B mRNA editing enzyme (cytidine deaminase), RNA-editing protein | GCGAGTACTTTGATGGGTCT | TGG | Solanum tuberosum L. | 0.02 | protoplast | PBE |
| PCdb_2698 | 36746586 | Waxy | Granule-bound starch synthase I (Waxy) | GCGAATGGCCACAGGGTCA | TGG | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2699 | 32117361 | PGA1 | Gibberellin receptor PGA1 (GA perception) | GCCTTGTTCAGAAGAAACCA | TGG | Ludwigia major (Micheli) Ramamoorthy | not found | kinetoplastids | CRISPR-Cas9,Base editor |
| PCdb_2700 | 31694550 | PDS | Phytoene desaturase | GCCTTGAACAGTTAGCTGCA | TGG | Triticum aestivum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2701 | 32265960 | LOC107276289 | Hypothetical protein LOC107276289 [Source: NCBI] | GCCTTATGGACTAAGAGTTC | TGG | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2702 | 32591429 | ZmNRPC 2 | RNA polymerase C2 subunit | GCCTGTGACGGCGCAGGTTC | TGG | Zea mays L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2703 | 25200087 | SWEET13-2 | SWEET13-2 sugar transporter (phloem loading) | GCCTGTCCCTGCAGCATCCC | TGG | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2704 | 37642675 | pCLCrVA | Viral satellite pCLCrVA (betasatellite replication) | GCCTCCATCTACTCAAAGCT | TGG | Gossypium hirsutum L. | not found | not found | CRISPR-Cas9 |
| PCdb_2705 | 36499605 | NtAITRs | Enhanced Drought Tolerance in Tobacco | GCCGTGTGATGTGTGGAGAA | TGG | Nicotiana tabacum L. | 0.2 | protoplast | CRISPR-Cas9 |
| PCdb_2706 | 36499605 | NtAITRs | Enhanced Drought Tolerance in Tobacco | GCCGTGTGATGTGTGGAAGA | TGG | Nicotiana tabacum L. | 0.2 | protoplast | CRISPR-Cas9 |
| PCdb_2707 | 38925598 | LOC_Os03g45210 | taste quality | GCCGTCAGTACCGTCCATGC | TGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_2708 | 31671177 | not found | Gene not detected or not annotated in the database | GCCGGGCATCTCGGACGCCA | TGG | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2709 | 26842991 | FGS | FGS (Arabidopsis thaliana FATTY ACID ELONGASE72, very-long-chain fatty acid biosynthesis) [Source: TAIR] | GCCGCTCTGGTTCACCGAGC | TGG | Zea mays L. | 0.1133 | protoplast | CRISPR-Cas9 |
| PCdb_2710 | 37535444 | PagHyPRP1 | improving drought and salt tolerance | GCCGCCCCAACTCTTGACTG | TGG | Populus sp. | 0.6 | not found | CRISPR-Cas9 |
| PCdb_2711 | 31469505 | Tms9-1 | Thermosensitive male sterility gene | GCCGAGGCTGAGCAGCTTG | TGG | Oryza sativa L. | 0.045 | calli | ABE |
| PCdb_2712 | 31634585 | DEP1 | Dense and erect panicle 1 gene controlling panicle architecture | GCCCCTCGCAGCAAGACGAC | TGG | Oryza sativa L. | 0.7 | calli | ABE |
| PCdb_2713 | 27116122 | OsERF922 | AP2/ERF transcription factor in blast resistance (OsERF922) | GCCCCGCATGTCTCTCTCCT | TGG | Oryza sativa L. | 0.42 | Enhanced Rice Blast Resistance | cas9 |
| PCdb_2714 | 30242039 | ZmbZIP 22 | bZIP transcription factor 22 | GCCCCCGCTCCCCA | TGG | Zea mays L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2715 | 34042262 | not found | not found | GCCCCCGCCCCCGCCTCCCA | TGG | Oryza sativa L. | 0.23 | protoplast | CBE |
| PCdb_2716 | 29577545 | FveARF8 | FveARF8 (Fragaria vesca auxin response factor 8, auxin signaling) [Source: UniProt] | GCCCACATCTGGAACTCGGG | TGG | Fragaria vesca L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2717 | 26842991 | FGS | FGS (Arabidopsis thaliana FATTY ACID ELONGASE90, very-long-chain fatty acid biosynthesis) [Source: TAIR] | GCCCAATAGCAAGTATACTG | TGG | Zea mays L. | 0.0104 | protoplast | CRISPR-Cas9 |
| PCdb_2718 | 27033976 | AtTFL1 | TERMINAL FLOWER 1 (floral repressor) | GCCATTGATAATGGGGAGAG | TGG | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2719 | 32426943 | TaBRI1 | Brassinosteroid receptor kinase BRI1 | GCCACTGCAGAAACTCACCT | TGG | Zea mays L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2720 | 29735370 | St16DOX | Potato 16伪-hydroxylase (St16DOX, steroidal glycoalkaloid biosynthesis) | GCCAACTCCCAAGGTTAAACTTGG | TGG | Solanum tuberosum L. | not found | hairy root | CRISPR-Cas9 |
| PCdb_2721 | 31694550 | PDS | Phytoene desaturase | GCATGCATTTAACAGGAGTG | TGG | Triticum aestivum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2722 | 26284791 | bar | Phosphinothricin N-acetyltransferase (herbicide resistance) | GCATCGCCTACGCGGGCCCC | TGG | Glycine max (L.) Merr. | 0.367 | hairy root | CRISPR-Cas9 |
| PCdb_2723 | 28640983 | GABA | Gamma-aminobutyric acid (GABA) receptor | GCATCCTGTTGCATGCGCAG | TGG | Solanum lycopersicum L. | 0.61 | leaf | CRISPR-Cas9 |
| PCdb_2724 | 37207820 | PdbKH | studied the physiological changes mediated by PdbKH when exposed to salt stress | GCATAGAAGTCCCAGCCCCA | TGG | Populus sp. | not found | bud,plants,plant | CRISPR-Cas9 |
| PCdb_2725 | 33557889 | Gh_A10G0929 | Gh_A10G0929 (Gossypium hirsutum aquaporin TIP2;1 A10G0929) [Source: CottonGen] | GCATAAAGCTCTAAACACAG | TGG | Gossypium hirsutum L. | 0.5889 | seed | CRISPR-Cas9 |
| PCdb_2726 | 34904377 | UR9 | Uncharacterized resistance protein UR9 (fungal disease resistance) | GCAGGGGCAGCACTTCATTG | tgg | Glycine max (L.) Merr. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2727 | 33557889 | Gh_A02G0192 | Gh_A02G0192 (Gossypium hirsutum dirigent-like protein, lignan biosynthesis) [Source: CottonGen] | GCAGGACCAGGAATAGCTGG | TGG | Gossypium hirsutum L. | 0.5889 | seed | CRISPR-Cas9 |
| PCdb_2728 | 38925598 | LOC_Os09g31390 | taste quality | GCAGCTCGTACATCAGCCGG | TGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_2729 | 38925598 | LOC_Os01g54040 | taste quality | GCAGATCCTGGAGCTTGACA | TGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_2730 | 36338846 | not found | not found | GCAGAAGCAAGTTTCACAGT | TGG | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2731 | 31694550 | PDS | Phytoene desaturase | GCAGAAATACTTGGCTTCCA | TGG | Triticum aestivum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2732 | 26842991 | FGS | FGS (Arabidopsis thaliana FATTY ACID ELONGASE50, very-long-chain fatty acid biosynthesis) [Source: TAIR] | GCACTCCACTCCGTAGCACA | TGG | Zea mays L. | 0.18 | protoplast | CRISPR-Cas9 |
| PCdb_2733 | 36499605 | NtAITRs | Enhanced Drought Tolerance in Tobacco | GCACCTAAACCGGTCGCCGG | TGG | Nicotiana tabacum L. | 0.2 | protoplast | CRISPR-Cas9 |
| PCdb_2734 | 34042262 | OsALS | Acetolactate synthase | GCACCACCATACCCAAATGT | TGG | Oryza sativa L. | 0.038 | protoplast | CBE |
| PCdb_2735 | 36499684 | Pyruvate Kinase (PK) Gene Family | Modulating Rice Yield and Quality | GCACATAATATTACACTGCC | TGG | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2736 | 35807717 | bamhi | Type II restriction enzyme BamHI, recognizes and cleaves specific DNA sequences | GCACACTGACAAGTGGATCC | TGG | Gossypium hirsutum L. | 0.88 | protoplast | CRISPR-Cas9 |
| PCdb_2737 | 38925598 | LOC_Os01g44220 | taste quality | GCACAAGCATTCGTATCCAA | TGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_2738 | 28790350 | BnaA2.DA2 | E3 ubiquitin ligase DA2 homolog | GCACAAGACGACGGCATTGC | TGG | Brassica napus L. | 0.902 | protoplast | CRISPR-Cas9 |
| PCdb_2739 | 30871076 | APT | Adenine phosphoribosyltransferase, salvages adenine for nucleotide synthesis | GCACAAACGCGTTGCCCGGGC | TGG | Chlamydomonas reinhardtii P.A.Dang. | 0.3 | protoplast | CRISPR-Cas9 |
| PCdb_2740 | 35684226 | not found | not found | GCAATGGAACCTCATATACG | TGG | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2741 | 34681568 | PDS | Phytoene desaturase (PDS, carotenoid biosynthesis) | GCAAAATATCTGGCAGATGC | TGG | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2742 | 31694550 | PDS | Phytoene desaturase | GCAAAATACCTGGCAGACGC | TGG | Triticum aestivum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2743 | 36998699 | OsHPP04 | Heavy metal鈥揳ssociated protein (HPP04) | gCAAAAGATCGTGATAAAGC | TGG | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2744 | 38925598 | LOC_Os06g04930 | taste quality | GATTTGATTCTATGGCCTAA | TGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_2745 | 31694550 | PDS | Phytoene desaturase | GATTTCATCAGGAAACAACT | TGG | Triticum aestivum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2746 | 26082432 | not found | not found | GATGTTTAGCTCCTTTACTA | tgg | Solanum tuberosum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2747 | 38925598 | LOC_Os11g45360 | taste quality | GATGGTGTCCTCCATCTCTG | TGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_2748 | 31694550 | PDS | Phytoene desaturase | GATGGTGATTGGTACGAGAC | TGG | Triticum aestivum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2749 | 35171288 | SlDML 2 | promote tomato fruit ripening | GATGGGTATCCTAGACCACG | TGG | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2750 | 29577545 | FveTAA1 | FveTAA1 (Fragaria vesca tryptophan aminotransferase of Arabidopsis 1, auxin biosynthesis) [Source: UniProt] | GATGGGGGACAAGTGCACAA | TGG | Fragaria vesca L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2751 | 33220510 | OsPAO5 | Polyamine oxidase 5 involved in polyamine catabolism | GATGGGCACCTGTCCATG | TGG | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2752 | 32117361 | PBL-T1 | Pattern-triggered immunity protein PBL-T1 (disease resistance) | GATGGCGAGTCTGGTCAAAT | TGG | Loeselia mexicana (Lam.) Brand | not found | kinetoplastids | CRISPR-Cas9,Base editor |
| PCdb_2753 | 26842991 | FGS | FGS (Arabidopsis thaliana FATTY ACID ELONGASE12, very-long-chain fatty acid biosynthesis) [Source: TAIR] | GATGCCATTTAATTCCTACA | TGG | Zea mays L. | 0.039 | protoplast | CRISPR-Cas9 |
| PCdb_2754 | 28640983 | CAT9 | Cationic amino acid transporter CAT9 | GATGCAAACCGTAGGCAGAA | TGG | Solanum lycopersicum L. | 0.61 | leaf | CRISPR-Cas9 |
| PCdb_2755 | 39348559 | BnaA02 | Brassica napus gene located on chromosome A02; function context-dependent and varies by specific locus. | GATGATGAGGCAGACACTGT | TGG | Brassica napus L. | not found | hypocotyl | CRISPR-Cas9 |
| PCdb_2756 | 33950284 | OsCOP 1 | regulates embryo development and flavonoid biosynthesis in rice | GATGAGCTATTTGCTACTGC | TGG | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2757 | 30287957 | OVATE | OVATE family protein (fruit shape determination) | GATGAGCACGTCTTCAGCTG | TGG | Physalis pruinosa L. | not found | leaf | CRISPR-Cas9 |
| PCdb_2758 | 31694550 | PDS | Phytoene desaturase | GATGACTAGTTTTTAGTGCC | TGG | Triticum aestivum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2759 | 31694550 | PDS | Phytoene desaturase | GATCTCTTATTTCAAAAGGC | TGG | Triticum aestivum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2760 | 37188058 | not found | not found | GATCGTG GGAACTACCG ACG | TGG | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2761 | 39831348 | Brachytic2 | ABC transporter affecting auxin transport and internode elongation; loss-of-function results in reduced plant height in maize. | GATCGCGATCGCGCGCGCGC | TGG | Zea mays L. | 0.49-1.12% | protoplast | CRISPR/Cas9 |
| PCdb_2762 | 36903878 | not found | not found | GATCGCGAAAACTGTGGAAT | TGG | Glycine max (L.) Merr. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2763 | 26842991 | FGS | FGS (Arabidopsis thaliana FATTY ACID ELONGASE41, very-long-chain fatty acid biosynthesis) [Source: TAIR] | GATCCTTATCTTGACTACCA | TGG | Zea mays L. | 0.051 | protoplast | CRISPR-Cas9 |
| PCdb_2764 | 26842991 | FGS | FGS (Arabidopsis thaliana FATTY ACID ELONGASE8, very-long-chain fatty acid biosynthesis) [Source: TAIR] | GATCCTGCTCAATCTTTACA | TGG | Zea mays L. | 0.0763 | protoplast | CRISPR-Cas9 |
| PCdb_2765 | 26842991 | FGS | FGS (Arabidopsis thaliana FATTY ACID ELONGASE8, very-long-chain fatty acid biosynthesis) [Source: TAIR] | GATCCTGCTCAATCTTTACA | TGG | Zea mays L. | 0.0763 | protoplast | CRISPR-Cas9 |
| PCdb_2766 | 28066464 | DIPM | Disease-Interacting Protein Module (likely involved in plant-pathogen interactions) | GATCCCAGAACGGAGGGAGG | TGG | Vitis vinifera L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2767 | 27226176 | GL1 | R2R3-MYB transcription factor GL1 | GATCCAAGTCACTATTA | TGG | Arabidopsis thaliana (L.) Heynh. | 1 | mature leaves | CRISPR-Cas9 |
| PCdb_2768 | 34042262 | OsALS | Acetolactate synthase | GATCATGCGGCGGGGGACC | TGG | Oryza sativa L. | 0.028 | protoplast | CBE |
| PCdb_2769 | 33396822 | PDS | Phytoene desaturase (PDS, carotenoid biosynthesis) | GATCAGACACTCTTATCTGT | TGG | Pyrus communis聽L. | 0.67 | protoplast | CRISPR-Cas9,Base editor |
| PCdb_2770 | 37119416 | TOM1 | TOM1 auxin transporter (polar auxin transport) | GATCAACGAGTCCGTTCAG | TGG | Nicotiana tabacum L. | 0.4 | seed | CRISPR-Cas9 |
| PCdb_2771 | 27699473 | GBSS | GBSS (Granule-bound starch synthase, EC 2.4.1.242, amylose biosynthesis) [Source: UniProt] | GATATTAGAATCACATAGGG | TGG | Solanum tuberosum L. | 0.082 | Protoplast | CRISPR-Cas9 |
| PCdb_2772 | 38925598 | LOC_Os01g13360 | taste quality | GATAGCCATATCCGTGACTA | TGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_2773 | 34713215 | PDS | Phytoene desaturase (PDS, carotenoid biosynthesis) | GATACGTTCTCTATGGAGGA | TGG | Nicotiana attenuata Torr. ex S.Watson | not found | protoplast | CRISPR-Cas9 |
| PCdb_2774 | 31452351 | Glyma.04G082900 Glyma.17G195900 Glyma.06G084300 | 4-coumarate-CoA ligase (Glyma.04G082900, Glyma.17G195900, Glyma.06G084300) [Source: SoyBase] | GATAACTTCCTTATGGGTCT | TGG | Glycine max (L.) Merr. | 0.592 | hairy root | CRISPR-Cas9 |
| PCdb_2775 | 31452351 | Glyma.16G208900 | 尾-amylase (Glyma.16G208900) [Source: SoyBase] | GAGTTTGAAGAACAACATGG | TGG | Glycine max (L.) Merr. | 0.592 | hairy root | CRISPR-Cas9 |
| PCdb_2776 | 29797189 | CrtR-b2 | 尾-carotene hydroxylase CrtR-b2 | GAGTTTAGCTGCCAGTTGGC | TGG | Solanum lycopersicum L. | 0.69 | Regenerated shoots | CRISPR-Cas9 |
| PCdb_2777 | 40029441 | PlCYP81Q38 | Cytochrome P450 monooxygenase involved in specialized secondary metabolism (e.g., phenylpropanoid or alkaloid biosynthesis) in plants. | GAGTGTCTAAGAGATGCATG | TGG | Phryma leptostachya subsp. asiatica (Hara) Kitamura | not found | protoplast | CRISPR/Cas9 |
| PCdb_2778 | 30959555 | not found | not found | GAGTGGAAGCTTATATATGT | TGG | Oryza sativa L. | 0.444 | calli | ABE |
| PCdb_2779 | 30729010 | BoMS1 | Male sterility 1 protein, involved in pollen development in Brassica oleracea | GAGTAGCAAAAGGAGAGCCG | TGG | Brassica oleracea var. capitata L. | 0.2778 | hypocotyl | CRISPR-Cas9 |
| PCdb_2780 | 29269023 | not found | not found | GAGGGCAAGAACGTGTTCTAC | TGG | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2781 | 26842991 | FGS | FGS (Arabidopsis thaliana FATTY ACID ELONGASE4, very-long-chain fatty acid biosynthesis) [Source: TAIR] | GAGGCGTTCTCCAGATGCCA | TGG | Zea mays L. | 0.5375 | protoplast | CRISPR-Cas9 |
| PCdb_2782 | 38925598 | LOC_Os10g42690 | taste quality | GAGGAGTTCGAGGATCCCAT | TGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_2783 | 33774917 | LEAFY | function in Eucalyptus gives sterile indeterminate inflorescences and normal juvenile development | GAGGAGCTGTTCGAGGCTTA | TGG | Eucalyptus grandis 脳 E. urophylla | not found | protoplast | CRISPR-Cas9 |
| PCdb_2784 | 29250878 | BnCLV1 | CLAVATA1 receptor-like kinase | GAGGAGATGGTCCATGTCAG | TGG | Brassica napus L. | 0.465 | seed | CRISPR-Cas9 |
| PCdb_2785 | 32841372 | BnCLV1 | regulates seed production | GAGGAGATGGTCCATGTCAG | TGG | Brassica napus L. | not found | seed | CRISPR-Cas9 |
| PCdb_2786 | 29206320 | FPPS1 | Farnesyl pyrophosphate synthase 1 | GAGGAACCTCCGGGATGAGT | TGG | Solanum lycopersicum L. | not found | chloroplast | CRISPR-Cas9 |
| PCdb_2787 | 27862889 | FAD2 | Fatty acid desaturase 2 | GAGCGTTTGAAACACTGCGG | TGG | Arabidopsis thaliana (L.) Heynh. | 0.716 | seed | CRISPR-Cas9 |
| PCdb_2788 | 27862889 | FAD2 | Fatty acid desaturase 2 | GAGCGTTTGAAACACTGCGG | TGG | Arabidopsis thaliana (L.) Heynh. | 0.716 | seed | CRISPR-Cas9 |
| PCdb_2789 | 38679667 | OsGS2 | Chloroplastic glutamine synthetase 2 catalyzing ammonia assimilation during photorespiration and nitrogen remobilization in rice. | GAGCACGGAGACCACCGGGG | TGG | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2790 | 31694550 | PDS | Phytoene desaturase | GAGATCTCTCTCCACTCTTG | TGG | Triticum aestivum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2791 | 30839150 | Ms1 | Wheat MALE STERILITY 1 transcription factor (anther development) | GAGATCCCGCGGGCTGCTGC | TGG | Triticum aestivum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2792 | 30272679 | APOBEC1 | Apolipoprotein B mRNA editing enzyme (cytidine deaminase), RNA-editing protein | GAGAGCTGTGTGCCAATCAT | TGG | Solanum tuberosum L. | 0.106 | protoplast | PBE |
| PCdb_2793 | 36892416 | FT and TFL1CENBFT family | growth, dormancy release and flowering | GAGAGCCOGAGGOCGACGA | TGG | Populus 脳 canescens 'INRA 717-1B10' | not found | seed | CRISPR-Cas9 |
| PCdb_2794 | 31694550 | PDS | Phytoene desaturase | GAGAGCATTTACCTGCACTA | TGG | Triticum aestivum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2795 | 26842991 | FGS | FGS (Arabidopsis thaliana FATTY ACID ELONGASE71, very-long-chain fatty acid biosynthesis) [Source: TAIR] | GAGAGCAACTGTTCAGGAGC | TGG | Zea mays L. | 0.37 | protoplast | CRISPR-Cas9 |
| PCdb_2796 | 26842991 | FGS | FGS (Arabidopsis thaliana FATTY ACID ELONGASE66, very-long-chain fatty acid biosynthesis) [Source: TAIR] | GAGAGAGTGTCCCATGGGGC | TGG | Zea mays L. | 0.2585 | protoplast | CRISPR-Cas9 |
| PCdb_2797 | 30379827 | not found | not found | GAGACCTTCATGATCAGGAG | TGG | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2798 | 31694550 | PDS | Phytoene desaturase | GAGAAGGTGAAGTTTGCTAT | TGG | Triticum aestivum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2799 | 32170801 | PHYTOENE DESATURASE | Phytoene desaturase (carotenoid biosynthesis) | GAGAAAGTCAAATTTGCAAT | TGG | Solanum tuberosum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2800 | 29036337 | CLE8 | CLE-Peptide-Encoding Genes | GAGAAAGACGTTGTCCCAGC | TGG | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2801 | 32191315 | rbcS | Ribulose bisphosphate carboxylase small subunit (rbcS, photosynthesis) | GAGAAAAACGCGCCGCGAGAT | TGG | Nicotiana attenuata Torr. ex S.Watson | not found | root | CRISPR-Cas9 |
| PCdb_2802 | 33557889 | Gh_A02G0192 | Gh_A02G0192 (Gossypium hirsutum dirigent-like protein, lignan biosynthesis) [Source: CottonGen] | GACTTGGTGGACAAACCGGT | TGG | Gossypium hirsutum L. | 0.5889 | seed | CRISPR-Cas9 |
| PCdb_2803 | 32117361 | CORE | CORE transcription factor | GACTGGCCTGGGGTCTCATG | TGG | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2804 | 37346168 | Solyc06g065100 | Tomato protein Solyc06g065100 (uncharacterized) | GACTGCGGTGGTGATATTGG | TGG | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2805 | 33440058 | Os05circ02465 | Circular RNA (potential regulatory function) | gactccattccattttgcag | TGG | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2806 | 33222361 | DrPDS | the phytoene desaturase gene | GACTACCCGAGGCCTGAAT | TGG | Dioscorea rotundata Poir. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2807 | 36012319 | ABI2 | Regulate ABA Response in Arabidopsis | GACTAAGTCGATCACCATCC | TGG | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2808 | 38925598 | LOC_Os05g03130 | taste quality | GACGTTCTTGGAGATCTTGC | TGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_2809 | 26842991 | FGS | FGS (Arabidopsis thaliana FATTY ACID ELONGASE23, very-long-chain fatty acid biosynthesis) [Source: TAIR] | GACGTGCGTGACGCCGGCCT | TGG | Zea mays L. | 0.97 | protoplast | CRISPR-Cas9 |
| PCdb_2810 | 30917862 | Glyma.13g123500 | Isoflavone reductase (Glyma.13g123500) [Source: SoyBase] | GACGTACTAGTGATTCCTCC | TGG | Glycine max (L.) Merr. | not found | hairy root | CRISPR-Cas9 |
| PCdb_2811 | 26842991 | FGS | FGS (Arabidopsis thaliana FATTY ACID ELONGASE57, very-long-chain fatty acid biosynthesis) [Source: TAIR] | GACGCACCTGGCCATCGTCA | TGG | Zea mays L. | 0.0154 | protoplast | CRISPR-Cas9 |
| PCdb_2812 | 38925598 | LOC_Os02g26480 | taste quality | GACGACTCTTCCCGCAGAGA | TGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_2813 | 34396631 | AT1G17615 | Arabidopsis unknown protein (AT1G17615, uncharacterized) | GACGACGTTGAACTCCAGAG | TGG | Arabidopsis thaliana (L.) Heynh. | not found | leaf | CRISPR-Cas9 |
| PCdb_2814 | 26842992 | GRMZM2G091313 (Hsg1) | Maize genome reference GRMZM2G091313 (Heat shock protein gene Hsg1) [Source: MaizeGDB] | gacgacgacggcgtcgacga | tgg | Zea mays L. | 19-31% | protoplast | CRISPR-Cas9 |
| PCdb_2815 | 38925598 | LOC_Os01g74140 | taste quality | GACCGTCGGCGAGTAGCTGA | TGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_2816 | 32321839 | not found | not found | GACCGAGATCCTGACTATAC | TGG | Oryza sativa L. | not found | Subcellular Fractions | CRISPR-Cas9 |
| PCdb_2817 | 31452351 | Glyma.02G279600 Glyma.14G035100 Glyma.20G040500 | UDP-glucosyltransferase (Glyma.02G279600, Glyma.14G035100, Glyma.20G040500) [Source: SoyBase] | GACCATGGGCTTTTGTTCAG | TGG | Glycine max (L.) Merr. | 0.592 | hairy root | CRISPR-Cas9 |
| PCdb_2818 | 36142495 | GmIPK1 | Glycine max inositol 1,3,4,5,6-pentakisphosphate 2-kinase 1 (phytic acid metabolism) [Source: SoyBase] | GACCAGGGAATTCCTTGAGT | TGG | Glycine max (L.) Merr. | 0.1-4.3% | seed | CRISPR-Cas9 |
| PCdb_2819 | 38925598 | LOC_Os01g27630 | taste quality | GACCAATGTAGCCCGCGTAC | TGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_2820 | 29572864 | GBSS | GBSS (Granule-bound starch synthase, EC 2.4.1.242, amylose biosynthesis) [Source: UniProt] | GACAAGAAGATCCCTTTGAT | TGG | Solanum tuberosum L. | 0.09 | protoplast | CRISPR-Cas9 |
| PCdb_2821 | 27699473 | GBSS | GBSS (Granule-bound starch synthase, EC 2.4.1.242, amylose biosynthesis) [Source: UniProt] | GACAAGAAGATCCCTTTGAT | TGG | Solanum tuberosum L. | 0.052 | Protoplast | CRISPR-Cas9 |
| PCdb_2822 | 38492487 | SlACOS1 | Pollen development and male fertility | GACAACAACGCTCGTAGGTT | TGG | Solanum lycopersicum L. | not found | protoplast | CRISPR/Cas9 |
| PCdb_2823 | 33557889 | Gh_A10G0929 | Gh_A10G0929 (Gossypium hirsutum aquaporin TIP2;1 A10G0929) [Source: CottonGen] | GAAGTTATGCAGCAACTGCA | TGG | Gossypium hirsutum L. | 0.5889 | seed | CRISPR-Cas9 |
| PCdb_2824 | 37018323 | PDS | Phytoene desaturase (PDS, carotenoid biosynthesis) | GAAGCTAGAGACGTTCTAGG | TGG | Vigna unguiculata (L.) Walp. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2825 | 28824692 | GhPDS | Phytoene desaturase | GAAGCGAGAGAVIGTTCTAGG | TGG | Gossypium hirsutum L. | 0.64 | cotyledon | CRISPR-Cas9 |
| PCdb_2826 | 30305839 | GhPDS | Gossypium hirsutum phytoene desaturase | GAAGCGAGAGATGTTCTAGG | TGG | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2827 | 30729010 | BoPDS | Phytoene desaturase, key enzyme in carotenoid biosynthesis pathway | GAAGCAAGAGATGTTCTTGG | TGG | Brassica oleracea var. capitata L. | 0.68 | hypocotyl | CRISPR-Cas9 |
| PCdb_2828 | 26603121 | GmPDS11 | Phytoene desaturase | GAAGCAAGAGACGTTCTAGG | TGG | Glycine max (L.) Merr. | 0.434 | hairy root | CRISPR-Cas9 |
| PCdb_2829 | 37346168 | Solyc01g102340 | Tomato protein Solyc01g102340 (uncharacterized) | GAAGATACGGCCGGCTTAAT | TGG | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2830 | 38925598 | LOC_Os04g33040 | taste quality | GAAGAGCAGGCCGCTCGTAA | TGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_2831 | 28790350 | BnaA6.DA1 | Ubiquitin receptor DA1 homolog | GAAGAGAGGTTACTATGGGT | TGG | Brassica napus L. | 0.406 | protoplast | CRISPR-Cas9 |
| PCdb_2832 | 31452351 | Glyma.01G185800 Glyma.11G056200 | NAC transcription factor (Glyma.01G185800 & Glyma.11G056200) [Source: SoyBase] | GAAGACCAAATGGGCTTCGG | TGG | Glycine max (L.) Merr. | 0.592 | hairy root | CRISPR-Cas9 |
| PCdb_2833 | 36555242 | YUC1 | Flavin monooxygenase YUCCA1 (auxin biosynthesis) | GAAGAATACTGGAGGAAGAT | TGG | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2834 | 34143557 | ppo | wheat grain quality improvement | GAAGAAGACGCTGCTGTTCC | TGG | Triticum aestivum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2835 | 30800139 | EPSPS | EPSPS (5-enolpyruvylshikimate-3-phosphate synthase, EC 2.5.1.19, aromatic amino acid biosynthesis) [Source: UniProt] | GAAGAAATCCAACTATTCCT | TGG | Solanum tuberosum L. | not found | protoplast | CRISPR-Cas9,CRISPR-Cas12,TALEN |
| PCdb_2836 | 38925598 | LOC_Os12g27830 | taste quality | GAACGGCGTGCTCAACTGGG | TGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_2837 | 26842991 | FGS | FGS (Arabidopsis thaliana FATTY ACID ELONGASE19, very-long-chain fatty acid biosynthesis) [Source: TAIR] | GAACGGCGCTCCAGCAGCTG | TGG | Zea mays L. | 0.3286 | protoplast | CRISPR-Cas9 |
| PCdb_2838 | 38925598 | LOC_Os02g37490 | taste quality | GAACGCGATGAGAGCCTGCC | TGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_2839 | 38925598 | LOC_Os02g12310 | taste quality | GAACGACACCGTCGGGTTTC | TGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_2840 | 25225186 | ARGONAUTE7 | Argonaute 7 | GAACCTAATTCTGAGATGGG | TGG | Solanum lycopersicum L. | 0.48 | seed | CRISPR-Cas9 |
| PCdb_2841 | 26842991 | FGS | FGS (Arabidopsis thaliana FATTY ACID ELONGASE13, very-long-chain fatty acid biosynthesis) [Source: TAIR] | GAACCCTAGAATTGGTACCT | TGG | Zea mays L. | 0.0558 | protoplast | CRISPR-Cas9 |
| PCdb_2842 | 28790350 | BnaC5.DA1 | Ubiquitin receptor DA1 homolog | GAACACCTTAGGATTTGTGC | TGG | Brassica napus L. | 0.4 | protoplast | CRISPR-Cas9 |
| PCdb_2843 | 31634585 | ALS | Acetolactate synthase (branched-chain amino acid biosynthesis) | GAACAACCAACATTTGGGTA | TGG | Oryza sativa L. | 0.08 | calli | ABE |
| PCdb_2844 | 27579989 | NbEDS1a + NbEDS1b (exon 1) | Enhanced disease susceptibility 1a/1b exon 1 fragment (plant immunity) [Source: SolGenomics] | GAAATTGGTCTGTTGATGGT | TGG | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2845 | 32841372 | BnALC | regulates seed production | GAAACTGGGGAAGGCAAATG | TGG | Brassica napus L. | not found | seed | CRISPR-Cas9 |
| PCdb_2846 | 27208253 | ABP1 | Auxin-binding protein 1 | GAAACACATGGAAATTTCCC | TGG | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2847 | 30729010 | BoPDS | Phytoene desaturase, key enzyme in carotenoid biosynthesis pathway | GAAACAACGAGATGCTGACA | TGG | Brassica oleracea var. capitata L. | 0.68 | hypocotyl | CRISPR-Cas9 |
| PCdb_2848 | 37346168 | Solyc02g092930 | Tomato protein Solyc02g092930 (uncharacterized) | GAAAATCTTGCCGCTTGCGG | TGG | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2849 | 38060616 | ZmWUS1 | WUSCHEL-related homeobox 1 (shoot apical meristem maintenance) | CTTTTTCACAGTAAAGATGC | TGG | Zea mays L. | not found | inflorescence | CRISPR-Cas9 |
| PCdb_2850 | 31452351 | Glyma.17G005600 Glyma.07G268100 | Glutathione S-transferase (Glyma.17G005600 & Glyma.07G268100) [Source: SoyBase] | CTTTGGTGCTGCCATGCCCA | TGG | Glycine max (L.) Merr. | 0.592 | hairy root | CRISPR-Cas9 |
| PCdb_2851 | 30272679 | APOBEC1 | Apolipoprotein B mRNA editing enzyme (cytidine deaminase), RNA-editing protein | CTTTATCTGCAGGTCAAAGT | TGG | Solanum tuberosum L. | 0.006 | protoplast | PBE |
| PCdb_2852 | 36892416 | FT and TFL1CENBFT family | TFL1 (Terminal Flower 1, phosphatidylethanolamine-binding protein family) [Source: UniProt] | CTTGTGGTTGGGAGAGTGAT | TGG | Populus 脳 canescens 'INRA 717-1B9' | not found | seed | CRISPR-Cas9 |
| PCdb_2853 | 38925598 | LOC_Os01g47130 | taste quality | CTTGTCCGTCTCGCCGCGCG | TGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_2854 | 28258551 | not found | not found | CTTGTCACTACTTTCTCTTA | TGG | Gossypium hirsutum L. | 0.4 | seed | CRISPR-Cas9 |
| PCdb_2855 | 35098208 | not found | not found | CTTGTCACTACTTTCTCTTA | tgg | Glycine max (L.) Merr. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2856 | 34191398 | eCDAL | Engineered cytidine deaminase-activating enzyme (likely used in base editing systems) | CTTGGTGTGGAGAATATACA | TGG | Oryza sativa L. | not found | calli | CBE |
| PCdb_2857 | 31694550 | PDS | Phytoene desaturase | CTTGAGCTTCAACGTAAGCT | TGG | Triticum aestivum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2858 | 30928637 | OsPDS | Oryza sativa phytoene desaturase (OsPDS, carotenoid biosynthesis) | CTTGAGCTTCAACATAAGCT | TGG | Oryza sativa L. | not found | protoplast | xCas9 |
| PCdb_2859 | 32508867 | not found | not found | CTTGAGCTICAACATAAGCT | TGG | Oryza sativa L. | not found | calli | CRISPR-Cas9 |
| PCdb_2860 | 31694550 | PDS | Phytoene desaturase | CTTCTACCAGCAATGCTTGG | TGG | Triticum aestivum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2861 | 31694550 | PDS | Phytoene desaturase | CTTCGGATTGCAGGCTCTCC | TGG | Triticum aestivum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2862 | 33576792 | YSL3 | is required for fertility, seed size and protein accumulation | CTTCAGGCCTACACTGCACA | TGG | Brachypodium distachyon (L.) P. Beauv. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2863 | 30287957 | MPF2 | MADS-box protein FLOWERING LOCUS F2 (floral transition) [Source: TAIR] | CTTATCATTTTCTCTTCTAC | TGG | Physalis pruinosa L. | not found | leaf | CRISPR-Cas9 |
| PCdb_2864 | 29867128 | AtT30G6.16 | Arabidopsis thaliana gene T30G6.16 (uncharacterized protein) | CTTACGAATTAGAAGAGCAT | TGG | Arabidopsis thaliana (L.) Heynh. | not found | seed | CBE |
| PCdb_2865 | 29867128 | AtHAB1 | Protein phosphatase 2C HAB1, negative regulator of ABA signaling | CTTACCGATGGACCTAGACA | TGG | Arabidopsis thaliana (L.) Heynh. | not found | seed | CBE |
| PCdb_2866 | 38925598 | LOC_Os02g33430 | taste quality | CTTAATCCCCCAACTCCTGT | TGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_2867 | 31694550 | PDS | Phytoene desaturase | CTTAACTGTTTCCGAATGGA | TGG | Triticum aestivum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2868 | 31694550 | PDS | Phytoene desaturase | CTGTCATCAATGTTCATATA | TGG | Triticum aestivum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2869 | 31694550 | PDS | Phytoene desaturase | CTGTATTCTCCTGGTTTGTT | TGG | Triticum aestivum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2870 | 38925598 | LOC_Os12g24800 | taste quality | CTGTAGATTACGGTGAGCCG | TGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_2871 | 38925598 | LOC_Os09g26380 | taste quality | CTGCGGTGATGGACGGCGAA | TGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_2872 | 37346168 | Solyc05g007160 | Tomato protein Solyc05g007160 (uncharacterized) | CTGATTTCAAGAAAGGAGGG | TGG | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2873 | 30679374 | SPL15 | SQUAMOSA-promoter binding-like 15 transcription factor | CTGAATCAGACAGAGTCAGG | TGG | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2874 | 26842992 | GRMZM2G000411 (Hsg8) | Maize genome reference GRMZM2G000411 (Heat shock protein gene Hsg8) [Source: MaizeGDB] | ctgaaagttgcaaagaattc | tgg | Zea mays L. | 19-31% | protoplast | CRISPR-Cas9 |
| PCdb_2875 | 33557889 | Gh_A13G1568 | Gh_A13G1568 (Gossypium hirsutum ABC transporter A13G1568) [Source: CottonGen] | CTCTGCACTGAATATTTGGT | TGG | Gossypium hirsutum L. | 0.5889 | seed | CRISPR-Cas9 |
| PCdb_2876 | 30455712 | FRI | FRI (FRIGIDA, scaffold protein for vernalization complex) [Source: UniProt] | CTCCTTTGGCGGCGATTGTG | TGG | Brassica oleracea var. capitata L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2877 | 26842991 | FGS | FGS (Arabidopsis thaliana FATTY ACID ELONGASE87, very-long-chain fatty acid biosynthesis) [Source: TAIR] | CTCCTGGCGTTCCCGCCACA | TGG | Zea mays L. | 0.0669 | protoplast | CRISPR-Cas9 |
| PCdb_2878 | 31634585 | NRT1.1B | Nitrate transporter regulating nitrogen uptake and utilization | CTCCCTCTCCATCGCCGGCA | TGG | Oryza sativa L. | 0.21 | calli | ABE |
| PCdb_2879 | 30477421 | DA1 | Ubiquitin receptor DA1 (seed and organ size regulator) | CTCATGAGATGATGCATGCG | TGG | Triticum aestivum L. | 0.5417 | protoplast | CRISPR-Cas9 |
| PCdb_2880 | 33150679 | TaDA1 | Ubiquitin receptor DA1 | CTCATGAGATGATGCATGCA | TGG | Triticum aestivum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2881 | 30477421 | DA1 | Ubiquitin receptor DA1 (seed and organ size regulator) | CTCATGAGATGATGCATGCA | TGG | Triticum aestivum L. | 0.5417 | protoplast | CRISPR-Cas9 |
| PCdb_2882 | 38925598 | LOC_Os02g36510 | taste quality | CTCATCTCCACGGTGTATTC | TGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_2883 | 38925598 | LOC_Os01g74140 | taste quality | CTCATCTCCACGGTGTATTC | TGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_2884 | 31452351 | Glyma.11G004000 | Hypothetical protein Glyma.11G004000 [Source: SoyBase] | CTCACTCTGGAGGTTATCAG | TGG | Glycine max (L.) Merr. | 0.592 | hairy root | CRISPR-Cas9 |
| PCdb_2885 | 34764970 | FAD2 | Enhances Oleic Acid Production | CTCACTACGATTCATCAGAG | TGG | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | Base editor |
| PCdb_2886 | 31991936 | FWL | FWL (FW2-2-like cell number regulator, plasma membrane-associated) [Source: UniProt] | CTCACGGTGCATCTGTGCGA | TGG | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2887 | 29051052 | GLABRA1 | GLABRA1 (trichome development regulator) [Source: TAIR] | CTATTGCCGAGGAGCTTG | TGG | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2888 | 38925598 | LOC_Os08g09700 | taste quality | CTATTCTGACAGCAACCTTC | TGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_2889 | 31694550 | PDS | Phytoene desaturase | CTATCATCTATGAACATAGC | TGG | Triticum aestivum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2890 | 36764921 | not found | not found | CTATAAAGAGGTATGCCTGA | TGG | Oryza sativa L. | not found | protoplast | not found |
| PCdb_2891 | 36892416 | FT and TFL1CENBFT family | TFL1 (Terminal Flower 1, phosphatidylethanolamine-binding protein family) [Source: UniProt] | CTAAGGACCTTCTACACTC | TGG | Populus 脳 canescens 'INRA 717-1B6' | not found | seed | CRISPR-Cas9 |
| PCdb_2892 | 37346168 | Solyc10g044680 | Tomato protein Solyc10g044680 (unknown function) | CTAAATATGGTCATGGTTGT | TGG | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2893 | 37346168 | Solyc05g008250 | Tomato protein Solyc05g008250 (uncharacterized) | CTAAACATGGTGAAGGTTGC | TGG | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2894 | 26842992 | GRMZM2G083935 (Hsg2) | Maize genome reference GRMZM2G083935 (Heat shock protein gene Hsg2) [Source: MaizeGDB] | cgtgggcccgctccagctga | tgg | Zea mays L. | 19-31% | protoplast | CRISPR-Cas9 |
| PCdb_2895 | 38925598 | LOC_Os06g06260 | taste quality | CGTCGTCGGCAGCGTGCTGG | TGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_2896 | 29061908 | SlORRM4 | Organellar RNA recognition motif protein SlORRM4 | CGTCCTGGAGGATTCGGGCG | TGG | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2897 | 37191128 | not found | not found | CGTCCTCTCGTGGATCC | TGG | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2898 | 32786122 | Ms26 | Pollen-specific cytochrome P450 fatty acid hydroxylase (Ms26) | CGTCCTCCTCTCGTGGATCC | TGG | Setaria viridis (L.) P. Beauv. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2899 | 31694550 | PDS | Phytoene desaturase | CGTCCGATCCATTCCTCTGC | TGG | Triticum aestivum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2900 | 31452351 | Glyma.16G176800 | WRKY transcription factor (Glyma.16G176800) [Source: SoyBase] | CGTCATCAACGATACTCCAG | TGG | Glycine max (L.) Merr. | 0.592 | hairy root | CRISPR-Cas9 |
| PCdb_2901 | 24836556 | ADH1 | Alcohol dehydrogenase 1, converts acetaldehyde to ethanol during fermentation | CGTATCTTCGCCCATGAAGC | TGG | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2902 | 32528496 | qSH1 | qSH1 seed shattering QTL (domestication trait) | cgggtagggttcggcgatga | TGG | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2903 | 27579989 | DM2c promoter to exon 1 | DM2 gene (c variant) promoter through exon 1 sequence | CGGCTAAGCAATCTGATATG | TGG | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2904 | 37346168 | Solyc05g052850 | Tomato protein Solyc05g052850 (uncharacterized) | CGGCGACGGAGGATGTAGTT | TGG | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2905 | 25232936 | DEP1 | Encodes a G-protein subunit that regulates panicle architecture, grain length, and yield in rice. | CGGCCGGCGGCGGATGCAGC | TGG | Oryza sativa L. | not found | protoplast | not found |
| PCdb_2906 | 38925598 | LOC_Os11g38900 | taste quality | CGGCCAAAGCGTGTGCCTGA | TGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_2907 | 29250878 | BnCLV1 | CLAVATA1 receptor-like kinase | CGGAGAGATTCTCACTCCCA | TGG | Brassica napus L. | 0.05 | seed | CRISPR-Cas9 |
| PCdb_2908 | 32841372 | BnCLV1 | regulates seed production | CGGAGAGATTCTCACTCCCA | TGG | Brassica napus L. | not found | seed | CRISPR-Cas9 |
| PCdb_2909 | 38925598 | LOC_Os06g04930 | taste quality | CGCTGCTTTCAGCCCGGCAA | TGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_2910 | 36070109 | TraesCS5A02G473800 | Wheat protein kinase (TraesCS5A02G473800, signal transduction) | CGCTACGGCCACACACCCCG | TGG | Triticum aestivum L. | 0.77 | leaf | not found |
| PCdb_2911 | 31694550 | PDS | Phytoene desaturase | CGCGCTAACTAGCTACAACT | TGG | Triticum aestivum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2912 | 38925598 | LOC_Os11g31330 | taste quality | CGCCGTAGCAACCGTGTTGC | TGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_2913 | 32595669 | PPR756 | loss of function of which could influence the activities of the mitochondrial electron transport chain complexes and result in dysfunctional pollen. | CGCCCGAAACGAGTACTCC | TGG | Oryza sativa L. | not found | Mitochondrion | not found |
| PCdb_2914 | 37346168 | Solyc02g088190 | Tomato protein Solyc02g088190 (uncharacterized) | CGCAGCTAACCTTAGCCACA | TGG | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2915 | 28066464 | DIPM | Disease-Interacting Protein Module (likely involved in plant-pathogen interactions) | CGATTGGCTGGTGAGGTAAT | TGG | Vitis vinifera L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2916 | 28790350 | BnaC5.DA1 | Ubiquitin receptor DA1 homolog | CGATGGACGGAAACTTTGCC | TGG | Brassica napus L. | 1 | protoplast | CRISPR-Cas9 |
| PCdb_2917 | 32448919 | BnaFAD2 | Fatty acid desaturase 2 | CGACGCCACCATTCCAACAC | TGG | Brassica napus L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2918 | 34713242 | OsMPK5 | Oryza sativa mitogen-activated protein kinase 5 (OsMPK5, stress signaling) | CGACATGATGACGGAGTACG | TGG | Oryza sativa L. | 0.45 | calli | CRISPR-xCas9 |
| PCdb_2919 | 31545544 | OsMPK5 | Mitogen-activated protein kinase 5 (defense responses) | CGACATGATGACGGAGTACG | TGG | Oryza sativa L. | 0.143 | seed | CBE |
| PCdb_2920 | 30588320 | NAC1 | a new positive regulator of tomato fruit ripening | CGAAATCCAGGTGGCAATTG | TGG | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2921 | 27579989 | NbPAD4 (exon 2) | Phytoalexin-deficient 4 exon 2 fragment (salicylic acid signaling) [Source: SolGenomics] | CGAAACGTTGGCAGCTTTTG | TGG | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2922 | 31752697 | Waxy | Granule-bound starch synthase determining amylose content | CCTTCTCCAGGAATGACGGA | TGG | Oryza sativa L. | 0.45 | calli | CBE |
| PCdb_2923 | 38925598 | LOC_Os05g45420 | taste quality | CCTCTTGGCGGTTACCGGAT | TGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_2924 | 35385977 | qKRN5.04 | qKRN5.04 kernel row number QTL (yield trait) | CCTCGGTTGGATCTTAAGTTATC | TGG | Zea mays L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2925 | 29807545 | GFP | GFP (Green Fluorescent Protein, Aequorea victoria, transformation control) [Source: Addgene] | CCTCATGAACATTCAGGAGC | TGG | Oryza sativa L. | 0.0022 | protoplast | ABE |
| PCdb_2926 | 31634585 | ALS | Acetolactate synthase (branched-chain amino acid biosynthesis) | CCTCATGAACATTCAGGAGC | TGG | Oryza sativa L. | 0.96 | calli | ABE |
| PCdb_2927 | 33810044 | not found | not found | CCTCAGCTACCTCTCC | TGG | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2928 | 31694550 | PDS | Phytoene desaturase | CCTCAAGCACTATGGGTTTG | TGG | Triticum aestivum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2929 | 36892416 | FT and TFL1CENBFT family | TFL1 (Terminal Flower 1, phosphatidylethanolamine-binding protein family) [Source: UniProt] | CCTAAAGTTGAGGTCCATGG | TGG | Populus 脳 canescens 'INRA 717-1B8' | not found | seed | CRISPR-Cas9 |
| PCdb_2930 | 31694550 | PDS | Phytoene desaturase | CCGGACTACTTGCTTCAGTA | TGG | Triticum aestivum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2931 | 38925598 | LOC_Os04g35000 | taste quality | CCGCTGCTTCGCTCCAGACG | TGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_2932 | 32117329 | AT5G28770 | Arabidopsis thaliana gene AT5G28770 (uncharacterized protein) | CCCTTTATGGTAGAGGACGT | TGG | Arabidopsis thaliana (L.) Heynh. | not found | seed | CRISPR-Cas9 |
| PCdb_2933 | 34343415 | LG1 | LIGULELESS1 (leaf patterning regulatory gene) [Source: MaizeGDB] | CCCTTCTCTGCTCCCAATCA | TGG | Hemisorghum C.E.Hubb. ex Bor | 0.007 | seed | CRISPR-Cas9 |
| PCdb_2934 | 31634585 | CDC48 | AAA-type ATPase involved in protein degradation | CCCTCAACAGTATCATCAAT | TGG | Oryza sativa L. | 0.25 | calli | ABE |
| PCdb_2935 | 38925598 | LOC_Os11g26750 | taste quality | CCCGGTGGGTGCGTTTCCGG | TGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_2936 | 33562315 | PIP1A | Plasma membrane intrinsic protein 1A (aquaporin) | CCCGGCGAGCTCAGCTCA | TGG | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2937 | 33562315 | PIP1A | Plasma membrane intrinsic protein 1A (aquaporin) | CCCGGCGAGCTCAAATCT | TGG | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2938 | 31452351 | Glyma.19G030400 | MYB transcription factor (Glyma.19G030400) [Source: SoyBase] | CCCATGGTGAATTTGGAAGG | TGG | Glycine max (L.) Merr. | 0.592 | hairy root | CRISPR-Cas9 |
| PCdb_2939 | 31452351 | Glyma.15G052200 | DREB transcription factor (Glyma.15G052200) [Source: SoyBase] | CCCAGCACCAGCACCGTCAG | TGG | Glycine max (L.) Merr. | 0.592 | hairy root | CRISPR-Cas9 |
| PCdb_2940 | 31694550 | PDS | Phytoene desaturase | CCATTACAGGTCGTGATTGC | TGG | Triticum aestivum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2941 | 33710467 | PDS | Phytoene desaturase | CCATTACACCTCCTCATTGC | TGG | Triticum aestivum L. | not found | protoplast | cpf1 |
| PCdb_2942 | 35481148 | BnVTE4 | Tocopherol methyltransferase (VTE4) | CCATGGGAGCAGAACCTC | TGG | Brassica napus L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2943 | 33751803 | Waxy | Granule-bound starch synthase (Waxy, starch biosynthesis) | CCATAAGTTCCTTTGAAGTA | TGG | Oryza sativa L. | 0.733 | calli | ABE |
| PCdb_2944 | 34884871 | SpDIR1L | Implicated in S-RNase-Independent Pollen Rejection | CCAGTGCAGATTCCTTTTGTG | TGG | Solanum sect. Pachyphylla | not found | protoplast | CRISPR-Cas9 |
| PCdb_2945 | 31694550 | PDS | Phytoene desaturase | CCAGCAATCACGACCTGTAA | TGG | Triticum aestivum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2946 | 38925598 | LOC_Os02g33430 | taste quality | CCAGAGACTGGAGTGAGCAT | TGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_2947 | 35099564 | not found | not found | CCAGACCTTATCATTAATGCG | TGG | Zea mays L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2948 | 30287957 | SOV1 | SUPPRESSOR OF VARIEGATION 1 (SOV1, leaf patterning) | CCAGACAAAATAAGACAACC | TGG | Physalis pruinosa L. | not found | leaf | CRISPR-Cas9 |
| PCdb_2949 | 27579989 | DM2Ler right | DM2 gene right flanking region in Arabidopsis Landsberg erecta ecotype | CCACTGTTAGGCATGCATGA | TGG | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2950 | 33557889 | Gh_A05G2316 | Gh_A05G2316 (Gossypium hirsutum peroxidase 72, cell wall reinforcement) [Source: CottonGen] | CCACAGGAATAGTAACTCGA | TGG | Gossypium hirsutum L. | 0.5889 | seed | CRISPR-Cas9 |
| PCdb_2951 | 29807545 | GFP | GFP (Green Fluorescent Protein, Aequorea victoria, transformation control) [Source: Addgene] | CCAATGCATCCGTGAGAAGA | TGG | Oryza sativa L. | 0.005 | protoplast | ABE |
| PCdb_2952 | 38925598 | LOC_Os08g36440 | taste quality | CCAAGGTTGACGACGAGCAG | TGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_2953 | 33557889 | Gh_A06G1509 | Gh_A06G1509 (Gossypium hirsutum chitinase, pathogenesis-related) [Source: CottonGen] | CCAAGCTTCGACCGATCAGA | TGG | Gossypium hirsutum L. | 0.5889 | seed | CRISPR-Cas9 |
| PCdb_2954 | 40040541 | ACS4 | 1-Aminocyclopropane-1-carboxylate synthase isoform 4 involved in ethylene biosynthesis during fruit development and stress signaling. | CCAACTTTCAAGATTATCA | TGG | Solanum lycopersicum L. | not found | protoplast | CRISPR/Cas9 |
| PCdb_2955 | 40040541 | ACS2 | 1-Aminocyclopropane-1-carboxylate synthase catalyzing the rate-limiting step in ethylene biosynthesis, regulating fruit ripening and stress responses. | CCAACTTTCAAGATTATCA | TGG | Solanum lycopersicum L. | not found | protoplast | CRISPR/Cas9 |
| PCdb_2956 | 31713832 | not found | Gene not detected or not annotated in the database | CCAAATCAGCTCATTACTAA | TGG | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2957 | 31694550 | PDS | Phytoene desaturase | CATTTCATTGTTTTTCAGTA | TGG | Triticum aestivum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2958 | 38925598 | LOC_Os09g20340 | taste quality | CATTGCTCTAAGGCAGTTTG | TGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_2959 | 33557889 | Gh_A05G0975 | Gh_A05G0975 (Gossypium hirsutum sucrose-phosphate synthase, carbohydrate metabolism) [Source: CottonGen] | CATTCTCCTCATCGTTGTTG | TGG | Gossypium hirsutum L. | 0.5889 | seed | CRISPR-Cas9 |
| PCdb_2960 | 26022141 | Glyma08g02290 | Unknown protein | CATTCCAGAAGGTGGATCCC | TGG | Glycine max (L.) Merr. | 0.592 | hairy root | CRISPR-Cas9 |
| PCdb_2961 | 35164736 | not found | not found | CATGGGGCAAACTAATGGAT | TGG | Oryza sativa L. | not found | protoplast | not found |
| PCdb_2962 | 35164736 | GhCLA | GhCLA (Gossypium hirsutum 1-deoxy-D-xylulose 5-phosphate synthase, chloroplast development) [Source: CottonGen] | CATGGGGCAAACTAATGGAT | TGG | Gossypium hirsutum L. | not found | protoplast | Base editor |
| PCdb_2963 | 28066464 | DIPM | Disease-Interacting Protein Module (likely involved in plant-pathogen interactions) | CATGGATGAGGGACGACGAT | TGG | Vitis vinifera L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2964 | 38925598 | LOC_Os02g03800 | taste quality | CATGCAGCAGACAGCAACCA | TGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_2965 | 26842991 | FGS | FGS (Arabidopsis thaliana FATTY ACID ELONGASE86, very-long-chain fatty acid biosynthesis) [Source: TAIR] | CATGAACTGTCTGAATCAGC | TGG | Zea mays L. | 0.66 | protoplast | CRISPR-Cas9 |
| PCdb_2966 | 31782599 | Waxy | Granule-bound starch synthase determining amylose content | CATCGACCATCCGTCATTCC | TGG | Oryza sativa L. | 14.6-85.4% | seed | ABE |
| PCdb_2967 | 33751803 | Waxy | Granule-bound starch synthase (Waxy, starch biosynthesis) | CATCGACCATCCGTCATTCC | TGG | Oryza sativa L. | 0.36 | calli | ABE |
| PCdb_2968 | 25733849 | MPK1 | Mitogen-activated protein kinase 1 (growth regulation) [Source: TAIR] | CATCCAGGCGACGCTGAG CCA | TGG | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2969 | 31694550 | PDS | Phytoene desaturase | CATACCTGCTGAAAAGAAGG | TGG | Triticum aestivum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2970 | 29331077 | AcPDS | Phytoene desaturase | CAGGTCTGTCCCATCAAAGATTGG | TGG | Actinidia chinensis Planch. | 0.0833 | leaf | CRISPR-Cas9 |
| PCdb_2971 | 38925598 | LOC_Os04g33870 | taste quality | CAGGAAGCGGGCGCGCGCCG | TGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_2972 | 38310724 | EPSPS | Confer herbicide resistance | CAGCTCTTGGGAATGC | TGG | Zea mays L. | not found | seed | CRISPR/Cas9 |
| PCdb_2973 | 33890635 | GRAS | essential for stamen and runner formation in wild Fragaria L. | CAGCGATAACGCGCTAGAGG | TGG | Fragaria vesca L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2974 | 35755703 | not found | not found | CAGCAGCCGAATTTACCGCC | TGG | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2975 | 38925598 | LOC_Os03g03810 | taste quality | CAGCAGCACCATGAGAAGCA | TGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_2976 | 29051769 | OsGIF1 | Positively Regulates the Sizes of Stems, Leaves, and Grains in Rice | CAGCACAATTACCTGGGACA | TGG | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2977 | 27148303 | Rep-A of alphasatellite | Alphasatellite replication-associated protein (Rep-A, viral replication) | CAGATGACCGCACTATCTTC | TGG | Gossypium hirsutum L. | not found | germplasm | CRISPR-Cas9 |
| PCdb_2978 | 32841372 | BnALC | regulates seed production | CAGACGTTAGCCGCTATGAA | TGG | Brassica napus L. | not found | seed | CRISPR-Cas9 |
| PCdb_2979 | 31694550 | PDS | Phytoene desaturase | CAGAATTTGTTTGCTGAGCT | TGG | Triticum aestivum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2980 | 27579989 | NbPAD4 (exon 2) | Phytoalexin-deficient 4 exon 2 fragment (salicylic acid signaling) [Source: SolGenomics] | CACTTCGCCGTGATTAAAGT | TGG | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2981 | 35043178 | SIDELLA | Tomato DELLA protein (gibberellin signaling) | CACTTATAGCTACCTCCGCC | TGG | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9,Base editor,Target-AID |
| PCdb_2982 | 28346401 | AID | Auxin-induced protein 1 | CACTTATAGCTACCTCCGCC | TGG | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2983 | 31452351 | Glyma.05G032200 Glyma.17G094400 | DREB transcription factor (Glyma.05G032200 & Glyma.17G094400) [Source: SoyBase] | CACTCTGGGACAAGGAAACG | TGG | Glycine max (L.) Merr. | 0.592 | hairy root | CRISPR-Cas9 |
| PCdb_2984 | 27579989 | NbPAD4 (exon 34) | Phytoalexin-deficient 4 exon 34 fragment (salicylic acid signaling) [Source: SolGenomics] | CACTCTATCTGTGCTCTTAG | TGG | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2985 | 31852439 | GmLHY | alters plant height and internode length | CACGTTGTTGATGGGAACCT | tgg | Glycine max (L.) Merr. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2986 | 31852439 | GmLHY | alters plant height and internode length | CACGTTGTTGACGGGAACCT | tgg | Glycine max (L.) Merr. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2987 | 37346168 | Solyc03g112390 | Tomato protein Solyc03g112390 (uncharacterized) | CACGTGGATTCGTATTGGAT | TGG | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2988 | 31316687 | SCR | GRAS family transcription factor SCARECROW | CACGTGCGACTCACGGGACT | TGG | Arabidopsis thaliana (L.) Heynh. | not found | seed | CRISPR-Cas9 |
| PCdb_2989 | 28066464 | DIPM | Disease-Interacting Protein Module (likely involved in plant-pathogen interactions) | CACGGGGAAGTGTCCCTCCG | TGG | Vitis vinifera L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2990 | 31694550 | PDS | Phytoene desaturase | CACGACCTGTAATGGTTTAC | TGG | Triticum aestivum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2991 | 32752068 | not found | not found | CACCGTCGAGGGCTACCCCG | TGG | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2992 | 30894127 | TMS5 | Thermosensitive genic male sterility gene | CACCGTCGAGGGCTACCCCG | TGG | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2993 | 34984801 | OsGBSSI | Granule-bound starch synthase I | CACCGGCATCGTCAACGGCA | TGG | Oryza sativa L. | not found | protoplast | CRISPR-Cas9,Base editor |
| PCdb_2994 | 34713257 | PDS | Phytoene desaturase (PDS, carotenoid biosynthesis) | CACCACCGCCAAGATCACCA | TGG | Saccharum officinarum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2995 | 31694550 | PDS | Phytoene desaturase | CACCACCCAAAGACTGAATG | TGG | Triticum aestivum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2996 | 32528496 | qSH1 | qSH1 seed shattering QTL (domestication trait) | caccaaatgctaaggatctt | TGG | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2997 | 35099564 | not found | not found | CACATTGACCTTGTATTGCC | TGG | Zea mays L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2998 | 36968417 | ZmG6PDH1 | enhances cold stress tolerance | CACACTGAAGGGTAGACAGA | TGG | Zea mays L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_2999 | 29807545 | GFP | GFP (Green Fluorescent Protein, Aequorea victoria, transformation control) [Source: Addgene] | CACACACACACTAGTACCTC | TGG | Oryza sativa L. | 0.0335 | protoplast | ABE |
| PCdb_3000 | 29867128 | AtALS & AtPDS & AtFT & AtLFY | Acetolactate synthase (ALS), Phytoene desaturase (PDS), Flowering locus T (FT), and Leafy (LFY) - Multiple gene targets for plant genetic studies | CACACACACACACTCGAGAT | TGG | Arabidopsis thaliana (L.) Heynh. | 0.0555 | protoplast | ABE |
| PCdb_3001 | 30287957 | SP5G | SELF-PRUNING 5G (SP5G, flowering time regulation) | CACAAGTTGTCAACCAACCT | TGG | Physalis pruinosa L. | not found | leaf | CRISPR-Cas9 |
| PCdb_3002 | 37346168 | Solyc09g010840 | Tomato protein Solyc09g010840 (uncharacterized) | CACAAACTCTTCTTCCTCCG | TGG | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_3003 | 36968183 | SlDCD2 | participates in tomato fruit ripening | CAATGGCAGCAGCCAAGAAA | TGG | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_3004 | 30669298 | StALS | Potato acetolactate synthase (StALS, branched-chain amino acid biosynthesis) | CAAGTGCCGAGGAGGATGAT | TGG | Solanum tuberosum L. | 0.552 | protoplast | not found |
| PCdb_3005 | 28790350 | BnaA6.RGA | DELLA protein RGA homolog | CAAGGTTAGGTCTTCGGAGA | TGG | Brassica napus L. | 0.633 | protoplast | CRISPR-Cas9 |
| PCdb_3006 | 28790350 | BnaC9.RGA | DELLA protein RGA homolog | CAAGGTGAGGTCGTCAGAGA | TGG | Brassica napus L. | 1 | protoplast | CRISPR-Cas9 |
| PCdb_3007 | 31284391 | bnaMLPKs | M-locus protein kinase | CAAGGTCATCAAGAATGGC | TGG | Brassica napus L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_3008 | 34834905 | FAD2 | FAD2 (Fatty acid desaturase 2, EC 1.14.19.2, linoleic acid biosynthesis) [Source: UniProt] | CAAGCCCCTTTGAAAATTAA | TGG | Glycine max (L.) Merr. | not found | protoplast | CRISPR-Cas9 |
| PCdb_3009 | 34834905 | FAD2 & FATB | Fatty acid desaturase & Acyl-ACP thioesterase | CAAGCCCCTTTGAAAATTAA | TGG | Glycine max (L.) Merr. | 0.592 | hairy root | CRISPR-Cas9 |
| PCdb_3010 | 26842992 | Zmzb7 | Zinc-binding protein 7 (metalloprotein) | CAAGATGCTATGTATCAGC | tgg | Zea mays L. | 19-31% | protoplast | CRISPR-Cas9 |
| PCdb_3011 | 29569825 | zb7 | Zinc-binding protein 7 (zb7, metal homeostasis) | CAAGATGCTATGTATCAGC | TGG | Zea mays L. | 0.66 | calli | CRISPR-Cas9 |
| PCdb_3012 | 32841372 | BnIND | regulates seed production | CAAGAACTTGGTGTAGCGGA | TGG | Brassica napus L. | not found | seed | CRISPR-Cas9 |
| PCdb_3013 | 30287957 | SOV1 | SUPPRESSOR OF VARIEGATION 1 (SOV1, leaf patterning) | CAAGAAAATCTTCCAAGAAG | TGG | Physalis pruinosa L. | not found | leaf | CRISPR-Cas9 |
| PCdb_3014 | 36959937 | OsEPSPS | 5-Enolpyruvylshikimate-3-phosphate synthase | CAACTCTTCTTGGGGAACGCTGG | TGG | Oryza sativa L. | 0.428571429 | dried seeds | not found |
| PCdb_3015 | 35710302 | not found | not found | CAACCTCGCGTCGAAATG | TGG | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_3016 | 32394708 | LOC106393678] | Hypothetical protein LOC106393678 (uncharacterized) | CAACAGCACTTCTTGTCCAA | TGG | Brassica napus L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_3017 | 37346168 | Solyc01g102340 | Tomato protein Solyc01g102340 (uncharacterized) | CAAATTGCAGCTAGATTACC | TGG | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_3018 | 27353960 | CBF2 | C-repeat binding factor 2 | CAAACAAGAAAACCAGGATT | TGG | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_3019 | 34905186 | not found | not found | CAAAAGTAGTCTGATATATA | TGG | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | not found |
| PCdb_3020 | 31694550 | PDS | Phytoene desaturase | CAAAAGGCTGGATAAGTTGG | TGG | Triticum aestivum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_3021 | 32001363 | OsALS1 | Acetolactate synthase involved in branched-chain amino acid biosynthesis [Source: RiceWiki] | AUCAGCUCCAGUGGGCGAGG | TGG | Oryza sativa L. | not found | calli | CBE |
| PCdb_3022 | 34713227 | OsALS | Acetolactate synthase involved in branched-chain amino acid biosynthesis [Source: RiceWiki] | ATTTGGGTATGGTGGTGCAA | TGG | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_3023 | 36457532 | not found | not found | ATTTGGGCATGGTTCAG | TGG | Glycine max (L.) Merr. | 0.592 | hairy root | CRISPR-Cas9 |
| PCdb_3024 | 31452351 | Glyma.15G211800 Glyma.15G210400 | Heat shock protein (Glyma.15G211800 & Glyma.15G210400) [Source: SoyBase] | ATTTGATAGGTGAGAATGGT | TGG | Glycine max (L.) Merr. | 0.592 | hairy root | CRISPR-Cas9 |
| PCdb_3025 | 37176936 | FtsZ1 | FtsZ1 (Filamenting temperature-sensitive mutant Z 1, chloroplast division) [Source: UniProt] | ATTGGAGAACTTCTGACTCG | TGG | Solanum tuberosum L. | 0.92 | protoplast | CRISPR-Cas9 |
| PCdb_3026 | 33557889 | Gh_A07G0469 | Gh_A07G0469 (Gossypium hirsutum MYB transcription factor, fiber development) [Source: CottonGen] | ATTGAACCCATCATTACGCC | TGG | Gossypium hirsutum L. | 0.5889 | seed | CRISPR-Cas9 |
| PCdb_3027 | 30585636 | ADR1 | Activated Disease Resistance 1 (CC-NB-LRR protein) | ATTCCGTGGTTGTGGTGTC | TGG | Arabidopsis thaliana (L.) Heynh. | not found | Cytosol | CRISPR-Cas9 |
| PCdb_3028 | 29036337 | CLE23 | CLE-Peptide-Encoding Genes | ATTCCCTTCGTCTCCAATTG | TGG | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_3029 | 34764970 | FAD2 | Enhances Oleic Acid Production | ATTCAGCGACTACCAATGGC | TGG | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | Base editor |
| PCdb_3030 | 37346168 | Solyc08g082890 | Tomato protein Solyc08g082890 (uncharacterized) | ATTCACTTCTGGGTAATCGT | TGG | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_3031 | 29884615 | PYRABACTIN RESISTANCE1-LIKE (PYL) | PYRABACTIN RESISTANCE1-LIKE ABA receptor (PYL, abscisic acid signaling) | ATTATGGAGCTAAGTGAGAG | TGG | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_3032 | 27579989 | DM2h exon 3 | DM2 gene (h variant) exon 3 sequence | ATTATACAGTTCAGTTACGA | TGG | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_3033 | 31316687 | WER | GRAS family transcription factor WEREWOLF | ATTAGGCTCCACAAGTTGCT | TGG | Arabidopsis thaliana (L.) Heynh. | not found | seed | CRISPR-Cas9 |
| PCdb_3034 | 37346168 | Solyc11g011050 | Tomato protein Solyc11g011050 (unknown function) | ATTAGCGCAATTCGTTGCCA | TGG | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_3035 | 31109137 | SNF | symbiotic nitrogen fixation | ATTACACAACAGATTACACA | TGG | Vigna unguiculata (L.) Walp. | not found | protoplast | CRISPR-Cas9 |
| PCdb_3036 | 30565255 | OsNAL1 | Narrow leaf 1, affects leaf width and vascular patterning | ATGTCTCTGCAAATCCATAA | TGG | Oryza sativa L. | 0.675 | protoplast | not found |
| PCdb_3037 | 34830019 | ZmThx 20 | Homeobox transcription factor 20 (developmental regulation) | ATGTACCGCAAGAAACACCG | tgg | Zea mays L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_3038 | 30928637 | OsPDS | Oryza sativa phytoene desaturase (OsPDS, carotenoid biosynthesis) | ATGGTTTTACTGTTTCTGAG | TGG | Oryza sativa L. | not found | protoplast | xCas9 |
| PCdb_3039 | 29331077 | AcPDS | Phytoene desaturase | ATGGTTTAACTGTTAAAGACTGG | TGG | Actinidia chinensis Planch. | 0.7692 | leaf | CRISPR-Cas9 |
| PCdb_3040 | 27530958 | PDS | Phytoene desaturase (PDS, carotenoid biosynthesis) | ATGGCTTGAGCGTAAAAGAC | TGG | Malus x domestica Bork. | 0.318 | leaf | CRISPR-Cas9 |
| PCdb_3041 | 31694550 | PDS | Phytoene desaturase | ATGGCTTAACTGTTTCCGAA | TGG | Triticum aestivum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_3042 | 27317309 | not found | not found | ATGGCTCACGAGATGATGGG | TGG | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_3043 | 31316687 | GL1 | R2R3-MYB transcription factor GLABRA1 | ATGGACTATGTTCTTAATCA | TGG | Arabidopsis thaliana (L.) Heynh. | not found | seed | CRISPR-Cas9 |
| PCdb_3044 | 30236054 | SAPK 1 | Stress-activated kinase involved in abiotic stress response | ATGGAATATGCTGCTGG | TGG | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_3045 | 34236584 | MS1 | regulating the microsporocyte cell plate expansion | ATGCTTCAGGTACGCCGGG | tgg | Glycine max (L.) Merr. | not found | protoplast | CRISPR-Cas9 |
| PCdb_3046 | 30287957 | SP | SELF-PRUNING (SP, determinacy control) | ATGATAGATCCAGATGTTCC | TGG | Physalis pruinosa L. | not found | leaf | CRISPR-Cas9 |
| PCdb_3047 | 26193631 | PtoPDS | Tomato phytoene desaturase (PtoPDS, carotenoid biosynthesis) | ATGAGTGCATTGAACTTGAGC | TGG | Populus sp. | 0.517 | leaf | CRISPR-Cas9 |
| PCdb_3048 | 33950284 | OsCOP 1 | regulates embryo development and flavonoid biosynthesis in rice | ATGAGGGTATAGTAACTGTT | tgg | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_3049 | 34608972 | GAI | GAI (DELLA) growth repressor | ATGAGCTTCTAGCTGTTCT | TGG | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_3050 | 36105709 | inactivation of the kauniolide synthase | Kauniolide synthase (sesquiterpene lactone biosynthesis) [Source: NCBI] | ATGAAGAAGATCGTCACCA | TGG | Cichorium intybus L. | not found | root | CRISPR-Cas9 |
| PCdb_3051 | 31452351 | Glyma.11G125500 Glyma.12G050100 Glyma.15G027900 | Heat shock protein (Glyma.11G125500, Glyma.12G050100, Glyma.15G027900) [Source: SoyBase] | ATGAACTTTGATACCTATGC | TGG | Glycine max (L.) Merr. | 0.592 | hairy root | CRISPR-Cas9 |
| PCdb_3052 | 26842991 | FGS | FGS (Arabidopsis thaliana FATTY ACID ELONGASE81, very-long-chain fatty acid biosynthesis) [Source: TAIR] | ATCTTGATATTTGCTGGAGC | TGG | Zea mays L. | 0.0209 | protoplast | CRISPR-Cas9 |
| PCdb_3053 | 33557889 | Gh_A06G1509 | Gh_A06G1509 (Gossypium hirsutum chitinase, pathogenesis-related) [Source: CottonGen] | ATCTGCCTCGAAAGGCTTGG | TGG | Gossypium hirsutum L. | 0.5889 | seed | CRISPR-Cas9 |
| PCdb_3054 | 31452351 | Glyma.09G137000 Glyma.20G160200 Glyma.10G234100 Glyma.16G182400 | WRKY transcription factor (Glyma.09G137000, Glyma.20G160200, Glyma.10G234100, Glyma.16G182400) [Source: SoyBase] | ATCTGCAAAGCCCTTGAGGT | TGG | Glycine max (L.) Merr. | 0.592 | hairy root | CRISPR-Cas9 |
| PCdb_3055 | 31694550 | PDS | Phytoene desaturase | ATCTCTTGCCTCAAGCACTA | TGG | Triticum aestivum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_3056 | 27148303 | IR and Rep of CABs | Intergenic region and repetitive elements of chloroplast DNA [Source: NCBI] | ATCCGTATAATATTACCGGA | TGG | Gossypium hirsutum L. | not found | germplasm | CRISPR-Cas9 |
| PCdb_3057 | 34191398 | eCDAL | Engineered cytidine deaminase-activating enzyme (likely used in base editing systems) | ATCCCTTGCCTCAAGCAATA | TGG | Oryza sativa L. | 0.8 | calli | CBE |
| PCdb_3058 | 31728198 | pgUGT84A24 | Panax ginseng UGT84A24 glycosyltransferase (ginsenoside modification) | ATCCCGTGGGTGTCTGACG | TGG | Punica granatum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_3059 | 27148303 | IR and Rep of CABs | Intergenic region and repetitive elements of chloroplast DNA [Source: NCBI] | ATCCCGCCTTTAATTTGAAC | TGG | Gossypium hirsutum L. | not found | germplasm | CRISPR-Cas9 |
| PCdb_3060 | 33339449 | miR818b | MicroRNA (rice-specific, function unknown) | ATCCAAAATCCCTTATATTA | TGG | Oryza sativa L. | 0.105 | protoplast | not found |
| PCdb_3061 | 31452351 | Glyma.04G017400 Glyma.06G017800 | FAD-binding oxidoreductase (Glyma.04G017400 & Glyma.06G017800) [Source: SoyBase] | ATCATCTGCTGCTACCATGA | TGG | Glycine max (L.) Merr. | 0.592 | hairy root | CRISPR-Cas9 |
| PCdb_3062 | 28640983 | GABA | Gamma-aminobutyric acid (GABA) receptor | ATCATCCATGCCGCAGAAAAT | TGG | Solanum lycopersicum L. | 0.61 | leaf | CRISPR-Cas9 |
| PCdb_3063 | 37346168 | Solyc10g055410 | Tomato protein Solyc10g055410 (unknown function) | ATCAAACTCCATAGCCTCCT | TGG | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_3064 | 37346168 | Solyc01g111500 | Tomato protein Solyc01g111500 (uncharacterized) | ATCAAACTCCATAGCCTCCT | TGG | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_3065 | 33339449 | miR816 | MicroRNA (rice-specific, function unknown) | ATATTTTACTACAACGAATC | TGG | Oryza sativa L. | 0.03 | protoplast | not found |
| PCdb_3066 | 28790350 | BnaFUL | FRUITFULL MADS-box transcription factor | ATATTCGAAGAGTTTGCCTT | TGG | Brassica napus L. | BnaA9.FUL:76.2%, BnaC2.FUL: 76.2%, BnaC7.FUL:76.2% | protoplast | CRISPR-Cas9 |
| PCdb_3067 | 31694550 | PDS | Phytoene desaturase | ATATGTTTTTTCTTTTCAGT | TGG | Triticum aestivum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_3068 | 37018323 | PDS | Phytoene desaturase (PDS, carotenoid biosynthesis) | ATATGTGTCTGGCGCCAAGC | TGG | Vigna unguiculata (L.) Walp. | not found | protoplast | CRISPR-Cas9 |
| PCdb_3069 | 37636104 | f2kp1 | EXPA11 (Expansin A11, cell wall loosening protein) [Source: UniProt] | AGTTTGTGGAAGTAATGAGG | TGG | Oryza sativa L. | not found | not found | CRISPR-Cas9 |
| PCdb_3070 | 38925598 | LOC_Os12g05680 | taste quality | AGTTGGGCAAGGTGGTGCCA | TGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_3071 | 31965382 | OsPDS | Oryza sativa phytoene desaturase (OsPDS, carotenoid biosynthesis) | AGTTGCTTCAGCATGGATAC | TGG | Oryza sativa L. | not found | protoplast | CRISPR-Cas9,CRISPR-Cas12 |
| PCdb_3072 | 37346168 | Solyc10g081320 | Tomato protein Solyc10g081320 (unknown function) | AGTTATGTGCTAGAGGTCAT | TGG | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_3073 | 34753955 | not found | not found | AGTTATGCTGTGGAGTATCG | TGG | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_3074 | 27543262 | not found | not found | AGTTATGCTGTGGAGTATCG | TGG | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_3075 | 37346168 | Solyc08g081500 | Tomato protein Solyc08g081500 (uncharacterized) | AGTGAAGTCCCTGAAAAAGC | TGG | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_3076 | 28905515 | VvWRKY52 | Vitis vinifera WRKY transcription factor 52 (VvWRKY52, defense response) | AGTCTCCACGCTCGCTCAG | TGG | Vitis vinifera L. | 0.25 | protoplast | CRISPR-Cas9 |
| PCdb_3077 | 33931634 | VvbZIP36 | Vitis vinifera bZIP transcription factor 36 (VvbZIP36, stress signaling) | AGTCTCCACGCTCGCTCAG | TGG | Vitis vinifera L. | not found | calli | CRISPR-Cas9 |
| PCdb_3078 | 30887096 | se14-1 | Photoperiod sensitivity mutant affecting flowering time | AGTCTCAACTTCCTCCACAC | TGG | Oryza sativa L. | not found | leaf | CRISPR-Cas9 |
| PCdb_3079 | 31394891 | SCL30a | Alternative isoform of SCL30 | AGTCCCCCTAGGAGGGGATA | TGG | Oryza sativa L. | not found | callus | CRISPR-Cas9 |
| PCdb_3080 | 31394891 | SCL30 | RNA splicing modulator protein | AGTCCCCCTAGGAGGGGATA | TGG | Oryza sativa L. | not found | callus | CRISPR-Cas9 |
| PCdb_3081 | 38925598 | LOC_Os04g51330 | taste quality | AGTCATTGCCCAGCTCGCCA | TGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_3082 | 31694550 | PDS | Phytoene desaturase | AGTCATCGTACGACCTCCCT | TGG | Triticum aestivum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_3083 | 33449143 | not found | not found | AGGTTCAGGAATAGGTGGAT | TGG | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_3084 | 30887096 | hd3a-2 | Heading date 3a, florigen protein promoting flowering | AGGTTAGGGTCACTTGGGCT | TGG | Oryza sativa L. | not found | leaf | CRISPR-Cas9 |
| PCdb_3085 | 33934485 | not found | not found | AGGTGGTGTTGGAGTGCGTG | TGG | Zea mays L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_3086 | 34618074 | MIR164a | ncover their functional specialization in development | AGGTGAGTGACGATCGAGA | TGG | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_3087 | 35657510 | ROS | Reactive oxygen species (ROS, stress signaling) | AGGTGAGGTGGGTGATGTCG | TGG | Oryza sativa L. | not found | calli | not found |
| PCdb_3088 | 35906898 | not found | not found | AGGTCGGGGAGTGTTTGGGA | TGG | Oryza sativa L. | not found | seed | CRISPR-Cas9 |
| PCdb_3089 | 31450868 | PDS-1 | Phytoene desaturase | AGGGTGCTGGTAGGACATC | TGG | Arabidopsis thaliana (L.) Heynh. | 38.1-100% | seed | CRISPR-Cas9 |
| PCdb_3090 | 31450868 | PDS | Phytoene desaturase | AGGGTGCTGGTAGGACATC | TGG | Arabidopsis thaliana (L.) Heynh. | 38.1-100% | seed | CRISPR-Cas9 |
| PCdb_3091 | 28640983 | GABA | Gamma-aminobutyric acid (GABA) receptor | AGGGGGGAACGAGCCGCGCC | TGG | Solanum lycopersicum L. | 0.61 | leaf | CRISPR-Cas9 |
| PCdb_3092 | 30214055 | GBSS | GBSS (Granule-bound starch synthase, EC 2.4.1.242, amylose biosynthesis) [Source: UniProt] | AGGGCTGTTAACAAGCTTGA | TGG | Solanum tuberosum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_3093 | 35269730 | ZmPAT7 | Contributes to Tassel Branch Number | AGGGCTCAGAGTGAACCTCC | TGG | Zea mays L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_3094 | 27579989 | DM2c exon 2 | DM2 gene (c variant) exon 2 sequence | AGGGAAGTTACCTACCTTGC | TGG | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_3095 | 28824692 | GhEF1 | Elongation factor 1-alpha | AGGCTTGTCTGAAGGCCTCT | TGG | Gossypium hirsutum L. | 0.64 | cotyledon | CRISPR-Cas9 |
| PCdb_3096 | 33557889 | Gh_A07G2334 | Gh_A07G2334 (Gossypium hirsutum tubulin beta chain A07G2334) [Source: CottonGen] | AGGCAGCTCCACCCATCGTT | TGG | Gossypium hirsutum L. | 0.5889 | seed | CRISPR-Cas9 |
| PCdb_3097 | 33345374 | LOC101248269 | Hypothetical protein LOC101248269 [Source: NCBI] | AGGAGATGCGCATACTTCCGT | TGG | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_3098 | 37346168 | Solyc04g009950 | Tomato protein Solyc04g009950 (uncharacterized) | AGGACAATTGCGCCAATCGT | TGG | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_3099 | 36301462 | ZIM | regulating hypocotyl elongation | AGGAACAAGGCGATTCACGG | TGG | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_3100 | 36301462 | PIF4 | regulating hypocotyl elongation | AGGAACAAGGCGATTCACGG | TGG | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_3101 | 39172289 | OsIPK1 | Regulates grain phosphorus (Pi) homeostasis and starch synthesis; aimed at low phytic acid content while preserving starch accumulation. | agctttcgaccaagacagag | TGG | Oryza sativa L. | 0.192 | callus | CRISPR/Cas9 |
| PCdb_3102 | 31694550 | PDS | Phytoene desaturase | AGCTTCTTGTACCACAAGAG | TGG | Triticum aestivum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_3103 | 38925598 | LOC_Os08g16860 | taste quality | AGCTTCCTTGATCCAACATG | TGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_3104 | 31768121 | ELF3 | EARLY FLOWERING 3 (ELF3): circadian clock and photoperiodic flowering regulator | AGCTCCTCCTAGAAACAAGA | TGG | Arabidopsis thaliana (L.) Heynh. | 32-91% | protoplast | not found |
| PCdb_3105 | 30917862 | Glyma.19g164800 | Cinnamate 4-hydroxylase (Glyma.19g164800) [Source: SoyBase] | AGCGTGGCCTACGTGACGAG | TGG | Glycine max (L.) Merr. | not found | hairy root | CRISPR-Cas9 |
| PCdb_3106 | 29036337 | CLE1 | CLE-Peptide-Encoding Genes | AGCGAGTATGGAGAAGCTAA | TGG | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_3107 | 28066464 | DIPM | Disease-Interacting Protein Module (likely involved in plant-pathogen interactions) | AGCGACTACGCGGTCTTTAT | TGG | Vitis vinifera L. | 0.5-6.9% | protoplast | CRISPR-Cas9 |
| PCdb_3108 | 36559613 | BnaRFL 11 | RAF-like protein 11, putative signaling component in developmental processes | AGCCTCGTATCCCTCTGAGTCT | TGG | Brassica napus L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_3109 | 36559613 | orf222 | not found | AGCCTCGTATCCCTCTGAGTCT | TGG | Brassica napus L. | 31-96% | pollen grains | CRISPR-Cas9 |
| PCdb_3110 | 30603093 | SlEIN2 | Ethylene Insensitive2 membrane protein | AGCCCGATTTGGGTTTGATT | TGG | Solanum lycopersicum L. | 0.27 | Germ Cells | CRISPR-Cas9 |
| PCdb_3111 | 33218644 | SlLBD40 | enhances drought tolerance | AGCATTAGGCCTTGTCTTCAA | TGG | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_3112 | 33557889 | Gh_A10G0657 | Gh_A10G0657 (Gossypium hirsutum sucrose transporter SUT1 A10G0657) [Source: CottonGen] | AGCATCTCAGATGCAATGGG | TGG | Gossypium hirsutum L. | 0.5889 | seed | CRISPR-Cas9 |
| PCdb_3113 | 36630019 | EgPAT | Oil palm Protein Acyl Transferase (EgPAT): palmitoyl?acyltransferase enzyme | AGCAGTGGACCCTTCTTGAT | TGG | Elaeis guineensis Jacq. | not found | protoplast | CRISPR-Cas9 |
| PCdb_3114 | 34539694 | 0 sS 40 | Possible typographical entry (function unclear without additional context) | AGCAGCAGCATGGTGGCG | TGG | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_3115 | 30819931 | DEP1 | Dense and erect panicle 1, controls panicle architecture and grain yield | AGCACATGAGAGAACAATAT | TGG | Oryza sativa L. | 0.618 | calli | CBE |
| PCdb_3116 | 29807545 | GFP | GFP (Green Fluorescent Protein, Aequorea victoria, transformation control) [Source: Addgene] | AGCACATGAGAGAACAATAT | TGG | Oryza sativa L. | 0.0051 | protoplast | ABE |
| PCdb_3117 | 31932727 | OsDEP1 | Oryza sativa Dense and Erect Panicle 1 (OsDEP1, panicle architecture) | AGCACATGAGAGAACAATAT | TGG | Oryza sativa L. | 0.27 | calli | ABE |
| PCdb_3118 | 31932727 | OsDEP1 | Oryza sativa Dense and Erect Panicle 1 (OsDEP1, panicle architecture) | AGCACATGAGAGAACAATAT | TGG | Oryza sativa L. | 0.17 | calli | ABE |
| PCdb_3119 | 31932727 | OsDEP1 | Oryza sativa Dense and Erect Panicle 1 (OsDEP1, panicle architecture) | AGCACATGAGAGAACAATAT | TGG | Oryza sativa L. | 0.02 | calli | ABE |
| PCdb_3120 | 31932727 | OsDEP1 | Oryza sativa Dense and Erect Panicle 1 (OsDEP1, panicle architecture) | AGCACATGAGAGAACAATAT | TGG | Oryza sativa L. | 0.001 | calli | ABE |
| PCdb_3121 | 31634585 | DEP1 | Dense and erect panicle 1 gene controlling panicle architecture | AGCACATGAGAGAACAATAT | TGG | Oryza sativa L. | 0.06 | calli | ABE |
| PCdb_3122 | 31694550 | PDS | Phytoene desaturase | AGCAATCAGAATGCACTGCA | TGG | Triticum aestivum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_3123 | 34132917 | CaERF28 | Ethylene responsive factor 28, transcription factor in ethylene signaling pathway | AGCAATAAAGTTCCGGGGAG | TGG | Capsicum annuum L. | 0.857 | Seed | CRISPR-Cas9 |
| PCdb_3124 | 27579989 | NbEDS1a + NbEDS1b (exon 1) | Enhanced disease susceptibility 1a/1b exon 1 fragment (plant immunity) [Source: SolGenomics] | AGCAAATGCTTCATTAACCA | TGG | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_3125 | 31694550 | PDS | Phytoene desaturase | AGCAAACAAATTCTGTACAT | TGG | Triticum aestivum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_3126 | 38925598 | LOC_Os10g29540 | taste quality | AGATCCCGTTCGTGACCAAG | TGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_3127 | 33557889 | Gh_A01G2151 | Gh_A01G2151 (Gossypium hirsutum cell wall invertase CWINV2, sucrose cleavage) [Source: CottonGen] | AGATATTCCCGAGAACCTCG | TGG | Gossypium hirsutum L. | 0.5889 | seed | CRISPR-Cas9 |
| PCdb_3128 | 33339449 | miR156d | MicroRNA targeting SPL transcription factors | AGAGTGAGCACACGGCGTGA | TGG | Oryza sativa L. | 0.938 | protoplast | not found |
| PCdb_3129 | 31359043 | not found | not found | AGAGGCTCCGTTCCATGTCC | TGG | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_3130 | 31694550 | PDS | Phytoene desaturase | AGAGGAACTGAAGTTGTACC | TGG | Triticum aestivum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_3131 | 27918538 | SELF PRUNING 5G | SELF-PRUNING 5G flowering regulator | AGAGATCCTTTAATAGTTTC | TGG | Solanum lycopersicum L. | not found | seed | CRISPR-Cas9 |
| PCdb_3132 | 31694550 | PDS | Phytoene desaturase | AGAGAACACGATTAACTATT | TGG | Triticum aestivum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_3133 | 33557889 | Gh_A06G1561 | Gh_A06G1561 (Gossypium hirsutum auxin response factor, ARF) [Source: CottonGen] | AGACGGATGCCGTATCATTG | TGG | Gossypium hirsutum L. | 0.5889 | seed | CRISPR-Cas9 |
| PCdb_3134 | 37346168 | Solyc05g008250 | Tomato protein Solyc05g008250 (uncharacterized) | AGAAATTTACCTAAAGCTGC | TGG | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_3135 | 37346168 | Solyc11g073120 | Tomato protein Solyc11g073120 (unknown function) | AGAAACTTCTACGATACGGG | TGG | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_3136 | 37879575 | GEX1 | essential roles for reproduction in cotton | AGAAACGTTCAAGGTTTCCC | TGG | Arabidopsis thaliana (L.) Heynh. | not found | not found | CRISPR-Cas9 |
| PCdb_3137 | 35485228 | not found | not found | AGAAAACAGAGGAAAGCGT | TGG | Zea mays L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_3138 | 31694550 | PDS | Phytoene desaturase | ACTTTGCCGGCGCCCTTAAA | TGG | Triticum aestivum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_3139 | 37346168 | Solyc10g055410 | Tomato protein Solyc10g055410 (unknown function) | ACTTGTTTCCAAGGAGGCTA | TGG | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_3140 | 34834905 | FAD2 & FATB | Fatty acid desaturase & Acyl-ACP thioesterase | ACTTGGTTGGCCCTTGTACT | TGG | Glycine max (L.) Merr. | 0.592 | hairy root | CRISPR-Cas9 |
| PCdb_3141 | 34834905 | FAD2 | FAD2 (Fatty acid desaturase 2, EC 1.14.19.2, linoleic acid biosynthesis) [Source: UniProt] | ACTTGGTIGGCCCTTGTACT | TGG | Glycine max (L.) Merr. | not found | protoplast | CRISPR-Cas9 |
| PCdb_3142 | 33346897 | Pp3c12_9240V3.1 (PHY5b) | Physcomitrella phytochrome 5b (Pp3c12_9240V3.1, light sensing) | ACTTCCTTTAGACCGACACT | TGG | Physcomitrella patens (Hedw.) Bruch & Schimp. | not found | protoplast | CRISPR-Cas9 |
| PCdb_3143 | 33339449 | miR814a | MicroRNA (conserved but uncharacterized in rice) | ACTTCATAGTACAACGAATC | TGG | Oryza sativa L. | 0.174 | protoplast | not found |
| PCdb_3144 | 28584922 | DEP1 | G-protein 纬 subunit controlling panicle architecture (Dense and erect panicle1) | ACTGCAGTGCGTGCTGCGC | TGG | Oryza sativa L. | 0.93 | protoplast | not found |
| PCdb_3145 | 31694550 | PDS | Phytoene desaturase | ACTGATGGGACTCAAATAAC | TGG | Triticum aestivum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_3146 | 30603093 | SlGRAS8 | GRAS family transcription factor | ACTGAGTCAGCGATTCGCTG | TGG | Solanum lycopersicum L. | 1 | Germ Cells | CRISPR-Cas9 |
| PCdb_3147 | 37535444 | PagHyPRP1 | improving drought and salt tolerance | ACTCTTGACTGTGGTTCTTG | TGG | Populus sp. | 0.6 | not found | CRISPR-Cas9 |
| PCdb_3148 | 30625150 | RhPDS | Phytoene desaturase | ACTATATACCCTAGCCGGAA | TGG | Arabidopsis thaliana (L.) Heynh. | 0.24 | protoplast | CRISPR-Cas9 |
| PCdb_3149 | 31452351 | Glyma.09G153900 Glyma.16G204600 | Lipoxygenase (Glyma.09G153900 & Glyma.16G204600) [Source: SoyBase] | ACTAACGTTGGTGATGAAGG | TGG | Glycine max (L.) Merr. | 0.592 | hairy root | CRISPR-Cas9 |
| PCdb_3150 | 30287957 | J2EJ2 | Hypothetical protein J2EJ2 (uncharacterized, phage origin) [Source: NCBI] | ACGTTGCAGCTATGCTACTC | TGG | Physalis pruinosa L. | not found | leaf | CRISPR-Cas9 |
| PCdb_3151 | 39942907 | OsPHS3 | 伪-Glucan water dikinase involved in starch phosphorylation and mobilization during rice seed germination. | ACGGTTCATTTCCACCTACC | TGG | Oryza sativa L. | not found | seed | CRISPR/Cas9 |
| PCdb_3152 | 30644027 | DcPDS | Phytoene desaturase | ACGGAGATTGGTACGAGAC | TGG | Daucus carota subsp. sativus (Hoffm.) Sch眉bl. & G.Martens | not found | protoplast | CRISPR-Cas9 |
| PCdb_3153 | 34764970 | FAD2 | Enhances Oleic Acid Production | ACGATTCATCAGAGTGGGAC | TGG | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | Base editor |
| PCdb_3154 | 31694550 | PDS | Phytoene desaturase | ACGATTAACTATTTGGAAGC | TGG | Triticum aestivum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_3155 | 38925598 | LOC_Os09g28400 | taste quality | ACGAGATCCCCGACCCGCTG | TGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_3156 | 26842992 | GRMZM2G170586 (Hsg6) | Maize genome reference GRMZM2G170586 (Heat shock protein gene Hsg6) [Source: MaizeGDB] | acgagagctgcaggcggcca | tgg | Zea mays L. | 19-31% | protoplast | CRISPR-Cas9 |
| PCdb_3157 | 37324705 | OsOLP1 | regulating ABA biosynthesis and lignin accumulation | ACCTTGGTCCGGCCGCAT | TGG | Oryza sativa L. | not found | plants,stomatal,plant | CRISPR-Cas9 |
| PCdb_3158 | 37346168 | Solyc02g088190 | Tomato protein Solyc02g088190 (uncharacterized) | ACCTTAGCCACATGGCTCAG | TGG | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_3159 | 30729010 | BoPDS | Phytoene desaturase, key enzyme in carotenoid biosynthesis pathway | ACCTGATCGCGTGACTGATG | TGG | Brassica oleracea var. capitata L. | 0.68 | hypocotyl | CRISPR-Cas9 |
| PCdb_3160 | 30623600 | not found | not found | ACCTCGTCCCCCTCGAGAT | TGG | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_3161 | 31694550 | PDS | Phytoene desaturase | ACCTCGGTGTCTTCACAACA | TGG | Triticum aestivum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_3162 | 32980909 | not found | not found | ACCGGACCACCTCAAGAGCT | TGG | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_3163 | 29279404 | ZmCCT9 | enhances maize adaptation to higher latitudes | ACCGCGGGTTTCCCGGGATG | TGG | Zea mays L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_3164 | 31694550 | PDS | Phytoene desaturase | ACCGATCGAAGGGTTTTATC | TGG | Triticum aestivum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_3165 | 26842992 | GRMZM2G332562 (Hsg3) | Maize genome reference GRMZM2G332562 (Heat shock protein gene Hsg3) [Source: MaizeGDB] | accgataagcacagcagctg | tgg | Zea mays L. | 19-31% | protoplast | CRISPR-Cas9 |
| PCdb_3166 | 28790350 | BnaC9.RGA | DELLA protein RGA homolog | ACCCGTCGGAGCTTTACTCG | TGG | Brassica napus L. | 1 | protoplast | CRISPR-Cas9 |
| PCdb_3167 | 32640102 | RGA | DELLA protein RGA growth repressor | ACCCGTCGGAGCTTTACTCG | TGG | Brassica napus L. | >20% | seed | A3A-PBE |
| PCdb_3168 | 28790350 | BnaA9.RGA | DELLA protein RGA homolog | ACCCGTCGGAGCTCTACTCG | TGG | Brassica napus L. | 0.7 | protoplast | CRISPR-Cas9 |
| PCdb_3169 | 28790350 | BnaA6.RGA | DELLA protein RGA homolog | ACCCCGCTGAGCTTTACTCG | TGG | Brassica napus L. | 0.7 | protoplast | CRISPR-Cas9 |
| PCdb_3170 | 34713230 | BnaA06.RGA | DELLA protein RGA homolog | ACCCCGCTGAGCTTTACTCG | TGG | Brassica napus L. | not found | protoplast | Base editor |
| PCdb_3171 | 34764970 | FAD2 | Enhances Oleic Acid Production | ACCAGTTCGATGGAACACCG | TGG | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | Base editor |
| PCdb_3172 | 33015536 | AGO4 & NRPD1a & NRPE1 & RDR2 & RDR4 & RDR6 & CHLI1 & PIE1 | Multi-gene complex: RNA-directed DNA methylation machinery (small RNA biogenesis and chromatin modification) | ACATTTGGAGGTATAACTGG | TGG | Arabidopsis thaliana (L.) Heynh. | 0.35 | seed | CRISPR-Cas9 |
| PCdb_3173 | 38925598 | LOC_Os05g04330 | taste quality | ACATGACTGGAGGAAGAGCT | TGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_3174 | 28905515 | VvWRKY52 | Vitis vinifera WRKY transcription factor 52 (VvWRKY52, defense response) | ACATGACGCCCGTGAATCCT | TGG | Vitis vinifera L. | 0.2778 | protoplast | CRISPR-Cas9 |
| PCdb_3175 | 33931634 | VvbZIP36 | Vitis vinifera bZIP transcription factor 36 (VvbZIP36, stress signaling) | ACATGACGCCCGTGAATCCT | TGG | Vitis vinifera L. | not found | calli | CRISPR-Cas9 |
| PCdb_3176 | 27148303 | IR and Rep of CABs | Intergenic region and repetitive elements of chloroplast DNA [Source: NCBI] | ACATCCATTCCCAATATCTC | TGG | Gossypium hirsutum L. | not found | germplasm | CRISPR-Cas9 |
| PCdb_3177 | 30733188 | not found | not found | ACAGTTGCGCAGCCTGAA | TGG | Oryza sativa L. | not found | protoplast | not found |
| PCdb_3178 | 26842991 | FGS | FGS (Arabidopsis thaliana FATTY ACID ELONGASE82, very-long-chain fatty acid biosynthesis) [Source: TAIR] | ACAGCGTGAGGGCATGCATC | TGG | Zea mays L. | 0.0751 | protoplast | CRISPR-Cas9 |
| PCdb_3179 | 26842991 | FGS | FGS (Arabidopsis thaliana FATTY ACID ELONGASE82, very-long-chain fatty acid biosynthesis) [Source: TAIR] | ACAGCGTGAGGGCATGCATC | TGG | Zea mays L. | 0.0751 | protoplast | CRISPR-Cas9 |
| PCdb_3180 | 38925598 | LOC_Os07g08500 | taste quality | ACAGATTTAACCAAAGCCCA | TGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_3181 | 31545544 | OsMPK2 | Mitogen-activated protein kinase 2 (stress signaling) | ACACTGCAGCTATTGATATC | TGG | Oryza sativa L. | 0.333 | seed | CBE |
| PCdb_3182 | 34782822 | StSBE3 | Potato starch branching enzyme 3 (StSBE3, starch biosynthesis) | ACACAGAATGAAGAGATATG | TGG | Solanum tuberosum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_3183 | 29867128 | AtALS & AtPDS & AtFT & AtLFY | Acetolactate synthase (ALS), Phytoene desaturase (PDS), Flowering locus T (FT), and Leafy (LFY) - Multiple gene targets for plant genetic studies | ACACACACACTCACTGTCTA | TGG | Arabidopsis thaliana (L.) Heynh. | 0.0042 | protoplast | ABE |
| PCdb_3184 | 38763364 | TPKa | Regulates potassium accumulation | ACACAATCGAGCAGCAGTAC | TGG | Nicotiana tabacum L. | not found | protoplast | CRISPR/Cas9 |
| PCdb_3185 | 36593415 | not found | not found | ACAACACTGCTGACTCTGCA | TGG | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_3186 | 31001300 | S-Rnase | S-RNase (self-incompatibility protein) | AATTGCAACTGGTATTAACA | TGG | Solanum tuberosum L. | 93-98% | protoplast | not found |
| PCdb_3187 | 27148303 | Rep-A of alphasatellite | Alphasatellite replication-associated protein (Rep-A, viral replication) | AATTCGAAGTCCGGTGAGAA | TGG | Gossypium hirsutum L. | not found | germplasm | CRISPR-Cas9 |
| PCdb_3188 | 31452351 | Glyma.04G241400 Glyma.06G122200 | Cinnamyl alcohol dehydrogenase (Glyma.04G241400 & Glyma.06G122200) [Source: SoyBase] | AATTCCAGAAAGCTCTTCTG | TGG | Glycine max (L.) Merr. | 0.592 | hairy root | CRISPR-Cas9 |
| PCdb_3189 | 35972347 | GhTCE1 | regulate transcriptional reprogramming during wound-induced callus formation in cotton | AATGGAGTTTACTGCCCGTT | TGG | Gossypium hirsutum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_3190 | 38925598 | LOC_Os01g51290 | taste quality | AATGCTTCTGCGACGAAACA | TGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_3191 | 30287957 | AGO7 | Argonaute 7, RNA interference effector protein in ta-siRNA pathway | AATGCTGTTTGTACCCGAAC | TGG | Physalis pruinosa L. | not found | leaf | CRISPR-Cas9 |
| PCdb_3192 | 33068118 | not found | not found | AATGCTACTGCAACGAGGGG | TGG | Oryza sativa L. | not found | protoplast | not found |
| PCdb_3193 | 32786122 | svDrm | Sugarvine dormancy-associated protein (svDrm, bud dormancy) | AATGCCTCTCCCAAACCCAA | TGG | Setaria viridis (L.) P. Beauv. | not found | protoplast | CRISPR-Cas9 |
| PCdb_3194 | 32323464 | not found | not found | AATGCCCCATAGTTACAGGT | TGG | Oryza sativa L. | not found | pollen,embryo sac | CRISPR-Cas9 |
| PCdb_3195 | 29723918 | TaCer9 | Wheat ECERIFERUM9鈥恖ike protein (cuticular wax biosynthesis) | AATGAAGCATCTCATGACCA | TGG | Triticum aestivum L. | not found | protoplast | CRISPR-Cas9,TALEN,Base editor |
| PCdb_3196 | 38925598 | LOC_Os01g62820 | taste quality | AATCTGGCCTTGACTAAGCA | TGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_3197 | 37346168 | Solyc08g082890 | Tomato protein Solyc08g082890 (uncharacterized) | AATCCTTCTTTAGCACAACA | TGG | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_3198 | 27986915 | PpTON | involved in gametophore cell elongation, and loss-of-function mutants exhibit small gametophores with short and thickened leaves | AATAGTCAACAGCAAAGGCC | TGG | Physcomitrella patens (Hedw.) Bruch & Schimp. | 0.678 | protoplast | CRISPR-Cas9 |
| PCdb_3199 | 32117329 | AT1G72350 | Arabidopsis thaliana gene AT1G72350 (uncharacterized protein) | AATACTGACTAATGAACCCG | TGG | Arabidopsis thaliana (L.) Heynh. | not found | seed | CRISPR-Cas9 |
| PCdb_3200 | 35937858 | RZ1AL | associated with tomato ripening and development | AAGTGCCCGACCGACCCGAT | TGG | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_3201 | 35192362 | not found | not found | AAGTCCCTCGTCGTATGAT | TGG | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9,Base editor |
| PCdb_3202 | 28303459 | not found | not found | AAGTCCCTCGTCGTATGAT | TGG | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9,Base editor |
| PCdb_3203 | 36902202 | FAD2-2A | Omega-6 fatty acid desaturase | AAGGTTGTGGAAGTAATCGG | TGG | Glycine max (L.) Merr. | not found | protoplast | CRISPR-Cas9,Base editor |
| PCdb_3204 | 31694550 | PDS | Phytoene desaturase | AAGGGCGCCGGCAAAGTCTC | TGG | Triticum aestivum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_3205 | 38773248 | GmDMEa | DEMETER-like DNA glycosylase mediating active DNA demethylation during soybean seed development and stress responses. | AAGGCCACAGAGATGCTGGA | TGG | Glycine max (L.) Merr. | not found | seed | CRISPR/Cas9 |
| PCdb_3206 | 30887096 | se13-3 | Photoperiod sensitivity mutant affecting flowering time | AAGCTGAATGTAGAACATGG | TGG | Oryza sativa L. | not found | leaf | CRISPR-Cas9 |
| PCdb_3207 | 31684940 | EPSPS | 5-enolpyruvylshikimate-3-phosphate synthase | AAGCTCTTCTTGGGTAATGC | TGG | Triticum aestivum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_3208 | 27874087 | not found | not found | AAGCTCAAGCCAGAGTATCT | TGG | Oryza sativa L. | not found | protoplast | not found |
| PCdb_3209 | 34416065 | GmNF鈥怸C14 | Nuclear transcription factor Y subunit C | AAGCGGAGTATCGATACAAC | TGG | Glycine max (L.) Merr. | not found | protoplast | CRISPR-Cas9 |
| PCdb_3210 | 35755703 | not found | not found | AAGCCGGTGTTGGCCGCGGA | TGG | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_3211 | 38925598 | LOC_Os03g16940 | taste quality | AAGCCAGAGGCAAACGTACG | TGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_3212 | 37497643 | PSY1 | Carotenoid biosynthesis phytoene synthase | AAGCAGCATTATATACGCT | TGG | Solanum lycopersicum L. | 0.5 | plants,flower,Plants,somatic cells,plant | CRISPR-Cas9 |
| PCdb_3213 | 31694550 | PDS | Phytoene desaturase | AAGCACTTTGCACTTACTGA | TGG | Triticum aestivum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_3214 | 31694550 | PDS | Phytoene desaturase | AAGCAAGTAAGATCTTTTGC | TGG | Triticum aestivum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_3215 | 30610223 | MTL | MATRILINEAL (phospholipase mediating seed development) [Source: UniProt] | AAGCAACCCAGTGCACCGC | TGG | Oryza sativa L. | not found | protoplast | not found |
| PCdb_3216 | 36892416 | FT and TFL1CENBFT family | TFL1 (Terminal Flower 1, phosphatidylethanolamine-binding protein family) [Source: UniProt] | AAGATGTCAGAGCCTCTTG | TGG | Populus 脳 canescens 'INRA 717-1B7' | not found | seed | CRISPR-Cas9 |
| PCdb_3217 | 35665758 | PpAPT | Physcomitrella adenosine phosphoribosyltransferase (PpAPT, purine metabolism) | AAGAGTATAGTCTAGAGAT | TGG | Physcomitrella patens (Hedw.) Bruch & Schimp. | not found | protoplast | CRISPR-Cas9,TALEN |
| PCdb_3218 | 36901844 | TaWOX5 | Wheat WUSCHEL-related homeobox 5 | AAGACCAGGAGATCTA | TGG | Triticum aestivum L. | 30.3-13.3% | Immature Embryos | not found |
| PCdb_3219 | 38925598 | LOC_Os01g24880 | taste quality | AAGACACTCCTTGATGTCTC | TGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_3220 | 30871076 | APT | Adenine phosphoribosyltransferase, salvages adenine for nucleotide synthesis | AAGAAGATTGACGTGG | TGG | Chlamydomonas reinhardtii P.A.Dang. | 0.03 | protoplast | CRISPR-Cas9 |
| PCdb_3221 | 39190135 | OsETR | Broad-spectrum resistance | AAGAAGAACTTGTACCGGAT | TGG | Oryza sativa L. | not found | protoplast | CRISPR/Cas9 |
| PCdb_3222 | 30824000 | OsNF-YC10 | affecting cell proliferation in rice | AAGAACTTGCTGOGCGTCA | TGG | Oryza sativa L. | not found | Cell Nucleus | CRISPR-Cas9,CRISPRa |
| PCdb_3223 | 33751803 | Waxy | Granule-bound starch synthase (Waxy, starch biosynthesis) | AACTTATGGTGAGTTACAAT | TGG | Oryza sativa L. | 3.3-10.5% | calli | ABE |
| PCdb_3224 | 32016614 | OsDEP1 | Oryza sativa Dense and Erect Panicle 1 (OsDEP1, panicle architecture) | AACTGCAGTGCGTGCTGCC | TGG | Oryza sativa L. | not found | protoplast | CRISPR-Cas9,CRISPR-Cas12 |
| PCdb_3225 | 31694550 | PDS | Phytoene desaturase | AACTGAAAAGAAAAAACATA | TGG | Triticum aestivum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_3226 | 31694550 | PDS | Phytoene desaturase | AACTCCAGCATCGAACGGTT | TGG | Triticum aestivum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_3227 | 31452351 | Glyma.04G198400 Glyma.06G167000 | amylase (Glyma.04G198400 & Glyma.06G167000) [Source: SoyBase] | AACGTCTTTCTGTGATAGGA | TGG | Glycine max (L.) Merr. | 0.592 | hairy root | CRISPR-Cas9 |
| PCdb_3228 | 36756926 | not found | not found | AACGAGTACTTCAGACATGC | TGG | Oryza sativa L. | not found | protoplast | not found |
| PCdb_3229 | 38925598 | LOC_Os09g29404 | taste quality | AACGAGCGGAAGCCTTACCA | TGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_3230 | 35955484 | not found | not found | AACCTCAACCCCGAGTATCT | TGG | Oryza sativa L. | not found | protoplast | not found |
| PCdb_3231 | 30729010 | BoSRK3 | S-receptor kinase 3, involved in self-incompatibility response in Brassica oleracea | AACCCTATATCCAACTCCAC | TGG | Brassica oleracea var. capitata L. | 1 | hypocotyl | CRISPR-Cas9 |
| PCdb_3232 | 31694550 | PDS | Phytoene desaturase | AACCACATTCAGTCTTTGGG | TGG | Triticum aestivum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_3233 | 29723918 | OsCer9 | Rice ECERIFERUM9ike protein (cuticular wax biosynthesis) | AACAGGGTTCCTGCTGCAGA | TGG | Triticum aestivum L. | not found | protoplast | CRISPR-Cas9,TALEN,Base editor |
| PCdb_3234 | 27918538 | SELF PRUNING 5G | SELF-PRUNING 5G flowering regulator | AACAATAGGGTGGTCTATAA | TGG | Solanum lycopersicum L. | not found | seed | CRISPR-Cas9 |
| PCdb_3235 | 31694550 | PDS | Phytoene desaturase | AAATGCTCTCTCCGTTGTAT | TGG | Triticum aestivum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_3236 | 34073486 | NbPDS | Phytoene desaturase (carotenoid biosynthesis) [Source: SolGenomics] | AAATGATCCGTTAACAGAAG | TGG | Nicotiana tabacum L. | 0.2289 | leaf | ABE |
| PCdb_3237 | 31452351 | Glyma.12G234500 Glyma.13G264400 | Phenylalanine ammonia-lyase (Glyma.12G234500 & Glyma.13G264400) [Source: SoyBase] | AAAGTTGCCAAGGATGCAGC | TGG | Glycine max (L.) Merr. | 0.592 | hairy root | CRISPR-Cas9 |
| PCdb_3238 | 31694550 | PDS | Phytoene desaturase | AAAGTAAAAGGATCACGTCA | TGG | Triticum aestivum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_3239 | 38925598 | LOC_Os07g17210 | taste quality | AAAGAGGAAGAGGACCCTGG | TGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_3240 | 31452351 | Glyma.04G000600 Glyma.06G000400 | Ferritin (Glyma.04G000600 & Glyma.06G000400) [Source: SoyBase] | AAAGACGCTGCCAAGAGCAT | TGG | Glycine max (L.) Merr. | 0.592 | hairy root | CRISPR-Cas9 |
| PCdb_3241 | 32661060 | not found | not found | AAAGAAGGATCATACTATAC | TGG | Oryza sativa L. | not found | chloroplast | CRISPR-Cas9 |
| PCdb_3242 | 37346168 | Solyc01g111500 | Tomato protein Solyc01g111500 (uncharacterized) | AAACTCACGGCGAAGGTTGC | TGG | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_3243 | 31694550 | PDS | Phytoene desaturase | AAACCGTTCGATGCTGGAGT | TGG | Triticum aestivum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_3244 | 33557889 | Gh_A11G3271 | Gh_A11G3271 (Gossypium hirsutum chitinase A11G3271) [Source: CottonGen] | AAACAGGTCAGATAACCCAT | TGG | Gossypium hirsutum L. | 0.5889 | seed | CRISPR-Cas9 |
| PCdb_3245 | 37176936 | FtsZ1 | FtsZ1 (Filamenting temperature-sensitive mutant Z 1, chloroplast division) [Source: UniProt] | AAACACCGATGCTCAAGCAC | TGG | Solanum tuberosum L. | 1 | tubers,plants,Tubers | CRISPR-Cas9 |
| PCdb_3246 | 31394891 | SR33a | Alternative splicing variant of SR33 | AAAATTCCTCCAAGGCCTCC | TGG | Oryza sativa L. | not found | callus | CRISPR-Cas9 |
| PCdb_3247 | 37313423 | BnaNTT2 | regulates ATP homeostasis in plastid to sustain lipid metabolism and plant growth | AAAAGTTCTATCCTTTGTT | TGG | Brassica napus L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_3248 | 37346168 | Solyc11g011050 | Tomato protein Solyc11g011050 (unknown function) | AAAAGTCCTCTCTTCAAATC | TGG | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_3249 | 31452351 | Glyma.11G125500 Glyma.02G311000 Glyma.06G000400 Glyma.13G346300 | Heat shock protein (Glyma.11G125500, Glyma.02G311000, Glyma.06G000400, Glyma.13G346300) [Source: SoyBase] | AAAAGGATATGCAGACAACA | TGG | Glycine max (L.) Merr. | 0.592 | hairy root | CRISPR-Cas9 |
| PCdb_3250 | 31694550 | PDS | Phytoene desaturase | AAAACAATGAAATGCTTACT | TGG | Triticum aestivum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_3251 | 31316687 | TMM | Leucine-rich repeat receptor-like protein TOO MANY MOUTHS | TCTTCCGGCGCTGAGCGTTC | TGG | Arabidopsis thaliana (L.) Heynh. | not found | seed | CRISPR-Cas9 |
| PCdb_3252 | 34347875 | not found | Gene not detected or not annotated in the database | TAGCACTCTGGTCTAAGCTT | TGG | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_3253 | 26842991 | FGS | FGS (Arabidopsis thaliana FATTY ACID ELONGASE58, very-long-chain fatty acid biosynthesis) [Source: TAIR] | GTGGGTACTTGCGACACATG | TGG | Zea mays L. | 0.2637 | protoplast | CRISPR-Cas9 |
| PCdb_3254 | 26842991 | FGS | FGS (Arabidopsis thaliana FATTY ACID ELONGASE46, very-long-chain fatty acid biosynthesis) [Source: TAIR] | GGTGCTTTCTCATCAGTAAT | TGG | Zea mays L. | 0.0344 | protoplast | CRISPR-Cas9 |
| PCdb_3255 | 26842991 | FGS | FGS (Arabidopsis thaliana FATTY ACID ELONGASE59, very-long-chain fatty acid biosynthesis) [Source: TAIR] | GCTAAGCCATAAGGAGGGCC | TGG | Zea mays L. | 0.0431 | protoplast | CRISPR-Cas9 |
| PCdb_3256 | 26842991 | FGS | FGS (Arabidopsis thaliana FATTY ACID ELONGASE25, very-long-chain fatty acid biosynthesis) [Source: TAIR] | GAGCCACAGTCGCAGCTGAC | TGG | Zea mays L. | 0.0215 | protoplast | CRISPR-Cas9 |
| PCdb_3257 | 26842991 | FGS | FGS (Arabidopsis thaliana FATTY ACID ELONGASE84, very-long-chain fatty acid biosynthesis) [Source: TAIR] | CTGCAGAGCTTTGTTGGCCA | TGG | Zea mays L. | 0.0582 | protoplast | CRISPR-Cas9 |
| PCdb_3258 | 30051586 | SNB | Controls spikelet development and inflorescence architecture | CGTAGAGAATCCTGATGATGC | TGCAG | Oryza sativa L. | 0.065 | leaf | ABE |
| PCdb_3259 | 30537191 | Ehd1 | Early heading date 1, controls flowering time in rice | TTCACCGAGGTGGTTCACTGC | TGCAAT | Oryza sativa L. | 0.12 | calli | CBE |
| PCdb_3260 | 30928635 | OsRLCK185 | Receptor-like cytoplasmic kinase involved in defense signaling | GUGCACUGCCAAGCUCACAC | TGC | Oryza sativa L. | 0.2 | protoplast | ABE |
| PCdb_3261 | 30928635 | OsRLCK185 | Receptor-like cytoplasmic kinase involved in immune responses | GUGCACUGCCAAGCUCACAC | TGC | Oryza sativa L. | 0.5 | protoplast | ABE |
| PCdb_3262 | 30928635 | OsRLCK185 | Receptor-like cytoplasmic kinase involved in immune responses | GUGCACUGCCAAGCUCACAC | TGC | Oryza sativa L. | 0.3 | protoplast | ABE |
| PCdb_3263 | 34042262 | OsALS | Acetolactate synthase | GTAAAACCTATCCTCCCAT | TGC | Oryza sativa L. | 0.036 | protoplast | CBE |
| PCdb_3264 | 30959555 | not found | not found | GCTGCAGCTGCTGTAGCGGT | TGC | Oryza sativa L. | 0.074 | calli | ABE |
| PCdb_3265 | 34984801 | OsWaxy | Granule-bound starch synthase I | CTCGCCAAGGAGAACGTGGC | TGC | Oryza sativa L. | not found | protoplast | CRISPR-Cas9,Base editor |
| PCdb_3266 | 37682975 | not found | not found | CCTCGTTCAAGCTTGACCGC | TGC | Oryza sativa L. | not found | not found | not found |
| PCdb_3267 | 28066464 | MLO-7 | Mildew resistance locus O 7 (powdery mildew susceptibility) [Source: TAIR] | CCAAAGATTTTAAGAACACA | TGC | Vitis vinifera L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_3268 | 30928637 | OsPDS | Oryza sativa phytoene desaturase (OsPDS, carotenoid biosynthesis) | ATTTCACTCCAAAGCTCACA | TGC | Oryza sativa L. | not found | protoplast | xCas9 |
| PCdb_3269 | 33152517 | APOBEC3A | the APOBEC family of cytidine deaminases | ATGCATGCATGCACCCATGC | TGC | Oryza sativa L. | 0.406 | protoplast | CBE |
| PCdb_3270 | 30928637 | OsDEP1 | Oryza sativa Dense and Erect Panicle 1 (OsDEP1, panicle architecture) | AGAGAAGGAGGCACAGATCT | TGC | Oryza sativa L. | not found | protoplast | xCas9 |
| PCdb_3271 | 34713242 | OsMPK2 | Oryza sativa mitogen-activated protein kinase 2 (OsMPK2, stress signaling) | AGACCTCAGGCCAAGTAATT | TGC | Oryza sativa L. | not found | calli | CRISPR-xCas9 |
| PCdb_3272 | 28864834 | PDS | Phytoene desaturase (PDS, carotenoid biosynthesis) | AAAGTTGTAATTGCTGG | TGC | Citrus 脳 sinensis (L.) Osbeck | 0.65 | protoplast | CRISPR-Cas9 |
| PCdb_3273 | 34713242 | OsNRT1.1B | Oryza sativa nitrate transporter 1.1B (OsNRT1.1B, nitrogen uptake) | GCTCTACCTGGGGCTCTACC | TGA | Oryza sativa L. | 0.263 | calli | CRISPR-xCas9 |
| PCdb_3274 | 30928637 | OsPDS | Oryza sativa phytoene desaturase (OsPDS, carotenoid biosynthesis) | GTTTGGCGAGCTTGGTATTAA | TGA | Oryza sativa L. | not found | protoplast | xCas9 |
| PCdb_3275 | 31545544 | OsNRT1.1B | Nitrate transporter regulating nitrogen uptake and utilization | GCTCTACCTGGGGCTCTACC | TGA | Oryza sativa L. | 0.05 | seed | CBE |
| PCdb_3276 | 30959555 | ALS | Acetolactate synthase, target site of ALS-inhibitor herbicides and essential for branched-chain amino acid biosynthesis | GCGACCATTGACAGCAGCCG | TGA | Oryza sativa L. | 0.407 | calli | CBE |
| PCdb_3277 | 34713242 | OsGRF4 | Oryza sativa Growth Regulating Factor 4 (OsGRF4, plant growth regulation) | GCATTCTCATCAGCGAGGTC | TGA | Oryza sativa L. | 0.7 | calli | CRISPR-xCas9 |
| PCdb_3278 | 31545544 | OsWaxy | Granule-bound starch synthase determining amylose content in endosperm | GACTCCACCTTCTCCAGGAA | TGA | Oryza sativa L. | 0.105 | seed | CBE |
| PCdb_3279 | 30928637 | OsPDS | Oryza sativa phytoene desaturase (OsPDS, carotenoid biosynthesis) | cgtccacaacagtacatatg | TGA | Oryza sativa L. | not found | protoplast | xCas9 |
| PCdb_3280 | 30959555 | not found | not found | CCTGAGATCTACATATGGAG | TGA | Oryza sativa L. | 0.013 | calli | ABE |
| PCdb_3281 | 34984801 | OSIAA13 | Auxin-responsive protein IAA13 | CCAACCCACTGCCTGCGCCC | TGA | Oryza sativa L. | not found | protoplast | CRISPR-Cas9,Base editor |
| PCdb_3282 | 30928636 | OsIAA13 | Auxin response factor inhibiting root development | CCAACCCACTGCCTGCGCCC | TGA | Oryza sativa L. | 0.119 | calli | ABE |
| PCdb_3283 | 31932727 | OsAAT | Amino acid transporter protein | CAACAAGGATCCCAGCCCCG | TGA | Oryza sativa L. | 0.04 | calli | ABE |
| PCdb_3284 | 31932727 | OsAAT | Amino acid transporter protein | CAACAAGGATCCCAGCCCCG | TGA | Oryza sativa L. | 0.019 | calli | ABE |
| PCdb_3285 | 30928637 | OsPDS | Oryza sativa phytoene desaturase (OsPDS, carotenoid biosynthesis) | ATGGCATTTCTACCTTATCGA | TGA | Oryza sativa L. | not found | protoplast | xCas9 |
| PCdb_3286 | 36312444 | NARK | Nodulation autoregulation receptor kinase (symbiotic nodulation) [Source: UniProt] | AAGGTTGAGTGGGTATCCAT | TGA | Glycine max (L.) Merr. | not found | hairy root | CRISPR-Cas9 |
| PCdb_3287 | 30928637 | OsPDS | Oryza sativa phytoene desaturase (OsPDS, carotenoid biosynthesis) | aacaactccagcgctgcata | TGA | Oryza sativa L. | not found | protoplast | xCas9 |
| PCdb_3288 | 32804931 | StGBSSI | Potato granule-bound starch synthase I (StGBSSI, amylose synthesis) | CATCCGATAGACGTGGCCTA | TCGGAT | Solanum tuberosum L. | not found | protoplast | CRISPR-Cas9,Prime editor,Base editor,SaCas9 |
| PCdb_3289 | 32804931 | StDMR 6 -1 | Potato DMR6-1 (StDMR6-1, disease susceptibility) | ACCACATCCGATAGACGTGGCCTA | TCGGAT | Solanum tuberosum L. | not found | protoplast | CRISPR-Cas9,Prime editor,Base editor,SaCas9 |
| PCdb_3290 | 33328469 | BrOG1AOE | Brassica rapa overexpressor line 1A (transgenic construct) | CTCCATTTCGTCTCCAGTTA | TCGAGT | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_3291 | 30537191 | IPA1 | Ideal Plant Architecture 1 (OsSPL14), controls tillering and panicle branching | ACAGAAGAGAGAGAGCACAGC | TCGAGT | Oryza sativa L. | 0.2 | calli | CBE |
| PCdb_3292 | 31469505 | OsSPL17 | Leaf angle regulator controlling plant architecture | ACAGAAGAGAGAGAGCACAGC | TCGAGT | Oryza sativa L. | 0.464 | calli | ABE |
| PCdb_3293 | 31469505 | OsSPL14 | Ideal Plant Architecture 1 (SPL14) controlling tillering and panicle structure | ACAGAAGAGAGAGAGCACAGC | TCGAGT | Oryza sativa L. | 0.393 | calli | ABE |
| PCdb_3294 | 30051586 | OsSPL14 | Transcription factor regulating tillering and plant architecture (e.g., IPA1 allele increases yield). | ACAGAAGAGAGAGAGCACAGC | TCGAG | Oryza sativa L. | 0.25 | leaf | ABE |
| PCdb_3295 | 27033976 | AtTFL1 | TERMINAL FLOWER 1 (floral repressor) | ctttggttttcatttggtta | tcg | Arabidopsis thaliana (L.) Heynh. | 0.008 | seed | not found |
| PCdb_3296 | 33398158 | OsPDS | Phytoene desaturase (carotenoid biosynthesis) | GCAATAATAGAGTACAAAGG | TCC | Oryza sativa L. | 0.0004 | protoplast | not found |
| PCdb_3297 | 31863838 | LmCBP1 | s required for the pathogenicity of Leptosphaeria maculans on rape | CCGCCCATCGCTACATCAGC | TCC | Brassica napus L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_3298 | 26661595 | AT2G19800.1 | Zinc-finger protein YAO (female gametophyte development) | CACCACTTGTATCCGAC | TCC | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | not found |
| PCdb_3299 | 34454034 | PDS | Phytoene desaturase | AGCGGAACCTCTACCGGATT | TCC | Triticum aestivum L. | not found | protoplast | CRISPRa,CRISPR-Cas9,CRISPRi |
| PCdb_3300 | 36009753 | C4H | Cinnamate 4-hydroxylase, key enzyme in phenylpropanoid pathway for lignin/flavonoid biosynthesis | AAACCCAACTCCCAAGTTTCTTTTC | TCC | Nicotiana tabacum L. | not found | protoplast | not found |
| PCdb_3301 | 26661595 | AT5G46790.1 | Arabidopsis calcium-binding protein (AT5G46790.1, stress signaling) | AAACAGCATAGGCTGCGCC | TCC | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | not found |
| PCdb_3302 | 30537191 | Wx | Granule-bound starch synthase determining amylose content | TCTTTGTAATCAACTCCAGTG | TCAGGT | Oryza sativa L. | 0.1 | calli | CBE |
| PCdb_3303 | 26891616 | PDS | Phytoene desaturase (PDS, carotenoid biosynthesis) | TTGTGCACAAGCAATTG | TAC | Citrus 脳 sinensis (L.) Osbeck | 0.75 | leaf | CRISPR-Cas9 |
| PCdb_3304 | 34042262 | OsROC5 | Homeodomain transcription factor ROC5 (leaf rolling and polarity) | GCCGCTCCAGTTGCGTCTTGG | TAAA | Oryza sativa L. | not found | protoplast | CBE |
| PCdb_3305 | 33398158 | OsPDS | Phytoene desaturase (carotenoid biosynthesis) | AGAAACAGTGAACAACCCAC | TAA | Oryza sativa L. | 0.005 | protoplast | not found |
| PCdb_3306 | 31916673 | OsMPK9 | Mitogen-activated protein kinase 9 (pathogen defense) | TGATCCAAAGGACCGTCCAACTG | NTG | Oryza sativa L. | not found | protoplast | Base editor |
| PCdb_3307 | 31916673 | OsMPK15 | Mitogen-activated protein kinase 15 (stress signaling) | GGATACTTCGTGAAATCAAGTTG | NTG | Oryza sativa L. | not found | protoplast | Base editor |
| PCdb_3308 | 31916673 | OsCPK8 | Calcium-dependent protein kinase 8 (defense responses) | CAGGTACGCGTGCAAGTCGATA | NTG | Oryza sativa L. | not found | protoplast | Base editor |
| PCdb_3309 | 34459083 | not found | not found | not found | notfound | Hordeum vulgare L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_3310 | 26582727 | Rj4 | Rj4 (Rhizobium japonicum symbiosis gene in soybean) | TTTTAGTTGAATTTCCCAT | not found | Glycine max (L.) Merr. | not found | hairy root | CRISPR-Cas9 |
| PCdb_3311 | 26582727 | Rj4 | Rj4 (Rhizobium japonicum symbiosis gene in soybean) | TTTTAGTCGAACTTGCCAT | not found | Glycine max (L.) Merr. | not found | hairy root | CRISPR-Cas9 |
| PCdb_3312 | 37547711 | StLike3 | Potato StLike3 protein (unknown function) | TTTGTGGCCAAGAAAAAGCC | not found | Solanum tuberosum L. | not found | hairy root | CRISPR-Cas9 |
| PCdb_3313 | 32945949 | FAD2-1B | Omega-6 fatty acid desaturase | TTTGTCCCAAAACCAAAATCCAAAGT | not found | Glycine max (L.) Merr. | not found | protoplast | CRISPR-Cas12 |
| PCdb_3314 | 37025130 | ZED1-related kinase 13 | ZED1-related kinase 13 (plant immune signaling) | TTTGGTGATGTGTAAAACAA | not found | Arabidopsis thaliana (L.) Heynh. | not found | seed | CRISPR-Cas9 |
| PCdb_3315 | 30704461 | OSDEP1 | temperature sensitivity | TTTGGTCACAGATCACAAACTTCAAAAT | not found | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas12 |
| PCdb_3316 | 0 | Solyc03g114840 | Tomato ascorbate peroxidase (Solyc03g114840, oxidative stress response) | TTTGGGCACGTTAAGCTCGA | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_3317 | 32945949 | FAD2-1B | Omega-6 fatty acid desaturase | TTTGGCTGCTATGTGTTTATGGGGTG | not found | Glycine max (L.) Merr. | not found | protoplast | CRISPR-Cas12 |
| PCdb_3318 | 31821678 | MIR | MicroRNA gene (non-coding RNA regulation) [Source: miRBase] | TTTGGCATTCTGTCCACCTCC | not found | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9,TALEN |
| PCdb_3319 | 31821678 | MIR | MicroRNA gene (non-coding RNA regulation) [Source: miRBase] | TTTGGATTGAAGGGAGCTCTG | not found | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9,TALEN |
| PCdb_3320 | 36145794 | UGT76G1 | UDP-glycosyltransferase 76G1, modifies steviol glycosides in Stevia rebaudiana | TTTGCCTTACTACCTTAGTT | not found | Stevia rebaudiana (Bertoni) Bertoni | 14.16-93.68 | protoplast | CRISPR-Cas9 |
| PCdb_3321 | 28913802 | the wheat phytoene desaturase gene | Wheat phytoene desaturase | TTTGCCATGCCAAACAAACC | not found | Triticum aestivum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_3322 | 32945949 | FAD2-1B | Omega-6 fatty acid desaturase | TTTGATGACACACCATTTTACAAGGC | not found | Glycine max (L.) Merr. | not found | protoplast | CRISPR-Cas12 |
| PCdb_3323 | 34305978 | BnGTR1 | Glucosinolate transporter 1 | TTTGAGAAGCTTGGGATCAT | not found | Brassica napus L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_3324 | 32945949 | FAD2-1B | Omega-6 fatty acid desaturase | TTTCTCATGGAAAATAAGCCATCGCC | not found | Glycine max (L.) Merr. | not found | protoplast | CRISPR-Cas12 |
| PCdb_3325 | 32945949 | FAD2-1B | Omega-6 fatty acid desaturase | TTTCTACATTGCCACCACCTACTTCC | not found | Glycine max (L.) Merr. | not found | protoplast | CRISPR-Cas12 |
| PCdb_3326 | 32945949 | FAD2-1B | Omega-6 fatty acid desaturase | TTTCCCTCATTGCATGGCCAATCTAT | not found | Glycine max (L.) Merr. | not found | protoplast | CRISPR-Cas12 |
| PCdb_3327 | 32945949 | FAD2-1B | Omega-6 fatty acid desaturase | TTTAGTCCCTTATTTCTCATGGAAAA | not found | Glycine max (L.) Merr. | not found | protoplast | CRISPR-Cas12 |
| PCdb_3328 | 0 | Solyc02g077370(Pti5) | Pto-interacting protein 5 transcription factor | TTTAGAATGCGAGGTGCTA | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_3329 | 32945949 | FAD2-1B | Omega-6 fatty acid desaturase | TTTACAAGGCACTGTGGAGAGAAGC | not found | Glycine max (L.) Merr. | not found | protoplast | CRISPR-Cas12 |
| PCdb_3330 | 31370789 | 伪-gliadins | Alpha-gliadin storage protein | TTGTTGTGGCCATTGTACT | not found | Triticum aestivum L. | 0.196 | embryo | CRISPR/Cas9 |
| PCdb_3331 | 29692796 | ERECTA | Deciphering the Evolutionary Trajectory and Phenotypic | TTGTGTACGAAGATATAATG | not found | Oryza sativa L. | not found | protoplast | not found |
| PCdb_3332 | 37533135 | SHATTERING1 | controls activation rather than patterning of the abscission zone | TTGTGGGCATTGCACTAGCC | not found | Setaria viridis (L.) P. Beauv. | not found | abscission zone,abscission,Abscission | CRISPR-Cas9 |
| PCdb_3333 | 26891616 | CsPDS | Phytoene desaturase (PDS) | TTGTGCACAAGCAATTGTAC | not found | Oryza sativa L. | not found | leaf | CRISPR-Cas9 |
| PCdb_3334 | 32774339 | not found | not found | TTGTGATCACCGGAA | not found | Glycine max (L.) Merr. | not found | protoplast | CRISPR-Cas9 |
| PCdb_3335 | 37591976 | CP | confers a broad-spectrum resistance against RNA viruses in potato | TTGGTTTTGCATTCTCAACGATTGGTTT | not found | Solanum tuberosum L. | not found | not found | CRISPR-Cas13 |
| PCdb_3336 | 35737098 | not found | not found | TTGGTGGTGAATTCCCATCAGGG | not found | Zea mays L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_3337 | 26891616 | AtBRI1 | Brassinosteroid receptor kinase (BRI1) | TTGGGTCATAACGATATCTC | not found | Oryza sativa L. | not found | leaf | CRISPR-Cas9 |
| PCdb_3338 | 34579415 | StPPO1B | Potato polyphenol oxidase 1B (StPPO1B, enzymatic browning) | TTGGCTACGAGTCGAATGA | not found | Solanum tuberosum L. | not found | leaf | CRISPR-Cas9 |
| PCdb_3339 | 34713245 | NbPDS-1 | Phytoene Desaturase 1 | TTGCGATGCCTAACAAGCCAG | not found | Nicotiana attenuata Torr. ex S.Watson | not found | protoplast | SaCas9, |
| PCdb_3340 | 35058949 | StLDP | Potato lipid droplet protein (StLDP, oil body formation) | TTGCCATTTTCAATTCACAA | not found | Phaeodactylum tricornutum Bohlin | 0.56 | protoplast | SpCas9 |
| PCdb_3341 | 29755497 | SGR1 | Stay-green protein SGR1 | TTGCCACATTAGTGGAGGCC | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_3342 | 28528644 | Solyc04g005320 | 5-enolpyruvylshikimate-3-phosphate synthase | TTCTAGTATGTCTGATACAC | not found | Solanum lycopersicum L. | 1 | seed | CRISPR-Cas9 |
| PCdb_3343 | 0 | Solyc04g005320 | Tomato fruit ripening regulator (Solyc04g005320) | TTCTAGTATGTCTGATACAC | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_3344 | 35652435 | VPg | Viral protein genome-linked (VPg, potyvirus replication) | TTCGCACTTCACTAAATCTCTCTTGAAT | not found | Solanum tuberosum L. | not found | calli | CRISPR-Cas13 |
| PCdb_3345 | 35652435 | VPg | Viral protein genome-linked (VPg, potyvirus replication) | TTCGCACTTCACTAAATCTCTCTTGAAT | not found | Solanum tuberosum L. | not found | calli | CRISPR-Cas13 |
| PCdb_3346 | 34305978 | BnGTR1 | Glucosinolate transporter 1 | TTCCTTTGCGACACTTACTT | not found | Brassica napus L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_3347 | 31572408 | LCH1 | Leaf color and height regulator 1 (chlorophyll metabolism) | TTCCTTGCCCATGTTGGTTCC | not found | Oryza sativa L. | not found | callus | CRISPR-Cas9 |
| PCdb_3348 | 31572408 | HHZ(TS1) | Thermosensitive rice line HHZ variant 1 (specific function undefined) | TTCCTTGCCCATGTTGGTCC | not found | Oryza sativa L. | not found | callus | CRISPR-Cas9 |
| PCdb_3349 | 36478403 | ZmACC1 | Acetyl-CoA carboxylase 1 (ZmACC1, fatty acid biosynthesis) | TTCCTCGGGCTGGACAAGTGTGG | not found | Zea mays L. | not found | seed | SpCas9 |
| PCdb_3350 | 37025130 | ZED1-related kinase 13 | is required for resistance against Pseudoidium neolycopersici | TTCCCATCAGTATAAGCCGG | not found | Arabidopsis thaliana (L.) Heynh. | not found | seed | CRISPR-Cas9 |
| PCdb_3351 | 37591976 | CP | confers a broad-spectrum resistance against RNA viruses in potato | TTCCATACCACTGGGGCATACTTCATGC | not found | Solanum tuberosum L. | not found | not found | CRISPR-Cas13 |
| PCdb_3352 | 26891616 | Os06g0142000 | Zinc finger AN1-type family protein [Source: RGAP] | TTCATGCTCAGGCATCGCTA | not found | Oryza sativa L. | not found | leaf | CRISPR-Cas9 |
| PCdb_3353 | 30796544 | DM 2 h | Disease resistance protein (DM2h NLR) | TTATTGATAATATATAGAGAGG | not found | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_3354 | 37312871 | Flo5 | Floral organ identity regulator | TTAGGTGGTCCTTTAACCGA | not found | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_3355 | 29087011 | Drb2b | dsRNA-binding protein 2b (small RNA pathway) | TTAGCTGGAATCATGTTTAC | not found | Glycine max (L.) Merr. | not found | hairy root | CRISPR-Cas9 |
| PCdb_3356 | 29087011 | Drb2a | dsRNA-binding protein 2a (small RNA pathway) | TTAGCTGGAATCATGTTTAC | not found | Glycine max (L.) Merr. | not found | hairy root | CRISPR-Cas9 |
| PCdb_3357 | 32371523 | not found | not found | TGTTTTATGCTAATCTTAAC | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_3358 | 34257043 | OsMLH3 | regulate synapsis and interference-sensitive crossover formation during meiosis in rice | TGTTTGATACAAGAGGCAAG | not found | Oryza sativa L. | not found | chloroplast | CRISPR-Cas9 |
| PCdb_3359 | 34943026 | not found | not found | TGTTCTCCAAACAATCCCAC | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_3360 | 31821678 | MIR | MicroRNA gene (non-coding RNA regulation) [Source: miRBase] | TGTGTTCTCAGGTCGCCCCTG | not found | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9,TALEN |
| PCdb_3361 | 26891616 | Waxy | Granule-bound starch synthase I (Waxy) | TGTGTGCTTACAGCCATGGC | not found | Oryza sativa L. | not found | leaf | CRISPR-Cas9 |
| PCdb_3362 | 33772993 | ZmbHLH122 | Basic helix-loop-helix transcription factor 122 (ZmbHLH122, stress response) | TGTGCTGCAAAGGTTCTAG | not found | Zea mays L. | not found | anther | CRISPR-Cas9 |
| PCdb_3363 | 35003180 | VviAIR12 | Genes Associated With Fungal Susceptibility in Vitis L. cv. Thompson Seedless | TGTCTGACTTGACTCCGTG | not found | Vitis vinifera L. | not found | calli | CRISPR-Cas9 |
| PCdb_3364 | 33024447 | TrxH | Thioredoxin H | tgtcgtcccagcctgaaaaa | not found | Zea mays L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_3365 | 33024447 | PDS1 | Phytoene desaturase | tgtattccgcggcatcacac | not found | Zea mays L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_3366 | 33263914 | not found | not found | TGGTTATGTGTCGGTAAAAT | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_3367 | 31845477 | RAP | alters fruit coloration | TGGTGCGCTCTTGTGAAGA | not found | Fragaria vesca L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_3368 | 30530202 | not found | not found | TGGTGAGGTAACTGATCGGC | not found | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_3369 | 37367609 | FGSG | Fusarium gene locus prefix | TGGCGTCGCGGATGGTCCAT | not found | Triticum aestivum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_3370 | 32623622 | OsGhd7 | Oryza sativa Grain number, plant height and heading date 7 (OsGhd7, flowering time regulation) | TGGCGAAGCGACCTCTCACT | not found | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_3371 | 26891616 | OsFTL12 | Flowering locus T-like protein 12 | TGGCAAGGAGTTCCGTTCCT | not found | Oryza sativa L. | not found | leaf | CRISPR-Cas9 |
| PCdb_3372 | 33104071 | OsABCG 15 | ABC transporter family protein involved in pollen development [Source: RGAP] | TGGCAAGCACATCCTCAAGGGGAT | not found | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_3373 | 37811725 | STAYGREEN | STAYGREEN (chlorophyll degradation) | TGGATGAGAAGAAACATCC | not found | Cucumis sativus L. | not found | not found | CRISPR-Cas9 |
| PCdb_3374 | 27622539 | GLV6_2 | GOLVEN peptide 6 | tggagttacaagcaataaaa | not found | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_3375 | 31370789 | 伪-gliadins | Alpha-gliadin storage protein | TGCTGGGGGAATGATTGTTG | not found | Triticum aestivum L. | 0.196 | embryo | CRISPR-Cas9 |
| PCdb_3376 | 26891616 | OsMRP15 | ABC transporter, multidrug resistance-associated protein 15 | TGCTAAAACTGAAACTAGTA | not found | Oryza sativa L. | not found | leaf | CRISPR-Cas9 |
| PCdb_3377 | 29708966 | heterotrimeric G伪 proteins | Heterotrimeric G伪 proteins, GTPases in signal transduction pathways | TGCGGAGGATCCTTCCCC | not found | Zea mays L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_3378 | 27622539 | GLV2_1 | GOLVEN peptide 2 | tgcgacgaggaaagacttg | not found | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_3379 | 29087011 | Drb2b | dsRNA-binding protein 2b (small RNA pathway) | TGCCAAGAATAAGAAACAAG | not found | Glycine max (L.) Merr. | not found | hairy root | CRISPR-Cas9 |
| PCdb_3380 | 29087011 | Drb2a | dsRNA-binding protein 2a (small RNA pathway) | TGCCAAGAATAAGAAACAAG | not found | Glycine max (L.) Merr. | not found | hairy root | CRISPR-Cas9 |
| PCdb_3381 | 29087011 | Drb | dsRNA-binding protein (small RNA pathway) | TGCCAAGAATAAGAAACAAG | not found | Glycine max (L.) Merr. | not found | hairy root | CRISPR-Cas9 |
| PCdb_3382 | 31134125 | OsALS | Acetolactate synthase involved in branched-chain amino acid biosynthesis [Source: RiceWiki] | TGCAGTCCGTGTAACAAAGA | not found | Oryza sativa L. | 0.83 | calli | CBE |
| PCdb_3383 | 26891616 | Os03g0126800 | Serine/threonine-protein kinase SAPK7 [Source: RGAP] | TGCACCTTGTATTTGCAGTT | not found | Oryza sativa L. | not found | leaf | CRISPR-Cas9 |
| PCdb_3384 | 34713245 | NbETR1-1 | Ethylene receptor 1-1 (ethylene signaling pathway) [Source: SolGenomics] | TGCACAAGAACCCATCTATA | not found | Nicotiana attenuata Torr. ex S.Watson | not found | protoplast | Target-AID |
| PCdb_3385 | 35982368 | hinT2 | increase grain hardness and reduce grain width in barley | TGCAACATCCCCAGCACTAC | not found | Hordeum vulgare L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_3386 | 30796544 | DM 2 h | Disease resistance protein (DM2h NLR) | TGATTTCTGCTAATTCATCAAGG | not found | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_3387 | 34360681 | ZmFAR1 & ZmABCG26 | Essential for Lipid Metabolism | TGATGATCCACTTCGACAT | not found | Zea mays L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_3388 | 30586438 | Os01g0833500 | Chalcone synthase-like polyketide synthase [Source: RAP-DB] | TGATGACTACCACGACTatcttggtacctttgAGTATTGGTGGACTCA | not found | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_3389 | 34217355 | fw2.2 | provides an excellent source of candidates for fruit size regulation in other domesticated species | TGATGACCCTGCTAACTGTT | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_3390 | 27622539 | GLV7_1 | GOLVEN peptide 7 | tgatgaaaaagatgatacg | not found | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_3391 | 0 | Solyc09g082800 | Tomato fruit ripening regulator (Solyc09g082800) | TGATATTTCGGGGAAAAGTT | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_3392 | 34257043 | OsMLH3 | regulate synapsis and interference-sensitive crossover formation during meiosis in rice | TGAGCCTTCACAGACTATTG | not found | Oryza sativa L. | not found | chloroplast | CRISPR-Cas9 |
| PCdb_3393 | 33772993 | ZmbHLH122 | Basic helix-loop-helix transcription factor 122 (ZmbHLH122, stress response) | TGAGAGAGATGGAATGGTC | not found | Zea mays L. | not found | anther | CRISPR-Cas9 |
| PCdb_3394 | 31673276 | TaABCC6 & TaNFXL1 & TansLTP9.4 | Combination: ABCC6 transporter; NFXL1 zinc-finger regulator; nsLTP9.4 lipid-transfer protein | TGACTGGCACAACGCAAGGT | not found | Triticum aestivum L. | 0.103 | protoplast | CRISPR-Cas9 |
| PCdb_3395 | 26891616 | SlDNMT3B | DNA (cytosine-5) methyltransferase 3B | TGAAGCACCCCGCCGACATC | not found | Oryza sativa L. | not found | leaf | CRISPR-Cas9 |
| PCdb_3396 | 33154763 | SlYDA | YODA-like MAPKK kinase (SlYDA) | TGAACCCTGGTTTCTGGCTA | not found | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_3397 | 33154763 | SlYDA | YODA-like MAPKK kinase (SlYDA) | TGAACCCTGGTTTCTGGCTA | not found | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_3398 | 35217878 | Rx3 | Disease resistance protein Rx3 (virus resistance) | TCTTCGGATCTTATGACACGTGG | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_3399 | 33024447 | PDS1 | Phytoene desaturase | tctgttgctaaggtaatatg | not found | Zea mays L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_3400 | 0 | Solyc12g010740 | Solyc12g010740 (not found) | TCTGGGATCGCCATCCCTTC | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_3401 | 37367609 | FGSG | Fusarium gene locus prefix | TCTGGCTGGAGCGGCCAGTT | not found | Triticum aestivum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_3402 | 35058949 | StLDP | Potato lipid droplet protein (StLDP, oil body formation) | TCTGGCACTACAGCGGACGA | not found | Phaeodactylum tricornutum Bohlin | 0.69 | protoplast | SpCas9 |
| PCdb_3403 | 33024447 | PDS1 | Phytoene desaturase | tctcgtcactatgtattccg | not found | Zea mays L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_3404 | 33024447 | ChlH | Magnesium-chelatase H subunit | tctcctcctccaggagacga | not found | Zea mays L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_3405 | 30543064 | GhMYB25 | MYB transcription factor 25 | TCTCCATGTAGCGACAAGG | not found | Gossypium hirsutum L. | 1 | protoplast | CRISPR-Cas9 |
| PCdb_3406 | 26891616 | SPL4 | SBP-box transcription factor 4 | TCTCCATATCTTCTTCCACA | not found | Oryza sativa L. | not found | leaf | CRISPR-Cas9 |
| PCdb_3407 | 37816147 | TAGL1 | Tomato AGAMOUS-like MADS-box TAGL1 | TCTCAGTTGAGAAAAACAAG | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_3408 | 35528934 | VYL | Loss of VYL function results in pale-yellow leaves in tissue culture without affecting further development and fertility and can act as a visual marker for gene editing in maize. | TCGGTGCGGAGGCCCTGTTG | not found | Zea mays L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_3409 | 26891616 | OsFTL7 | Flowering locus T-like protein 7 | TCGGCGCGTCGGCGCTGCTG | not found | Oryza sativa L. | not found | leaf | CRISPR-Cas9 |
| PCdb_3410 | 37504507 | SPL13 | SQUAMOSA-promoter binding-like protein 13 | TCGCCGGCATAAAGTTTGTG | not found | Solanum lycopersicum L. | not found | lateral shoots,bud,shoot,PLANT,stem nodes,plant | CRISPR-Cas9 |
| PCdb_3411 | 31762012 | CBF2 | Cold Acclimation | TCGCCGCCATAGCTCTCCG | not found | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_3412 | 27622539 | CLE18_1 | CLAVATA3/ESR-related peptide 18 | tcgaggaaaacaatatcgac | not found | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_3413 | 34980227 | CaS | Calcium-sensitive protein (generic term; may refer to calcium-binding or calcium-regulated proteins) | TCGAAAGCTCGTCAGGGTTTATGAAGTT | not found | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas13 |
| PCdb_3414 | 37504507 | CCD7 | Carotenoid cleavage dioxygenase 7 | TCCTCCAAAACTCTTGCCAC | not found | Solanum lycopersicum L. | not found | lateral shoots,bud,shoot,PLANT,stem nodes,plant | CRISPR-Cas9 |
| PCdb_3415 | 26365384 | Acc65I | Restriction endonuclease Acc65I, recognizes GGTACC sequence | TCCAGGATTCGGACTGCTT | not found | Zea mays L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_3416 | 26891616 | LOC_Os05g38140 | LOC_Os05g38140 (hypothetical) | TCCAGAATCGAGCGCACCGC | not found | Oryza sativa L. | not found | leaf | CRISPR-Cas9 |
| PCdb_3417 | 33263914 | not found | not found | TCCACTTCAAAATATTGTCA | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_3418 | 29087011 | Hen1 | HUA ENHANCER 1 (small RNA methylation enzyme) [Source: TAIR] | TCCAAAGCAATCAGATTCA | not found | Medicago truncatula Gaertn. | not found | hairy root | CRISPR-Cas9 |
| PCdb_3419 | 35326106 | The E3 Ubiquitin Ligase Gene Sl1 | Is Critical for Cadmium Tolerance | TCATTAAAGGGTCTTCAACA | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_3420 | 29881395 | not found | not found | TCATCTCCATCTTGGCCACT | not found | Oryza sativa L. | not found | protoplast | not found |
| PCdb_3421 | 31401729 | crNtPDS | Cryptochrome Nicotiana tabacum phytoene desaturase (light-regulated carotenoid enzyme) | TCATCCAGTCCTTAACACTTAAAC | not found | Nicotiana tabacum L. | not found | protoplast | CRISPR-Cas9,CRISPR-Cas12,SaCas9,Target-AID |
| PCdb_3422 | 34713245 | crNtPDS-1 | Phytoene desaturase, catalyzes phytoene to 味-carotene conversion (carotenoid pathway) | TCATCCAGTCCTTAACACTTAAAC | not found | Nicotiana attenuata Torr. ex S.Watson | not found | protoplast | CRISPR-Cas12 |
| PCdb_3423 | 35949953 | StISAC | Solanum tuberosum invertase/sucrose synthase activator, regulates carbohydrate metabolism | TCATAGACTCCCCTTGTAAG | not found | Solanum tuberosum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_3424 | 37467787 | not found | not found | TCAGGTAGTTTGGGCCCGGAAGC | not found | Oryza sativa L. | not found | not found | not found |
| PCdb_3425 | 0 | Solyc08g060970(PGA3) | Polygalacturonase 3 | TCAGGGTCAGGAACATGAG | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_3426 | 0 | Solyc05g014000(Pectin1) | Pectin methylesterase 1 | TCAGGGTCAGGAACATGAG | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_3427 | 37025130 | ZED1-related kinase 13 | ZED1-related kinase 13 (plant immune signaling) | TCAGGAACGGTATTAGCTGG | not found | Arabidopsis thaliana (L.) Heynh. | not found | seed | CRISPR-Cas9 |
| PCdb_3428 | 37467787 | not found | not found | TCAGCCTTGCTCGCGGTGCTTCCA | not found | Oryza sativa L. | not found | not found | not found |
| PCdb_3429 | 34579415 | StPPO2C | Potato polyphenol oxidase 2C (StPPO2C, enzymatic browning) | TCACGTGTTACATCGAAAA | not found | Solanum tuberosum L. | not found | leaf | CRISPR-Cas9 |
| PCdb_3430 | 26891616 | Os01g0891000 | UDP-glucosyl transferase OsUGT91C1 [Source: RGAP] | TCACCTTGCAAACATGGCGC | not found | Oryza sativa L. | not found | leaf | CRISPR-Cas9 |
| PCdb_3431 | 37620620 | P3 | P3 viral silencing suppressor (RNA interference suppression) | TCAATACTAAGTGTGTAAATATTTCATC | not found | Solanum tuberosum L. | not found | not found | CRISPR-Cas13 |
| PCdb_3432 | 30803101 | P3 | the potyviral membrane protein involved in virus replication, systemic infection, pathogenicity and movement | TCAATACTAAGTGTGTAAATATTCATC | not found | Solanum tuberosum L. | not found | protoplast | CRISPR-Cas13 |
| PCdb_3433 | 31877655 | FLN2 | Floral organ development protein FLORAL ORGAN NUMBER2 | TCAAGTGATGATGAGAGTGA | not found | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_3434 | 33396822 | PDS | Phytoene desaturase (PDS, carotenoid biosynthesis) | TCAAGTACCCCGGAGAATGAT | not found | Pyrus communis聽L. | 0.67 | protoplast | CRISPR-Cas9,Base editor |
| PCdb_3435 | 35168613 | GmPDS11g & GmPDS18g | Glycine max phytoene desaturase 11g & 18g (carotenoid biosynthesis) [Source: SoyBase] | TCAAGAATGGATGAAAAAGC | not found | Glycine max (L.) Merr. | not found | leaf | CRISPR-Cas9 |
| PCdb_3436 | 0 | Solyc12g008500 | Solyc12g008500 (not found) | TCAAAGTACTTGAGCTGCCT | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_3437 | 26891616 | OsFTL9 | Flowering locus T-like protein 9 | TATTGGTGGCACCGACCTGA | not found | Oryza sativa L. | not found | leaf | CRISPR-Cas9 |
| PCdb_3438 | 35003180 | VviSWEET4 | Vitis vinifera SWEET sugar transporter 4 (VviSWEET4, phloem loading) | TATCAGATAGAGTCCAGGA | not found | Vitis vinifera L. | not found | calli | CRISPR-Cas9 |
| PCdb_3439 | 0 | Solyc12g055720 | Tomato protein Solyc12g055720 (unknown function) | TATACCACACTAAATTCACC | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_3440 | 0 | Solyc03g114230(BHLH) | Basic helixoopelix transcription factor | TAGTCCAGAAAAGCTAGAC | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_3441 | 34579415 | StvacINV1B | Potato vacuolar invertase 1B (StvacINV1B, sugar metabolism) | TAGTCACGTTTCTTATGCG | not found | Solanum tuberosum L. | not found | leaf | CRISPR-Cas9 |
| PCdb_3442 | 33772993 | ZmTGA9-A | TGA transcription factor 9-A (defense response) | TAGTAGTTCTAGCCATTCA | not found | Zea mays L. | not found | anther | CRISPR-Cas9 |
| PCdb_3443 | 31845477 | RAP | alters fruit coloration | TAGGGCAGCCTGCCCCCAG | not found | Fragaria vesca L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_3444 | 35642449 | CLV3 | regulates de novo shoot regeneration in Arabidopsis thaliana | TAGGACTACATGAAGAGTTA | not found | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_3445 | 0 | Solyc10g085990(Mai5) | MAI5 (Solyc10g085990, meiotic chromosome organization) | TAGATCGTAATGGATTGCA | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_3446 | 37025130 | ZED1-related kinase 13 | ZED1-related kinase 13 (plant immune signaling) | TAGAGCGCATTTGAAATCCA | not found | Arabidopsis thaliana (L.) Heynh. | not found | seed | CRISPR-Cas9 |
| PCdb_3447 | 36570941 | Nudix hydrolase 14 | influences plant development and grain chalkiness in rice | TACTGCATTGCTGAACCCTG | not found | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_3448 | 33772993 | ZmTGA9-A | TGA transcription factor 9-A (defense response) | TACTCCATGTCGAACATGG | not found | Zea mays L. | not found | anther | CRISPR-Cas9 |
| PCdb_3449 | 36938045 | MIR162 | regulates stomatal conductance in response to low night temperature stress | TACTCCACTACTACTTCTGA | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_3450 | 33772993 | ZmTGA9 | TGA transcription factor 9 (salicylic acid signaling) | TACTCCACGTCAAACATGG | not found | Zea mays L. | not found | anther | CRISPR-Cas9 |
| PCdb_3451 | 33772993 | ZmTGA10 | TGA transcription factor 10 (jasmonic acid signaling) | TACGTCGGCCATATATACG | not found | Zea mays L. | not found | anther | CRISPR-Cas9 |
| PCdb_3452 | 31134125 | OsALS | Acetolactate synthase involved in branched-chain amino acid biosynthesis [Source: RiceWiki] | TACCCGGGCGGCGCGTCCAT | not found | Oryza sativa L. | 0.25 | calli | CBE |
| PCdb_3453 | 29270298 | pLAU | Uncharacterized protein | TACATGGTGTCGAGGGTACC | not found | Brassica napus L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_3454 | 29087011 | Hen1 | HUA ENHANCER 1 (small RNA methylation enzyme) [Source: TAIR] | TACATCTGAACAACATATC | not found | Medicago truncatula Gaertn. | not found | hairy root | CRISPR-Cas9 |
| PCdb_3455 | 26891616 | LOC_Os08g04390 | LOC_Os08g04390 (hypothetical) | TAAGGTCAGGGTCTTGTGGT | not found | Oryza sativa L. | not found | leaf | CRISPR-Cas9 |
| PCdb_3456 | 34267775 | FAD2 | FAD2 (Fatty acid desaturase 2, EC 1.14.19.2, linoleic acid biosynthesis) [Source: UniProt] | TAAGGTAGGAGAAAGAGCGA | not found | Camelina sativa (L.) Crantz | 0.4-84.1% | flower | CRISPR-Cas9 |
| PCdb_3457 | 30543064 | GhMYB25 | MYB transcription factor 25 | TAAGACCAGATATCAAAAG | not found | Gossypium hirsutum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_3458 | 34579415 | StvacINV1B | Potato vacuolar invertase 1B (StvacINV1B, sugar metabolism) | TAACAATCGGGTCTAAGAT | not found | Solanum tuberosum L. | not found | leaf | CRISPR-Cas9 |
| PCdb_3459 | 37919649 | MLO | Enhancing powdery mildew resistance | TGAGAGGTTCAGGTTTGCAA | NGG | Glycine max (L.) Merr. | not found | not found | CRISPR-Cas9 |
| PCdb_3460 | 36978193 | WRNEXO | Werner syndrome exonuclease (WRNEXO, DNA repair) | TGAGAAGTGAGACCAGTCTT | NGG | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_3461 | 36978193 | WRNEXO | Werner syndrome exonuclease (WRNEXO, DNA repair) | TCCAGTATAATGCATCTTGT | NGG | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_3462 | 36978193 | WRNEXO | Werner syndrome exonuclease (WRNEXO, DNA repair) | TCATCTGACCAGTAGCATAG | NGG | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_3463 | 27483984 | BIA | Benzylisoquinoline alkaloid biosynthesis-related protein | GUUUACUCGCUUAAACCGGU | NGG | Panicum virgatum L. | 0.85 | leaf | CRISPR-Cas9 |
| PCdb_3464 | 36498869 | PMR4 | Powdery mildew resistant 4, callose synthase involved in fungal defense | GTTAAAGCAGTCCCATACTCG | NGG | Solanum lycopersicum L. | 3.4-80.1% | protoplast | CRISPR-Cas9 |
| PCdb_3465 | 36978193 | WRNEXO | Werner syndrome exonuclease (WRNEXO, DNA repair) | GTCGATGTGCGTTCAACTGT | NGG | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_3466 | 36498869 | PMR4 | Powdery mildew resistant 4, callose synthase involved in fungal defense | GTACTGCCCCACACTCTGCG | NGG | Solanum lycopersicum L. | 1.2-93.4% | protoplast | CRISPR-Cas9 |
| PCdb_3467 | 31916673 | OsMPK9 | Mitogen-activated protein kinase 9 (pathogen defense) | GGTTATTAGCCTTTGATCCAAAGG | NGG | Oryza sativa L. | not found | protoplast | Base editor |
| PCdb_3468 | 37919649 | MLO | Enhancing powdery mildew resistance | GGTGCACCTGTGGTTGAGCC | NGG | Glycine max (L.) Merr. | not found | not found | CRISPR-Cas9 |
| PCdb_3469 | 36498869 | PMR4 | Powdery mildew resistant 4, callose synthase involved in fungal defense | GGATATCAGAGAAGGATCAG | NGG | Solanum lycopersicum L. | 1.1-99% | protoplast | CRISPR-Cas9 |
| PCdb_3470 | 36079639 | not found | not found | GGACTCAGAAGACTTGAGAA | NGG | Triticum aestivum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_3471 | 32973827 | MS2 or PP7 | Male sterility 2 (fatty acid reductase) / Phosphoprotein phosphatase 7 [Source: UniProt/TAIR] | GCCTTTAGCGTTTAGCCTTT | NGG | Nicotiana attenuata Torr. ex S.Watson | not found | protoplast | CRISPR-Cas9 |
| PCdb_3472 | 36498869 | PMR4 | Powdery mildew resistant 4, callose synthase involved in fungal defense | GCCAAGGTTGCCAGTGGCAA | NGG | Solanum lycopersicum L. | 2.2-99.3% | protoplast | CRISPR-Cas9 |
| PCdb_3473 | 36079639 | not found | not found | GCACTGGCACTGCTTGATGA | NGG | Triticum aestivum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_3474 | 37275253 | Nit1 | Nitrilase 1 involved in auxin biosynthesis pathway [Source: TAIR] | CCCTACACAAACCAACAGTACGG | NGG | Chlamydomonas reinhardtii P.A.Dang. | 0.1481 | protoplast | CRISPR-Cas9 |
| PCdb_3475 | 31916673 | OSMPK17 | Mitogen-activated protein kinase 17 (environmental responses) | CCACCCGCATCCTTAGGGAGAT | NGG | Oryza sativa L. | not found | protoplast | Base editor |
| PCdb_3476 | 36978193 | WRNEXO | Werner syndrome exonuclease (WRNEXO, DNA repair) | CAGAGAACTGGTCAGCATGT | NGG | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_3477 | 31916673 | OsCPK6 | Calcium-dependent protein kinase 6 (abiotic stress response) | ATGGGCAACTACTACTCGTGCGG | NGG | Oryza sativa L. | not found | protoplast | Base editor |
| PCdb_3478 | 36079639 | not found | not found | ATAGATAGCCAAGCAAAATA | NGG | Triticum aestivum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_3479 | 36978193 | WRNEXO | Werner syndrome exonuclease (WRNEXO, DNA repair) | AATAACTATTCATTCTTATT | NGG | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_3480 | 31134125 | OsWaxy | Oryza sativa granule-bound starch synthase (OsWaxy, amylose biosynthesis) | TACGGACCTGACACTGGAGT | NGAT | Oryza sativa L. | 0.04 | calli | CBE |
| PCdb_3481 | 31134125 | OsWaxy | Oryza sativa granule-bound starch synthase (OsWaxy, amylose biosynthesis) | CTCGTACCTGTCTGCAACCT | NGAT | Oryza sativa L. | 0.04 | calli | CBE |
| PCdb_3482 | 31134125 | OsWaxy | Oryza sativa granule-bound starch synthase (OsWaxy, amylose biosynthesis) | CTCCAGGAATGACGGATGGT | NGAT | Oryza sativa L. | 0.059 | calli | CBE |
| PCdb_3483 | 31134125 | OsWaxy | Oryza sativa granule-bound starch synthase (OsWaxy, amylose biosynthesis) | TGCAGACAGGTACGAGAGGG | NGAG | Oryza sativa L. | 0.1 | calli | CBE |
| PCdb_3484 | 31134125 | OsWaxy | Oryza sativa granule-bound starch synthase (OsWaxy, amylose biosynthesis) | CCGTCATTCCTGGAGAAGGT | NGAG | Oryza sativa L. | 0.5 | calli | CBE |
| PCdb_3485 | 31134125 | OsWaxy | Oryza sativa granule-bound starch synthase (OsWaxy, amylose biosynthesis) | CCAGCGTTGTGGCTGAGGTA | NGAG | Oryza sativa L. | 0.8 | calli | CBE |
| PCdb_3486 | 31134125 | OsWaxy | Oryza sativa granule-bound starch synthase (OsWaxy, amylose biosynthesis) | GTACCGAGGAGAGATCACCA | NGAC | Oryza sativa L. | 0.412 | calli | CBE |
| PCdb_3487 | 31916673 | OsCPK6 | Calcium-dependent protein kinase 6 (abiotic stress response) | GGGCAACTACTACTCGTGCGGCG | NCG | Oryza sativa L. | not found | protoplast | Base editor |
| PCdb_3488 | 31916673 | OSMPK17 | Mitogen-activated protein kinase 17 (environmental responses) | GAGTTATGGTGTTGTGGCTGCCCG | NCG | Oryza sativa L. | not found | protoplast | Base editor |
| PCdb_3489 | 31916673 | OsCPK5 | Calcium-dependent protein kinase 5 (stress signaling) | CGTCACGCTTAGATCCAAGTACT | NCG | Oryza sativa L. | not found | protoplast | Base editor |
| PCdb_3490 | 31916673 | OSMPK16 | Mitogen-activated protein kinase 16 (developmental regulation) | TGTGACTTCGGCCTTGCTCGAG | NAG | Oryza sativa L. | not found | protoplast | Base editor |
| PCdb_3491 | 31134125 | OsWaxy | Oryza sativa granule-bound starch synthase (OsWaxy, amylose biosynthesis) | TGGCACACTGGCCCACTGGC | NAG | Oryza sativa L. | 0.125 | calli | CBE |
| PCdb_3492 | 31916673 | OSMPK15 | Mitogen-activated protein kinase 15 (stress signaling) | TGAGAAAGTTGCTATCAAGAAG | NAG | Oryza sativa L. | not found | protoplast | Base editor |
| PCdb_3493 | 31134125 | OsWaxy | Oryza sativa granule-bound starch synthase (OsWaxy, amylose biosynthesis) | GGCCAGTGTGCCAGTCGTTG | NAG | Oryza sativa L. | 0.6 | calli | CBE |
| PCdb_3494 | 31916673 | OsCPK7 | Calcium-dependent protein kinase 7 (development regulation) | GCCAGAACGGGACTCTTGGGAG | NAG | Oryza sativa L. | not found | protoplast | Base editor |
| PCdb_3495 | 31134125 | OsWaxy | Oryza sativa granule-bound starch synthase (OsWaxy, amylose biosynthesis) | CTCCTCGGTACGACCAGTAC | NAG | Oryza sativa L. | 0.2 | calli | CBE |
| PCdb_3496 | 31134125 | OsWaxy | Oryza sativa granule-bound starch synthase (OsWaxy, amylose biosynthesis) | AGCCACAACGCTGGTATCCC | NAG | Oryza sativa L. | 0.08 | calli | CBE |
| PCdb_3497 | 32170285 | not found | not found | CAATCAAGGGCACCATGGCA | GTTG | Oryza sativa L. | not found | protoplast | CRISPR-Cas9,CRISPR-Cas12 |
| PCdb_3498 | 31410483 | not found | not found | CCACGTGATGACGGCGATG | GTG | Oryza sativa L. | not found | seed | CRISPR-Cas9 |
| PCdb_3499 | 33159140 | not found | not found | GGCAACGGAGCTCAGGCTCG | GTC | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9,CRISPR-Cas3,TiD |
| PCdb_3500 | 30537191 | OsMPK3 | Mitogen-activated protein kinase participating in defense responses | TGACGGAGTACGTGGTCACCC | GGTGGT | Oryza sativa L. | 0.061 | calli | CBE |
| PCdb_3501 | 30928637 | OsDEP1 | Oryza sativa Dense and Erect Panicle 1 (OsDEP1, panicle architecture) | gtgttatgggctgccaccat | GGT | Oryza sativa L. | not found | protoplast | xCas9 |
| PCdb_3502 | 30928637 | OsDEP1 | Oryza sativa Dense and Erect Panicle 1 (OsDEP1, panicle architecture) | GCCGCCGGCCGCACAGGTCCG | GGT | Oryza sativa L. | not found | protoplast | xCas9 |
| PCdb_3503 | 35755680 | QLD (Wxa) and YSZ (Wxb) | Waxy granule-bound starch synthase alleles (amylose synthesis) | GCCCAAGGTCCCGGAGTTCG | GGT | Oryza sativa L. | not found | protoplast | not found |
| PCdb_3504 | 31932727 | OsDEP1 | Oryza sativa Dense and Erect Panicle 1 (OsDEP1, panicle architecture) | GCACATGAGAGAACAATATT | GGT | Oryza sativa L. | 0.07 | calli | ABE |
| PCdb_3505 | 31932727 | OsDEP1 | Oryza sativa Dense and Erect Panicle 1 (OsDEP1, panicle architecture) | GCACATGAGAGAACAATATT | GGT | Oryza sativa L. | 0.07 | calli | ABE |
| PCdb_3506 | 28049122 | CpYGFP | Yellow fluorescent protein marker (likely experimental control/reporter) | CCTTCCTCTAGATACTTCTG | GGT | Chrysanthemum morifolium聽Ramat. | 0-33.8% | calli | CRISPR-Cas9 |
| PCdb_3507 | 33398158 | OsDEP1 | Dense and erect panicle 1 (panicle architecture control) | CCGCCGGCCGCACAGGTCCG | GGT | Oryza sativa L. | 0.028 | protoplast | not found |
| PCdb_3508 | 34713242 | OsMPK2 | Oryza sativa mitogen-activated protein kinase 2 (OsMPK2, stress signaling) | CAACGCCCGCAGATATGTGA | GGT | Oryza sativa L. | 0.947 | calli | CRISPR-xCas9 |
| PCdb_3509 | 31545544 | OsMPK2 | Mitogen-activated protein kinase 2 (stress signaling) | CAACGCCCGCAGATATGTGA | GGT | Oryza sativa L. | 0.643 | seed | CBE |
| PCdb_3510 | 36430441 | not found | not found | ATTGGGGGATCATTCAGAGCA | GGT | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_3511 | 30928637 | OsPDS | Oryza sativa phytoene desaturase (OsPDS, carotenoid biosynthesis) | ATCAAACTCTTTCATCGATAA | GGT | Oryza sativa L. | not found | protoplast | xCas9 |
| PCdb_3512 | 30928637 | OsPDS | Oryza sativa phytoene desaturase (OsPDS, carotenoid biosynthesis) | AGgtaaacgctgctctccat | GGT | Oryza sativa L. | not found | protoplast | xCas9 |
| PCdb_3513 | 34984801 | OsCKX2 | Cytokinin oxidase/dehydrogenase 2 | ACCGACGACGACGGTGACGA | GGT | Oryza sativa L. | not found | protoplast | CRISPR-Cas9,Base editor |
| PCdb_3514 | 28049122 | CpYGFP | Yellow fluorescent protein marker (likely experimental control/reporter) | ACAAGTGGGTGTCTGCACAG | GGT | Chrysanthemum morifolium聽Ramat. | 0-33.8% | calli | CRISPR-Cas9 |
| PCdb_3515 | 29446503 | lncRNA1459 | Long non-coding RNA 1459 | AAGCTGTCCTCAACGTTCCG | GGT | Solanum lycopersicum L. | not found | fruit | CRISPR-Cas9 |
| PCdb_3516 | 27226176 | OST2 | Plasma membrane H?-ATPase 2 | AAGCATCCCGCAACTTAG | GGT | Arabidopsis thaliana (L.) Heynh. | 0.93 | mature leaves | CRISPR-Cas9 |
| PCdb_3517 | 34608972 | JAZ1 | Jasmonate ZIM-domain protein 1 | AACTGTCTTGAAGGATAAC | GGT | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_3518 | 36292566 | BnFAD2 | Fatty acid desaturase 2, converts oleic acid to linoleic acid (omega-6 fatty acid synthesis) | aattgcatttcgaggaaatg | ggn | Brassica napus L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_3519 | 33328469 | BrOG1AOE | Brassica rapa overexpressor line 1A (transgenic construct) | CTGATTTTGTATTGTGTTGC | GGGGGT | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_3520 | 27226350 | not found | not found | TTGCGATGCCTAACAAGCCAG | GGGAAT | Oryza sativa L. | not found | protoplast | CRISPR-Cas9,SaCas9 |
| PCdb_3521 | 30537191 | TAC1 | Controls tiller angle and plant architecture in rice | CAAATCCCGCAAAAGGTGAAA | GGGAAT | Oryza sativa L. | 0.17 | calli | CBE |
| PCdb_3522 | 29735370 | St16DOX | Potato 16-hydroxylase (St16DOX, steroidal glycoalkaloid biosynthesis) | GTAGGTACCTATATCTTGGAGGG | GGG | Solanum tuberosum L. | not found | hairy root | CRISPR-Cas9 |
| PCdb_3523 | 31410483 | not found | not found | GGCTGCAAGATGATAACGG | GGG | Oryza sativa L. | not found | seed | CRISPR-Cas9 |
| PCdb_3524 | 31991936 | FWL | FWL (FW2-2-like cell number regulator, plasma membrane-associated) [Source: UniProt] | GCGCTGGTGATGCTCCTCAC | GGG | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_3525 | 31410483 | not found | not found | GCCTCCATCGTCTCCTTCC | GGG | Oryza sativa L. | not found | seed | CRISPR-Cas9 |
| PCdb_3526 | 36902202 | FAD2-1B | Omega-6 fatty acid desaturase | GCAGAAGAAGCCTCTCTCAA | GGG | Glycine max (L.) Merr. | not found | protoplast | CRISPR-Cas9,Base editor |
| PCdb_3527 | 34376154 | GUX1 | not found | ATTTAGGGACTCGGAAAGG | GGG | Pinus radiata D. Don | not found | embryo | CRISPR-Cas9 |
| PCdb_3528 | 31991936 | FWL | FWL (FW2-2-like cell number regulator, plasma membrane-associated) [Source: UniProt] | ATCGCAGAAATCGTCGACAG | GGG | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_3529 | 33339449 | OsNAC14 | NAC transcription factor regulating stress responses | AAGAGCTCTGGTGCAAGAAG | GGG | Oryza sativa L. | 0.938 | protoplast | not found |
| PCdb_3530 | 38925598 | LOC_Os10g25850 | taste quality | TTTAGCTTCTAGATTGACTA | GGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_3531 | 36544871 | vrn-A1 | Vernalization response gene A1 (vrn-A1, flowering time regulation) | TTGGTGGACTATCGGTACCG | GGG | Triticum aestivum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_3532 | 38925598 | LOC_Os06g30280 | taste quality | TTGGGGCCATAGACCAGCAA | GGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_3533 | 31198943 | miR396-encoding gene | leaf growth and developmental phase transition | TTGCGGTTCAATAAAGCTGT | GGG | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_3534 | 33557889 | Gh_A06G1561 | Gh_A06G1561 (Gossypium hirsutum auxin response factor, ARF) [Source: CottonGen] | TTGCATCATCAGCATCTCTA | GGG | Gossypium hirsutum L. | 0.5889 | seed | CRISPR-Cas9 |
| PCdb_3535 | 38925598 | LOC_Os11g14880 | taste quality | TTCTTACCAATCACTGGGTG | GGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_3536 | 38925598 | LOC_Os07g27359 | taste quality | TTCGATGTAATGCCTCCCTC | GGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_3537 | 31394891 | RS2Z37 | RNA splicing factor (zinc finger family) | TTCCTCGCGCACCCGGACCC | GGG | Oryza sativa L. | not found | callus | CRISPR-Cas9 |
| PCdb_3538 | 34211132 | 16S rRNA | 16S ribosomal RNA | TTATTGGCATTACTATAGT | GGG | Brassica napus L. | 0.99 | protoplast | Base editor |
| PCdb_3539 | 31452351 | Glyma.20G082500 | Sucrose synthase (Glyma.20G082500) [Source: SoyBase] | TTATTCAACCCCCAAAACAA | GGG | Glycine max (L.) Merr. | 0.592 | hairy root | CRISPR-Cas9 |
| PCdb_3540 | 38925598 | LOC_Os01g47130 | taste quality | TTATGGCGAGTAGCTCGGGC | GGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_3541 | 33015536 | AGO4 & NRPD1a & NRPE1 & RDR2 & RDR4 & RDR6 & CHLI1 & PIE1 | Multi-gene complex: RNA-directed DNA methylation machinery (small RNA biogenesis and chromatin modification) | TTATCAGCCTTATCATGTGG | GGG | Arabidopsis thaliana (L.) Heynh. | 0.18 | seed | CRISPR-Cas9 |
| PCdb_3542 | 33557889 | Gh_A12G2520 | Gh_A12G2520 (Gossypium hirsutum glutathione S-transferase A12G2520) [Source: CottonGen] | TTAGGGTTCCGTCATGTGCA | GGG | Gossypium hirsutum L. | 0.5889 | seed | CRISPR-Cas9 |
| PCdb_3543 | 33557889 | Gh_A04G0456 | Gh_A04G0456 (Gossypium hirsutum gibberellin 2-oxidase, GA inactivation) [Source: CottonGen] | TTACAGTCCCTCGCCACCAA | GGG | Gossypium hirsutum L. | 0.5889 | seed | CRISPR-Cas9 |
| PCdb_3544 | 34397079 | GmPPR576 | Pentatricopeptide repeat-containing protein | TTACACGCCATGGTCCAAAC | GGG | Glycine max (L.) Merr. | not found | protoplast | CRISPR-Cas9 |
| PCdb_3545 | 33557889 | Gh_A02G0932 | Gh_A02G0932 (Gossypium hirsutum dehydrin DHN1, abiotic stress response) [Source: CottonGen] | TTAAGAAGTCCGGAGAACTG | GGG | Gossypium hirsutum L. | 0.5889 | seed | CRISPR-Cas9 |
| PCdb_3546 | 35151447 | PpAPT | Physcomitrella adenosine phosphoribosyltransferase (PpAPT, purine metabolism) | TGTCTTAGGCCCTGTGATTA | GGG | Solanum tuberosum L. | not found | protoplast | CRISPR-Cas9,Prime editor |
| PCdb_3547 | 33557889 | Gh_A09G0654 | Gh_A09G0654 (Gossypium hirsutum laccase A09G0654) [Source: CottonGen] | TGTCGTTTCCGGAAGTAGGA | GGG | Gossypium hirsutum L. | 0.5889 | seed | CRISPR-Cas9 |
| PCdb_3548 | 36660867 | OsCKX | Rice cytokinin oxidase/dehydrogenase (cytokinin catabolism enzyme) | tgtcgaatgcaggagtcagt | ggg | Oryza sativa L. | not found | protoplast | CRISPR-Cas9,CRISPR-Cas12 |
| PCdb_3549 | 36660867 | OsCKX | Rice cytokinin oxidase/dehydrogenase (cytokinin catabolism enzyme) | tgtccaatgctggcatcagt | ggg | Oryza sativa L. | not found | protoplast | CRISPR-Cas9,CRISPR-Cas12 |
| PCdb_3550 | 31070861 | FER | FERONIA receptor-like kinase | TGTATAGGCTCAATGTTGGA | GGG | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_3551 | 31694550 | PDS | Phytoene desaturase | TGTATAACCTTACCATTTAA | GGG | Triticum aestivum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_3552 | 38925598 | LOC_Os04g31170 | taste quality | TGGTTGATTGCCAAGCGGAA | GGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_3553 | 30588320 | NAC1 | a new positive regulator of tomato fruit ripening | TGGTGGCAAACCACCCAAAG | GGG | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_3554 | 38925598 | LOC_Os03g22120 | taste quality | TGGGCTTACCAGATACTGGA | GGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_3555 | 38925598 | LOC_Os07g44200 | taste quality | TGGCTACTCCAGCCTCTGCG | GGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_3556 | 34343415 | LG1 | LIGULELESS1 (leaf patterning regulatory gene) [Source: MaizeGDB] | TGCTGTAGGAAGTCAAGATG | GGG | Hemisorghum C.E.Hubb. ex Bor | 0.007 | seed | CRISPR-Cas9 |
| PCdb_3557 | 37346168 | Solyc12g049300 | Tomato protein Solyc12g049300 (unknown function) | TGCTGACGGACATTAGACAC | GGG | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_3558 | 36902202 | FAD2-1A | Omega-6 fatty acid desaturase | TGCCTTCAGCAAGTACCAAT | GGG | Glycine max (L.) Merr. | not found | protoplast | CRISPR-Cas9,Base editor |
| PCdb_3559 | 33751803 | Waxy | Granule-bound starch synthase (Waxy, starch biosynthesis) | TGCCGATGAACGCGATCAGT | GGG | Oryza sativa L. | 0.861 | calli | ABE |
| PCdb_3560 | 31694550 | PDS | Phytoene desaturase | TGCAACGATCACCGATCGAA | GGG | Triticum aestivum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_3561 | 34669232 | OsPDS | Oryza sativa phytoene desaturase (OsPDS, carotenoid biosynthesis) | TGCAAAGATCACCGATTGAA | GGG | Oryza sativa L. | not found | protoplast | Base editor |
| PCdb_3562 | 37309421 | not found | not found | TGACGCCATCACCTACATTA | GGG | Solanum lycopersicum L. | not found | trichome,seedling,hypocotyl | CRISPR-Cas9 |
| PCdb_3563 | 31768121 | ELF3 | EARLY FLOWERING 3 (ELF3): circadian clock and photoperiodic flowering regulator | TGAATGATGCAGATAAAGGA | GGG | Arabidopsis thaliana (L.) Heynh. | 32-91% | protoplast | not found |
| PCdb_3564 | 37346168 | Solyc11g073120 | Tomato protein Solyc11g073120 (unknown function) | TGAATCCTGATCTCAAACAT | GGG | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_3565 | 37797782 | OsNF-YC5 | regulates salt tolerance in rice | TCTTGATCCTTGCAAGC | GGG | Oryza sativa L. | not found | not found | not found |
| PCdb_3566 | 34042262 | OsSPL14 | Squamosa-promoter binding-like 14 (ideal plant architecture regulator) | TCTTCTGTCAACCCAGCCAT | GGG | Oryza sativa L. | not found | protoplast | CBE |
| PCdb_3567 | 28527115 | not found | not found | TCTTACCCTTATTCGGGAGA | GGG | Gossypium hirsutum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_3568 | 32808386 | BnaA09.ZEP | confers orange color | TCTGGCGGCGAAGAAGAAA | GGG | Brassica napus L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_3569 | 38925598 | LOC_Os10g40260 | taste quality | TCTGCACAACTCAATGTCTG | GGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_3570 | 31694550 | PDS | Phytoene desaturase | TCTCTTGCCTCAAGCACTAT | GGG | Triticum aestivum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_3571 | 34555252 | not found | not found | TCTCATGGCGCCGCCGCCTC | ggg | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_3572 | 34675957 | ZEP1 | encodes the central component of the meiotic synaptonemal complex (SC) | TCGGGGCTTAGGGGTCTCGA | GGG | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_3573 | 35270079 | BnaMPK 3 | Mitogen-activated protein kinase 3 | TCGGCTAAAGTTATCCACA | GGG | Brassica napus L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_3574 | 32842152 | SPO11-2 | in meiosis in rice | tcgcagcggtcgatcATGgC | GGG | Arabidopsis thaliana (L.) Heynh. | not found | calli | CRISPR-Cas9 |
| PCdb_3575 | 30778363 | not found | not found | TCGACCGCATCACGGCCAAG | GGG | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_3576 | 35164736 | not found | not found | TCCTGGTGACCCTTACCTGA | GGG | Oryza sativa L. | not found | protoplast | Base editor |
| PCdb_3577 | 35164736 | GhPEBP | GhPEBP (Gossypium hirsutum phosphatidylethanolamine-binding protein) [Source: CottonGen] | TCCTGGTGACCCTTACCTGA | GGG | Gossypium hirsutum L. | not found | protoplast | Base editor |
| PCdb_3578 | 33557889 | Gh_A10G0929 | Gh_A10G0929 (Gossypium hirsutum aquaporin TIP2;1 A10G0929) [Source: CottonGen] | TCCTGGTCTTGACTACGAAA | GGG | Gossypium hirsutum L. | 0.5889 | seed | CRISPR-Cas9 |
| PCdb_3579 | 38925598 | LOC_Os01g74590 | taste quality | TCATCAGCGGCGCCATCCCG | GGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_3580 | 29867128 | AtFWA | FWA gene, regulates flowering time through DNA methylation | TCATACGAGCGCCGCTCTA | GGG | Arabidopsis thaliana (L.) Heynh. | 0.046 | protoplast | ABE |
| PCdb_3581 | 38925598 | LOC_Os01g16810 | taste quality | TCAGGGGAAGCTTTGCGCGA | GGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_3582 | 38925598 | LOC_Os10g41240 | taste quality | TCAGCCGTAGAACATCGCTG | GGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_3583 | 34025705 | NMCP | displayed reduced growth rate and curly thallus lobes | TCACACCGAAGACACCACCA | GGG | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_3584 | 24868032 | mGFP5 | Modified green fluorescent protein | TCAACAGGATCGAGCTTAA | GGG | Solanum lycopersicum L. | not found | hairy root | CRISPR-Cas9 |
| PCdb_3585 | 25146436 | CsPDS | Citrus sinensis phytoene desaturase | TCAAATCGGCTGAATTCTCC | GGG | Citrus 脳 sinensis (L.) Osbeck | 0.2 | Mesophyll protoplast | not found |
| PCdb_3586 | 37993454 | GmSNAPO2 | Soluble NSF attachment protein (vesicle trafficking) | TATGGGCGATCATTTGGCCA | ggg | Glycine max (L.) Merr. | not found | not found | CRISPR-Cas9 |
| PCdb_3587 | 35512407 | not found | not found | TATGCTCGAGGAATGATAAGC | GGG | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | Base editor |
| PCdb_3588 | 28066464 | MLO-7 | Mildew resistance locus O 7 (powdery mildew susceptibility) [Source: TAIR] | TATGCATTTCTGAGAGTGTT | GGG | Vitis vinifera L. | 0.001 | protoplast | CRISPR-Cas9 |
| PCdb_3589 | 35498707 | BnBRI1 | Brassinosteroid receptor kinase BRI1 | TATCTGTTTATTCTCAACTT | GGG | Brassica napus L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_3590 | 32841372 | EOD3 | regulates seed production | TATCCCGGTGGACCTGCATG | GGG | Brassica napus L. | not found | seed | CRISPR-Cas9 |
| PCdb_3591 | 32841372 | BnaEOD3 | regulates seed production | TATCCAGGTGGACCTGCATG | GGG | Brassica napus L. | not found | seed | CRISPR-Cas9 |
| PCdb_3592 | 39513889 | mPDS and ClPDS | Paired phytoene desaturases from melon (mPDS) and citrus (ClPDS) catalyzing phytoene 鈫?味-carotene in carotenoid biosynthesis; essential for chlorophyll and carotenoid formation and photoprotection. | TATCATCTATCTGTGGTCTA | GGG | Citrullus lanatus (Thunb.) Matsum. & Nakai | not found | protoplast | CRISPR/Cas9 |
| PCdb_3593 | 30622549 | LOC107784516 | Hypothetical protein LOC107784516 [Source: NCBI] | TATAAAGGAAAGCCCCCTAA | GGG | Nicotiana tabacum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_3594 | 37642157 | C4 | promotes rapeseed growth and yield | TAGGAAACTACTAATCGAA | GGG | Brassica napus L. | not found | not found | CRISPR-Cas9 |
| PCdb_3595 | 31694550 | PDS | Phytoene desaturase | TACTTTATTCCTTAAGCCAA | GGG | Triticum aestivum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_3596 | 28066464 | DIPM | Disease-Interacting Protein Module (likely involved in plant-pathogen interactions) | TACTGGACTTGCGAATCTCG | GGG | Vitis vinifera L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_3597 | 31452351 | Glyma.05G000700 Glyma.19G000700 | Cinnamate 4-hydroxylase (Glyma.05G000700 & Glyma.19G000700) [Source: SoyBase] | TACTGATTATGACATTAAGG | GGG | Glycine max (L.) Merr. | 0.592 | hairy root | CRISPR-Cas9 |
| PCdb_3598 | 29795191 | Ptr | Populus trichocarpa gene (specific function depends on full gene name) | TACTCCCTGGCCCTGTTCCA | GGG | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_3599 | 27618611 | EPSPS | 5-enolpyruvylshikimate-3-phosphate synthase | tactaaatatacaatccctt | ggg | Oryza sativa L. | 0.02 | protoplast | CRISPR-Cas9 |
| PCdb_3600 | 30625150 | RhH6 | Peroxidase RhH6 | TAAAAGGGACTCTTGGAAAA | GGG | Arabidopsis thaliana (L.) Heynh. | 0.045 | protoplast | CRISPR-Cas9 |
| PCdb_3601 | 36070109 | TraesCS5A02G473800 | Wheat protein kinase (TraesCS5A02G473800, signal transduction) | GTTTCCGATGGGGCGAGCGG | GGG | Triticum aestivum L. | 0.77 | leaf | not found |
| PCdb_3602 | 25398353 | NbPDS | Phytoene desaturase (carotenoid biosynthesis) [Source: SolGenomics] | GTTTAACCTGAACAAAGACG | GGG | Nicotiana tabacum L. | 0.63 | protoplast | CRISPR-Cas9 |
| PCdb_3603 | 29036337 | CLE22 | CLE-Peptide-Encoding Genes | GTTGGAGTGATTGCATCTTT | GGG | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_3604 | 31452351 | Glyma.16G208900 | amylase (Glyma.16G208900) [Source: SoyBase] | GTTGCTTCTTTTCCTTGTGG | GGG | Glycine max (L.) Merr. | 0.592 | hairy root | CRISPR-Cas9 |
| PCdb_3605 | 31993066 | not found | not found | GTTCGAGCTCCGCAAGGCCT | GGG | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_3606 | 34073486 | NbPDS | Phytoene desaturase (carotenoid biosynthesis) [Source: SolGenomics] | GTTCCTAATTCTTTGTTCAG | GGG | Nicotiana tabacum L. | 0.2289 | leaf | ABE |
| PCdb_3607 | 31728198 | pgUGT84A23 | Panax ginseng UGT84A23 glycosyltransferase (ginsenoside modification) | GTTCACGTGCCCTTGACCC | GGG | Punica granatum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_3608 | 26842991 | FGS | FGS (Arabidopsis thaliana FATTY ACID ELONGASE10, very-long-chain fatty acid biosynthesis) [Source: TAIR] | GTTAGACCTGATCTAGAAGT | GGG | Zea mays L. | 0.0231 | protoplast | CRISPR-Cas9 |
| PCdb_3609 | 31694550 | PDS | Phytoene desaturase | GTTAACCACATTCAGTCTTT | GGG | Triticum aestivum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_3610 | 35089385 | not found | not found | GTGTCTAAATCCGGACCATG | GGG | Daucus carota subsp. sativus (Hoffm.) Sch眉bl. & G.Martens | 0.119 | protoplast | CRISPR-Cas9 |
| PCdb_3611 | 26842991 | FGS | FGS (Arabidopsis thaliana FATTY ACID ELONGASE15, very-long-chain fatty acid biosynthesis) [Source: TAIR] | GTGTCATGTTTGAACCATAT | GGG | Zea mays L. | 0.2098 | protoplast | CRISPR-Cas9 |
| PCdb_3612 | 28349358 | EPFL9 | Epidermal Patterning Factor-Like 9 (stomatal density) | GTGTAGATGGTGTTCGAGGAA | GGG | Oryza sativa L. | 0.69 | embryo | CRISPR-Cas9 |
| PCdb_3613 | 30625150 | RhJAZ | Jasmonate ZIM-domain protein JAZ | GTGGAGAAGATGGGGCGGAG | GGG | Arabidopsis thaliana (L.) Heynh. | 0.412 | protoplast | CRISPR-Cas9 |
| PCdb_3614 | 27226176 | OST2 | Plasma membrane H?-ATPase 2 | GTGCCGAAACCATTCGTA | GGG | Arabidopsis thaliana (L.) Heynh. | 0.93 | mature leaves | CRISPR-Cas9 |
| PCdb_3615 | 36510797 | bHLH57 | Basic helix-loop-helix transcription factor 57, regulates various developmental processes | GTGCATTCACTGCTCCTCAA | GGG | Oryza sativa L. | not found | protoplast | not found |
| PCdb_3616 | 32841372 | BnaEOD3 | regulates seed production | GTGATCGCTAGCCAGATGGT | GGG | Brassica napus L. | not found | seed | CRISPR-Cas9 |
| PCdb_3617 | 30911123 | DsRed2 | Red fluorescent protein marker gene | GTGAAGCTGAAGGTGACCAA | GGG | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_3618 | 31782599 | Pid3 | Blast disease resistance protein 3 | GTCTGCCTAGATCCCAAGAC | GGG | Oryza sativa L. | A9=12.5%|A9=89.6%|A9=100% | seed | ABE |
| PCdb_3619 | 33152517 | APOBEC3A | the APOBEC family of cytidine deaminases | GTCGTCGGCGGCGATGGTGA | GGG | Oryza sativa L. | 0.594 | protoplast | CBE |
| PCdb_3620 | 27904648 | the urease gene | Urease (urea hydrolysis) | GTCGTAATCAAGTATTGCCG | GGG | Thalassiosira pseudonana Hasle & Heimdal | not found | protoplast | CRISPR-Cas9 |
| PCdb_3621 | 31694550 | PDS | Phytoene desaturase | GTCGGCAAGGTTCGCAATTC | GGG | Triticum aestivum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_3622 | 31983879 | DET2 | DE-ETIOLATED 2 (brassinosteroid biosynthetic enzyme involved in light responses) | GTATTGGGCTGGTTATATTC | GGG | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_3623 | 40364305 | BnABI5 | Drought tolerance | GTATGGAGTTGATATGGGA | GGG | Brassica napus L. | not found | seed | CRISPR/Cas9 |
| PCdb_3624 | 39513889 | mPDS and ClPDS | Paired phytoene desaturases from melon (mPDS) and citrus (ClPDS) catalyzing phytoene 鈫?味-carotene in carotenoid biosynthesis; essential for chlorophyll and carotenoid formation and photoprotection. | GTAGTGAGATTGTGGGCGAT | GGG | Citrullus lanatus (Thunb.) Matsum. & Nakai | not found | protoplast | CRISPR/Cas9 |
| PCdb_3625 | 28509421 | GmFT2a | Florigen FT homolog | GTAGGGATCCTCTCGTTGTT | GGG | Glycine max (L.) Merr. | 0.48 | leaf | CRISPR-Cas9 |
| PCdb_3626 | 32117361 | PBL-T1 | Pattern-triggered immunity protein PBL-T1 (disease resistance) | gTAGATCGTAATGGATTGCA | GGG | Limosella major Diels | not found | kinetoplastids | CRISPR-Cas9,Base editor |
| PCdb_3627 | 32117361 | Mai5 | Maintenance of Mai5 imprinted gene (seed development) [Source: MaizeGDB] | gTAGATCGTAATGGATTGCA | GGG | Lindbergia mexicana (Besch.) Cardot | not found | kinetoplastids | CRISPR-Cas9,Base editor |
| PCdb_3628 | 38925598 | LOC_Os01g68820 | taste quality | GTACGGCGGCGCCCATAGTC | GGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_3629 | 38925598 | LOC_Os01g48580 | taste quality | GTACCCTCTTCCACGGCGGA | GGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_3630 | 33557889 | Gh_A05G0432 | Gh_A05G0432 (Gossypium hirsutum ethylene-responsive transcription factor ERF109) [Source: CottonGen] | GTAATCTGGACCGCTAACAG | GGG | Gossypium hirsutum L. | 0.5889 | seed | CRISPR-Cas9 |
| PCdb_3631 | 33557889 | Gh_A06G0364 | Gh_A06G0364 (Gossypium hirsutum glutathione S-transferase, GST) [Source: CottonGen] | GTAAGTTCGTTGACCTTCGA | GGG | Gossypium hirsutum L. | 0.5889 | seed | CRISPR-Cas9 |
| PCdb_3632 | 36246293 | not found | palmarumycin biosynthetic gene cluster | GTAACGGTTTGCATCGACCT | GGG | Avicennia officinalis L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_3633 | 34042262 | OsALS | Acetolactate synthase | GGTTTGATGATCGTGTGACA | GGG | Oryza sativa L. | 0.01 | protoplast | CBE |
| PCdb_3634 | 38925598 | LOC_Os12g05680 | taste quality | GGTTGCCACACTCAGGAGGA | GGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_3635 | 29089547 | OsNramp5 | Rice natural resistance-associated macrophage protein 5, manganese/cadmium transporter | GGTTCTTCCTGTACGAGAGCGGG | GGG | Oryza sativa L. | 0.824 | calli | CRISPR-Cas9 |
| PCdb_3636 | 38925598 | LOC_Os11g31380 | taste quality | GGTGTGACATGCCCACAGCG | GGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_3637 | 31852823 | the maize G protein | controls shoot meristem development and immune responses | GGTGGTGAATTCCCATCA | GGG | Zea mays L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_3638 | 31452351 | Glyma.14G160100 Glyma.13G041300 | Peroxidase (Glyma.14G160100 & Glyma.13G041300) [Source: SoyBase] | GGTGGGTAGCATAGGCTTGG | GGG | Glycine max (L.) Merr. | 0.592 | hairy root | CRISPR-Cas9 |
| PCdb_3639 | 27515683 | MYBR | MYB-related transcription factor (stress response regulation) [Source: TAIR] | GGTGGACGCCCCGGACTCCT | GGG | Zea mays L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_3640 | 38925598 | LOC_Os08g07480 | taste quality | GGTGCTAGACAGAAGACCCG | GGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_3641 | 28585692 | OsGCD1 | essential for rice fertility and required for embryo dorsal-ventral pattern formation and endosperm development | GGTGCGCGAGCCGGGCTCCC | ggg | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_3642 | 26284791 | GmFEI2 | Leucine-rich repeat receptor-like kinase FEI2 (cell wall integrity) | GGTCTATATCACCTGACCTT | GGG | Glycine max (L.) Merr. | 0.1 | hairy root | CRISPR-Cas9 |
| PCdb_3643 | 36660914 | CIPK-B | essential for salt stress | GGTCGGTCGTACCATTGGCG | GGG | Marchantia polymorpha L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_3644 | 37313529 | BnaA09.ZEP and BnaC09.ZEP | regulate pollen tube guidance | GGTACAACACAAATTCTGCA | GGG | Brassica napus L. | not found | pollen grains,anther,Pollen tube,microspore,pollen,flower,plasma,pollen tube,style | CRISPR-Cas9 |
| PCdb_3645 | 38925598 | LOC_Os04g28120 | taste quality | GGGTAGGACACTCTGCTGAT | GGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_3646 | 38925598 | LOC_Os07g17460 | taste quality | GGGGCGCCACCGTTTGGACA | GGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_3647 | 38925598 | LOC_Os05g34730 | taste quality | GGGGAGATGATGAGGTACAG | GGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_3648 | 30214055 | GBSS | GBSS (Granule-bound starch synthase, EC 2.4.1.242, amylose biosynthesis) [Source: UniProt] | GGGCTGTTAACAAGCTTGAT | GGG | Solanum tuberosum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_3649 | 30459263 | PL | Pectate lyase | GGGCGCTAGCGTACACATAGC | GGG | Solanum lycopersicum L. | not found | Plantlets | CRISPR-Cas9 |
| PCdb_3650 | 34328250 | not found | not found | gggcaatttacaagggccca | ggg | Oryza sativa L. | not found | protoplast | not found |
| PCdb_3651 | 33068118 | not found | not found | GGGCAATGCTACTGCAACGA | GGG | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_3652 | 28487703 | ENGase | Endoacetylglucosaminidase (ENGase): key regulator of cell differentiation | GGGAGCGGCGCCCCGGGAGA | GGG | Hordeum vulgare L. | 0.022 | Immature embryos | CRISPR-Cas9 |
| PCdb_3653 | 28605576 | MOC3 | Regulator of tiller number (Monoculm3) | GGGAAGAGTGGAAGCGTCTC | GGG | Oryza sativa L. | 0.6413 | protoplast | CRISPR-Cas9 |
| PCdb_3654 | 38925598 | LOC_Os04g35000 | taste quality | GGCTGACATGGTGCACGCCT | GGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_3655 | 27148303 | IR and Rep of CABs | Intergenic region and repetitive elements of chloroplast DNA [Source: NCBI] | GGCGGTGTGTACCCCTGGGA | GGG | Gossypium hirsutum L. | not found | germplasm | CRISPR-Cas9 |
| PCdb_3656 | 35903231 | CPR5 | Constitutive Pathogen Response 5, regulates plant immunity and stress responses | GGCGGCGAACAAGAACTCTA | GGG | Glycine max (L.) Merr. | not found | protoplast | CRISPR-Cas9 |
| PCdb_3657 | 25917172 | ccdB | Toxin component of ccdAB toxin-antitoxin system, induces DNA gyrase inhibition and cell stasis | GGCGCTCGCCAAGTTCGACA | GGG | Oryza sativa L. | 0.854 | four | cas9 |
| PCdb_3658 | 38925598 | LOC_Os06g25130 | taste quality | GGCGCACGGGCACGGCCGAA | GGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_3659 | 38925598 | LOC_Os02g34320 | taste quality | GGCGACGGCGACAACAAGGA | GGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_3660 | 28155921 | pVS 1 | Plasmid stability protein pVS1 | GGCCCACGGTTTCCATTCAA | GGG | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9,SaCas9 |
| PCdb_3661 | 38925598 | LOC_Os01g56050 | taste quality | GGCCACCGCAAGAACTGGCG | GGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_3662 | 33152517 | APOBEC3A | the APOBEC family of cytidine deaminases | ACATTCTCCCAGTTCTTCGC | AGG | Oryza sativa L. | 0.793 | protoplast | CBE |
| PCdb_3663 | 30784179 | eIF4E | associated with resistance to potyviruses | ACATTAGAGGAAAGCAAGAA | AGG | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9,Base editor |
| PCdb_3664 | 33557889 | Gh_A13G0202 | Gh_A13G0202 (Gossypium hirsutum hypothetical protein A13G0202) [Source: CottonGen] | ACATGTTTAGCAGATATGGG | AGG | Gossypium hirsutum L. | 0.5889 | seed | CRISPR-Cas9 |
| PCdb_3665 | 33557889 | Gh_A10G1868 | Gh_A10G1868 (Gossypium hirsutum cellulose synthase A10G1868) [Source: CottonGen] | ACATGTTTAGCAGATACGGG | AGG | Gossypium hirsutum L. | 0.5889 | seed | CRISPR-Cas9 |
| PCdb_3666 | 30733188 | not found | not found | ACATGAGCGAAACCCTAT | AGG | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_3667 | 38925598 | LOC_Os02g55210 | taste quality | ACATATCTTGTTCTAGTAGG | AGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_3668 | 37882316 | not found | not found | ACAGTGACGGGAGGACTGCA | AGG | Oryza sativa L. | not found | not found | CRISPR-Cas9 |
| PCdb_3669 | 30887096 | ghd7-1 | Grain number, plant height and heading date 7, represses flowering | ACAGAGGGTGTTTGCTGTCC | AGG | Oryza sativa L. | not found | leaf | CRISPR-Cas9 |
| PCdb_3670 | 30917862 | Glyma.20g146200 | Isoflavone reductase (Glyma.20g146200) [Source: SoyBase] | ACAGAAGCAGAAACAGGAAG | AGG | Glycine max (L.) Merr. | not found | hairy root | CRISPR-Cas9 |
| PCdb_3671 | 32842152 | SPO11-2 | in meiosis in rice | acactatgcttatgatcgtc | AGG | Arabidopsis thaliana (L.) Heynh. | not found | calli | CRISPR-Cas9 |
| PCdb_3672 | 32528496 | qSH1 | qSH1 seed shattering QTL (domestication trait) | acacgtaccaccaaatgcta | AGG | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_3673 | 29867128 | AtALS & AtPDS & AtFT & AtLFY | Acetolactate synthase (ALS), Phytoene desaturase (PDS), Flowering locus T (FT), and Leafy (LFY) - Multiple gene targets for plant genetic studies | ACACACACACACACTCCTCT | AGG | Arabidopsis thaliana (L.) Heynh. | 0.0675 | protoplast | ABE |
| PCdb_3674 | 38925598 | LOC_Os03g20430 | taste quality | ACACAAAGCATCAGATCCAC | AGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_3675 | 34236584 | MS1 | regulating the microsporocyte cell plate expansion | ACAAGACGACCCCTCTGAGA | agg | Glycine max (L.) Merr. | not found | protoplast | CRISPR-Cas9 |
| PCdb_3676 | 33557889 | Gh_A11G3237 | Gh_A11G3237 (Gossypium hirsutum glucanase A11G3237) [Source: CottonGen] | ACAACATCTGAAACACGAGG | AGG | Gossypium hirsutum L. | 0.5889 | seed | CRISPR-Cas9 |
| PCdb_3677 | 29552023 | TcNPR3 | Theobroma cacao NPR3 (disease resistance) | ACAAAGACCAGCAAACTCAG | AGG | Theobroma cacao L. | 0.27 | leaf | CRISPR-Cas9 |
| PCdb_3678 | 38925598 | LOC_Os04g42634 | taste quality | ACAAACAGCAGAACCAGACG | AGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_3679 | 33339449 | miR418 | MicroRNA (function not fully characterized) | AATTCCACCGTGGTCCCTGG | AGG | Oryza sativa L. | 0.381 | protoplast | not found |
| PCdb_3680 | 34328250 | not found | not found | aatTATAttggtgtagcttc | agG | Oryza sativa L. | not found | chloroplast | CRISPR-Cas9 |
| PCdb_3681 | 36559613 | BnaRFL 11 | RAF-like protein 11, putative signaling component in developmental processes | AATGTGCAAATGGAAGATCGAA | AGG | Brassica napus L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_3682 | 36559613 | LOC106449291 | Hypothetical protein LOC106449291 [Source: NCBI] | AATGTGCAAATGGAAGATCGAA | AGG | Brassica napus L. | 31-96% | pollen grains | CRISPR-Cas9 |
| PCdb_3683 | 31694550 | PDS | Phytoene desaturase | AATGCTTACTTGGCCGGAGA | AGG | Triticum aestivum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_3684 | 27628577 | Gn1a | Cytokinin oxidase/dehydrogenase | AATGAAGCAAGAGCAGGTC | AGG | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_3685 | 30928636 | SNB | SUPERNUMERARY BRACT controlling spikelet development | AATCCTGATGATGCTGCAGT | AGG | Oryza sativa L. | 0.417 | calli | ABE |
| PCdb_3686 | 30051586 | SNB | Controls spikelet development and inflorescence architecture | AATCCTGATGATGCTGCAG | AGG | Oryza sativa L. | 0.8 | leaf | ABE |
| PCdb_3687 | 30729010 | BoMS1 | Male sterility 1 protein, involved in pollen development in Brassica oleracea | AAGTTGGTCCTTTCAGCTCG | AGG | Brassica oleracea var. capitata L. | 0.2778 | hypocotyl | CRISPR-Cas9 |
| PCdb_3688 | 34782822 | StSBE3 | Potato starch branching enzyme 3 (StSBE3, starch biosynthesis) | AAGTTGGATCCAAATTTAGG | AGG | Solanum tuberosum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_3689 | 31694550 | PDS | Phytoene desaturase | AAGTGCTTCACTGTTCCGTC | AGG | Triticum aestivum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_3690 | 34890109 | not found | not found | AAGGCCTTCGCCTCGTTACC | AGG | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_3691 | 30887096 | hd1-4 | Heading date 1, photoperiod sensitivity regulator | AAGGAGTTTGCAGAGAAGGA | AGG | Oryza sativa L. | not found | leaf | CRISPR-Cas9 |
| PCdb_3692 | 37313529 | BnaA09.ZEP and BnaC09.ZEP | regulate pollen tube guidance | AAGCTCGGAACGCCACTCAA | AGG | Brassica napus L. | not found | pollen grains,anther,Pollen tube,microspore,pollen,flower,plasma,pollen tube,style | CRISPR-Cas9 |
| PCdb_3693 | 29250878 | BnCLV3 | CLAVATA3 peptide ligand | AAGCATCATGCAGGAACATG | AGG | Brassica napus L. | 0.144 | seed | CRISPR-Cas9 |
| PCdb_3694 | 32841372 | BnCLV3 | regulates seed production | AAGCATCATGCAGGAACATG | AGG | Brassica napus L. | not found | seed | CRISPR-Cas9 |
| PCdb_3695 | 33557889 | Gh_A01G2151 | Gh_A01G2151 (Gossypium hirsutum cell wall invertase CWINV2, sucrose cleavage) [Source: CottonGen] | AAGCAGCGACCAGATCCAGG | AGG | Gossypium hirsutum L. | 0.5889 | seed | CRISPR-Cas9 |
| PCdb_3696 | 28066464 | DIPM | Disease-Interacting Protein Module (likely involved in plant-pathogen interactions) | AAGCACAGATCCCAGAACGG | AGG | Vitis vinifera L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_3697 | 37965680 | OsACL5 | triggers environmentally-dependent leaf rolling and reduces grain size | AAGATGGTTGGGGCCGTGC | AGG | Oryza sativa L. | not found | not found | CRISPR-Cas9 |
| PCdb_3698 | 30272679 | APOBEC1 | Apolipoprotein B mRNA editing enzyme (cytidine deaminase), RNA-editing protein | AAGATCTCTTCCTCGTTAGC | AGG | Solanum tuberosum L. | 0.05 | protoplast | PBE |
| PCdb_3699 | 31394891 | SR32 | Serine/arginine-rich splicing factor | AAGATCCCTCCGAGGCCACC | AGG | Oryza sativa L. | not found | callus | CRISPR-Cas9 |
| PCdb_3700 | 33339449 | miR169f | MicroRNA targeting NF-YA transcription factors | AAGAGCTGATTCGGTAGCCA | AGG | Oryza sativa L. | 0.857 | protoplast | not found |
| PCdb_3701 | 31694550 | PDS | Phytoene desaturase | AAGAGATGTGTTGGGCGGAA | AGG | Triticum aestivum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_3702 | 33396568 | CRTISO | Induced Somatic Recombination | AAGAGACATAGATGTGGAAG | agg | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_3703 | 38925598 | LOC_Os01g33370 | taste quality | AAGAAGTTGCATTCGTTACG | AGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_3704 | 31452351 | Glyma.14G112600 | Chalcone synthase (Glyma.14G112600) [Source: SoyBase] | AAGAAGTTCAGGGATGGAGG | AGG | Glycine max (L.) Merr. | 0.592 | hairy root | CRISPR-Cas9 |
| PCdb_3705 | 31452351 | Glyma.16G071300 Glyma.06G187600 Glyma.04G177300 | ABC transporter (Glyma.16G071300, Glyma.06G187600, Glyma.04G177300) [Source: SoyBase] | AAGAACCGCGACCGCAAGCG | AGG | Glycine max (L.) Merr. | 0.592 | hairy root | CRISPR-Cas9 |
| PCdb_3706 | 29036337 | CLE10 | CLE-Peptide-Encoding Genes | AACTCACCGAACCGTCCCTA | AGG | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_3707 | 40312015 | MsCLE3a | Controlling the angle of leaf petioles | AACTACAAGACATTGGTCAG | AGG | Medicago sativa L. | not found | protoplast | CRISPR/Cas9 |
| PCdb_3708 | 29250878 | BnCLV2 | CLAVATA2 receptor-like protein | AACGCGGAGTATCAATAGCG | AGG | Brassica napus L. | 0.487 | seed | CRISPR-Cas9 |
| PCdb_3709 | 32841372 | BnCLV2 | regulates seed production | AACGCGGAGTATCAATAGCG | AGG | Brassica napus L. | not found | seed | CRISPR-Cas9 |
| PCdb_3710 | 31237422 | not found | not found | AACCCAAGAACGAAACA CATAGG | AGG | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_3711 | 37346168 | Solyc02g087960 | Tomato protein Solyc02g087960 (uncharacterized) | AACATGGTCCAGGGAATTGG | AGG | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_3712 | 37346168 | Solyc02g067340 | Tomato protein Solyc02g067340 (uncharacterized) | AACATGGTCCAGGCAATTGG | AGG | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_3713 | 29569825 | zyp1 | Zipper protein 1 (synaptonemal complex component) | AACAATACACTTACAGCTG | AGG | Zea mays L. | 0.66 | calli | CRISPR-Cas9 |
| PCdb_3714 | 38925598 | LOC_Os03g26044 | taste quality | AAATCTTGGAACCTGTGACG | AGG | Oryza sativa L. | 0.8406 | protoplast | CRISPR/Cas9 |
| PCdb_3715 | 27579989 | DM2h promoter to exon 2 | DM2 gene (h variant) promoter through exon 2 sequence | AAATCTCACCGATACATGAA | AGG | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_3716 | 35779674 | SlMADS1 | regulate tomato sepal growth | AAATCGTCTCCCTAACACAG | AGG | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_3717 | 31553599 | not found | Gene not detected or not annotated in the database | AAAGCTCGTGTAGGGCGAACT | AGG | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_3718 | 30603093 | SlERFE1 | Ethylene-responsive factor E1 | AAACGAGCTCGACCCTCTAC | AGG | Solanum lycopersicum L. | 0.43 | Germ Cells | CRISPR-Cas9 |
| PCdb_3719 | 33015536 | AGO4 & NRPD1a & NRPE1 & RDR2 & RDR4 & RDR6 & CHLI1 & PIE1 | Multi-gene complex: RNA-directed DNA methylation machinery (small RNA biogenesis and chromatin modification) | AAACCATAAAGCTGTCACAG | AGG | Arabidopsis thaliana (L.) Heynh. | 0.17 | seed | CRISPR-Cas9 |
| PCdb_3720 | 36630019 | EgPAT | Oil palm Protein Acyl Transferase (EgPAT): palmitoyl?acyltransferase enzyme | AAACAGCACTTAATCATGTG | AGG | Elaeis guineensis Jacq. | not found | protoplast | CRISPR-Cas9 |
| PCdb_3721 | 30558146 | SBPase | Sedoheptulose-1 | 7-bisphosphatase | agg | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_3722 | 33557889 | Gh_A13G1973 | Gh_A13G1973 (Gossypium hirsutum peroxidase A13G1973) [Source: CottonGen] | GTTACCCTAGTAGCAATCCA | AGG | Gossypium hirsutum L. | 0.5889 | seed | CRISPR-Cas9 |
| PCdb_3723 | 26842991 | FGS | FGS (Arabidopsis thaliana FATTY ACID ELONGASE67, very-long-chain fatty acid biosynthesis) [Source: TAIR] | GTGAATATAGTCCCACGACA | AGG | Zea mays L. | 0.0212 | protoplast | CRISPR-Cas9 |
| PCdb_3724 | 26842991 | FGS | FGS (Arabidopsis thaliana FATTY ACID ELONGASE2, very-long-chain fatty acid biosynthesis) [Source: TAIR] | GGTGTACTTGAGATCATGGA | AGG | Zea mays L. | 0.0933 | protoplast | CRISPR-Cas9 |
| PCdb_3725 | 26842991 | FGS | FGS (Arabidopsis thaliana FATTY ACID ELONGASE37, very-long-chain fatty acid biosynthesis) [Source: TAIR] | GGGTTTCTTAGCGCGTGCAG | AGG | Zea mays L. | 0.294 | protoplast | CRISPR-Cas9 |
| PCdb_3726 | 26842991 | FGS | FGS (Arabidopsis thaliana FATTY ACID ELONGASE40, very-long-chain fatty acid biosynthesis) [Source: TAIR] | GGAGGTTAGACGAGAGCTGC | AGG | Zea mays L. | 0.4312 | protoplast | CRISPR-Cas9 |
| PCdb_3727 | 26842991 | FGS | FGS (Arabidopsis thaliana FATTY ACID ELONGASE56, very-long-chain fatty acid biosynthesis) [Source: TAIR] | GCCGTCAAGTACATCGACCG | AGG | Zea mays L. | 0.4 | protoplast | CRISPR-Cas9 |
| PCdb_3728 | 33557889 | Gh_A03G0180 | Gh_A03G0180 (Gossypium hirsutum R2R3-MYB transcription factor, flavonoid biosynthesis) [Source: CottonGen] | GAGACGATTGGCAACAGGCG | AGG | Gossypium hirsutum L. | 0.5889 | seed | CRISPR-Cas9 |
| PCdb_3729 | 26842991 | FGS | FGS (Arabidopsis thaliana FATTY ACID ELONGASE3, very-long-chain fatty acid biosynthesis) [Source: TAIR] | GAAAGATTGCTCCCATGTAC | AGG | Zea mays L. | 0.0141 | protoplast | CRISPR-Cas9 |
| PCdb_3730 | 26842991 | FGS | FGS (Arabidopsis thaliana FATTY ACID ELONGASE85, very-long-chain fatty acid biosynthesis) [Source: TAIR] | CAGAAGTCCTGGAGGGGGCT | AGG | Zea mays L. | 0.0189 | protoplast | CRISPR-Cas9 |
| PCdb_3731 | 30051586 | OsTOE1 | Encodes a protein involved in chloroplast development and photosynthesis regulation | GAGAATCCTGATGATGCTGC | AGCG | Oryza sativa L. | 0.026 | leaf | ABE |
| PCdb_3732 | 30245698 | MS8 | Transgene-Free Maize Male Sterile Lines | GCTGTCCGGGAAGGCCGTCG | AGCA | Zea mays L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_3733 | 34713242 | OsMPK2 | Oryza sativa mitogen-activated protein kinase 2 (OsMPK2, stress signaling) | CCACCTTCTTCGATCAAACC | AGC | Oryza sativa L. | not found | calli | CRISPR-xCas9 |
| PCdb_3734 | 34984801 | LF1 | LEAFY homolog 1 transcription factor | TGGGATGAAGGTTCCATGCT | AGC | Oryza sativa L. | not found | protoplast | CRISPR-Cas9,Base editor |
| PCdb_3735 | 30928636 | LF1 | Leaf rolling control gene affecting leaf morphology | TGGGATGAAGGTTCCATGCT | AGC | Oryza sativa L. | 0.02 | calli | ABE |
| PCdb_3736 | 30928636 | OsSPL4 | SQUAMOSA promoter binding protein-like 4 controlling development | TCTCTCTCTTCTGTCAACCC | AGC | Oryza sativa L. | not found | calli | CBE |
| PCdb_3737 | 34713242 | OsWaxy | Oryza sativa granule-bound starch synthase (OsWaxy, amylose biosynthesis) | GGCACACTGGCCCACTGGCG | AGC | Oryza sativa L. | not found | calli | CRISPR-xCas9 |
| PCdb_3738 | 30928637 | OsEPFL9 | Oryza sativa EPIDERMAL PATTERNING FACTOR-LIKE 9 (OsEPFL9, stomatal development) | GCAATCAAGGGCACCATGGC | AGC | Oryza sativa L. | not found | protoplast | xCas9 |
| PCdb_3739 | 30928637 | OsPDS | Oryza sativa phytoene desaturase (OsPDS, carotenoid biosynthesis) | GCAACCGATCATTAATACCA | AGC | Oryza sativa L. | not found | protoplast | xCas9 |
| PCdb_3740 | 30928637 | OsPDS | Oryza sativa phytoene desaturase (OsPDS, carotenoid biosynthesis) | GCAACCGATCATTAATACCA | AGC | Oryza sativa L. | not found | protoplast | xCas9 |
| PCdb_3741 | 30928637 | OsPDS | Oryza sativa phytoene desaturase (OsPDS, carotenoid biosynthesis) | GAAAAGTAGTCAGCATGTG | AGC | Oryza sativa L. | not found | protoplast | xCas9 |
| PCdb_3742 | 33398158 | OsALS | Acetolactate synthase (branched-chain amino acid biosynthesis) | CCCCACTTGGGATCATAGGC | AGC | Oryza sativa L. | 0.15 | protoplast | not found |
| PCdb_3743 | 30959555 | ALS | Acetolactate synthase, target site of ALS-inhibitor herbicides and essential for branched-chain amino acid biosynthesis | CCCCACTTGGGATCATAGGC | AGC | Oryza sativa L. | 0.59 | calli | CBE |
| PCdb_3744 | 37773156 | Os-AG04 | not found | AGTCCTGGCAAACAACCTGC | AGAAA | Oryza sativa L. | not found | not found | Base editor,CRISPR-Cas9,CRISPRi,CRISPR-Cas12 |
| PCdb_3745 | 30051586 | PMS3 | DNA mismatch repair protein maintaining genome stability | TGTTTGTCTACCATCCATCA | AGA | Oryza sativa L. | 0.714 | leaf | CBE |
| PCdb_3746 | 34984801 | OSMADS57 | MADS-box transcription factor 57 | TGTGAACAGAGAGGTGCCAC | AGA | Oryza sativa L. | not found | protoplast | CRISPR-Cas9,Base editor |
| PCdb_3747 | 30928637 | OsPDS | Oryza sativa phytoene desaturase (OsPDS, carotenoid biosynthesis) | TCTTTTTCCTTTATTCCTTA | AGA | Oryza sativa L. | not found | protoplast | xCas9 |
| PCdb_3748 | 30928636 | OsSPL7 | SQUAMOSA promoter binding protein-like 7 regulating copper homeostasis | TCTCTCTTCTGTCATCGGCT | AGA | Oryza sativa L. | 0.152 | calli | ABE |
| PCdb_3749 | 31070861 | FER | FERONIA receptor-like kinase | GGTGCAGGACTTGGTATTCC | AGA | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_3750 | 26995294 | not found | not found | GCTATTGAGCGGACACTGC | AGA | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_3751 | 33917747 | not found | not found | GCAGGACCAGCTGTTCC | AGA | Zea mays L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_3752 | 30928637 | OsEPFL9 | Oryza sativa EPIDERMAL PATTERNING FACTOR-LIKE 9 (OsEPFL9, stomatal development) | CTGATGCAAAGGGGTACCTG | AGA | Oryza sativa L. | not found | protoplast | xCas9 |
| PCdb_3753 | 31932727 | OsODEV | Oryza sativa ODEV transcription factor (OsODEV, chloroplast development) | CAGACACACACAATAGTCCC | AGA | Oryza sativa L. | 0.11 | calli | ABE |
| PCdb_3754 | 31932727 | OsODEV | Oryza sativa ODEV transcription factor (OsODEV, chloroplast development) | CAGACACACACAATAGTCCC | AGA | Oryza sativa L. | 0.02 | calli | ABE |
| PCdb_3755 | 30928637 | OsPDS | Oryza sativa phytoene desaturase (OsPDS, carotenoid biosynthesis) | ATTTCTACCTTATCGATGAA | AGA | Oryza sativa L. | not found | protoplast | xCas9 |
| PCdb_3756 | 30928637 | OsPDS | Oryza sativa phytoene desaturase (OsPDS, carotenoid biosynthesis) | ATCTTTTTCCTTTATTCCTTA | AGA | Oryza sativa L. | not found | protoplast | xCas9 |
| PCdb_3757 | 33751803 | EPSPS | EPSPS (5-enolpyruvylshikimate-3-phosphate synthase, EC 2.5.1.19, aromatic amino acid biosynthesis) [Source: UniProt] | GAGAAGGATGCGAAAGAGGA | AG | Oryza sativa L. | 0.857 | calli | ABE |
| PCdb_3758 | 29476916 | OsSPL14 | Rice SQUAMOSA promoter-binding protein-like 14, regulates ideal plant architecture | GCTGTGCTCTCTCTCTTCTGT | ACTCGA | Oryza sativa L. | not found | protoplast | not found |
| PCdb_3759 | 32970905 | Ms 2 | Fertility recovery of wheat male sterility | CCAACTCAGGATTGCATGGT | ACG | Triticum aestivum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_3760 | 26661595 | AT5G46790.1 | Arabidopsis calcium-binding protein (AT5G46790.1, stress signaling) | GGAGTGCTAGTCTGGCT | ACC | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | not found |
| PCdb_3761 | 32936726 | HSFA6A | offers ABA and osmotic stress insensitivity | GATACGTGTAAGTTCCTGA | ACC | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_3762 | 30645710 | not found | not found | CTACGAGGAGTTCTTCCACT | ACC | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_3763 | 26661595 | AT5G46790.1 | Arabidopsis calcium-binding protein (AT5G46790.1, stress signaling) | CGCCTCTGCCGCTATTGCA | ACC | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | not found |
| PCdb_3764 | 26284791 | GmSHR | SHORT-ROOT transcription factor (root patterning) | CCGGGGACCGAACCTACCGA | ACC | Glycine max (L.) Merr. | 0.357 | hairy root | CRISPR-Cas9 |
| PCdb_3765 | 33328464 | not found | not found | AGTTCGCCCATCATCAG | ACC | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_3766 | 30537191 | Pi-d2 | Disease resistance protein against rice blast fungus | TCCGAGCATAATGACAATAAT | AATGGT | Oryza sativa L. | 7.5%|7% | calli | CBE |
| PCdb_3767 | 37773156 | Os-AG02 | not found | AATAGATGCAGGAGAACAG | AAGAA | Oryza sativa L. | not found | not found | Base editor,CRISPR-Cas9,CRISPRi,CRISPR-Cas12 |
| PCdb_3768 | 32176419 | not found | not found | TGATAAGTGGTGTCATAGTTGAA | AAG | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_3769 | 31116473 | GhCLA | Phytoene desaturase | GGCCAAACATAGGGATCCAC | aag | Gossypium hirsutum L. | not found | protoplast | CRISPR-Cas9,Base editor |
| PCdb_3770 | 33557889 | Gh_A12G0439 | Gh_A12G0439 (Gossypium hirsutum sucrose synthase A12G0439) [Source: CottonGen] | GCCGTCATAGAATATTCAAG | AAG | Gossypium hirsutum L. | 0.5889 | seed | CRISPR-Cas9 |
| PCdb_3771 | 26284791 | GmSHR | SHORT-ROOT transcription factor (root patterning) | CCGATCACGATCAATCCCTC | AAC | Glycine max (L.) Merr. | 0.5 | hairy root | CRISPR-Cas9 |
| PCdb_3772 | 30245698 | MS8 | Transgene-Free Maize Male Sterile Lines | CGACGGCCTTCCCGGACAGC | AAAC | Zea mays L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_3773 | 32176419 | not found | not found | TGGATGTTTACTTTTGTACTACT | AAA | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_3774 | 38597776 | miR396b/c/d/f | Negative regulator of seed size and yield in soybean; knockout increases seed size and yield | TTTGTATTCTTCCACAGCTT | not found | Glycine max (L.) Merr. | not found | cotyledon node | CRISPR/Cas12SF01 |
| PCdb_3775 | 39138865 | CDPK | insect-resistance | TTGCAGAAACTGCTTCATG | not found | Gossypium spp. | 0.8949 | leaf | CRISPR/Cas9 |
| PCdb_3776 | 39138865 | CDPK | insect-resistance | TTGCAGAAACTGCTTCATG | not found | Gossypium spp. | 0.8949 | leaf | CRISPR/Cas9 |
| PCdb_3777 | 39138865 | CDPK | insect-resistance | TTGATTTCGCATCAGATCCA | not found | Gossypium spp. | 0.8949 | leaf | CRISPR/Cas9 |
| PCdb_3778 | 38597776 | miR396a/i | Negative regulator of seed size and yield in soybean; knockout increases seed size and yield | TTCCACAGCTTTCTTGAACT | not found | Glycine max (L.) Merr. | not found | cotyledon node | CRISPR/Cas12SF01 |
| PCdb_3779 | 39138865 | CDPK | insect-resistance | TTCAGCATAGCCGATGCCTT | not found | Gossypium spp. | 0.8949 | leaf | CRISPR/Cas9 |
| PCdb_3780 | 39138865 | CDPK | insect-resistance | TTCAGCATAGCCGATGCCTT | not found | Gossypium spp. | 0.8949 | leaf | CRISPR/Cas9 |
| PCdb_3781 | 39138865 | CDPK | insect-resistance | TTAGTTTCGAAAACGACCCA | not found | Gossypium spp. | 0.8949 | leaf | CRISPR/Cas9 |
| PCdb_3782 | 39138865 | CDPK | insect-resistance | TTAGAGGCGTTAAAGGCCA | not found | Gossypium spp. | 0.8949 | leaf | CRISPR/Cas9 |
| PCdb_3783 | 39138865 | CDPK | insect-resistance | TGTTGGGTCTTTGATTCCAA | not found | Gossypium spp. | 0.8949 | leaf | CRISPR/Cas9 |
| PCdb_3784 | 39138865 | CDPK | insect-resistance | TGTTGGGTCTTTGATTCCAA | not found | Gossypium spp. | 0.8949 | leaf | CRISPR/Cas9 |
| PCdb_3785 | 40542534 | GLK1 | GOLDEN2-LIKE transcription factor regulating chloroplast development and photosynthetic gene expression. | tgtgttgccaaatttggaga | not found | Populus L. | not found | leaf | CRISPR/Cas9 |
| PCdb_3786 | 40345045 | EnTCP4 | Class II TCP transcription factor regulating leaf morphogenesis and cell proliferation, involved in leaf shape formation and organ boundary establishment. | TGTGTGCCACTCCCATCATCACCAC | not found | Elymus nutans Griseb. | 0.1923 | seed | CRISPR/Cas9 |
| PCdb_3787 | 39138865 | CDPK | insect-resistance | TGGTGGAATTGGGGTTGAAC | not found | Gossypium spp. | 0.8949 | leaf | CRISPR/Cas9 |
| PCdb_3788 | 39138865 | CDPK | insect-resistance | TGGTGGAATTGGGGTTGAAC | not found | Gossypium spp. | 0.8949 | leaf | CRISPR/Cas9 |
| PCdb_3789 | 39138865 | CDPK | insect-resistance | TGGCTTAGGCTCTCTTCTCC | not found | Gossypium spp. | 0.8949 | leaf | CRISPR/Cas9 |
| PCdb_3790 | 40542534 | GLK2 | GOLDEN2-LIKE transcription factor regulating chloroplast development and photosynthetic gene expression. | tggataaggcagtgccttcg | not found | Populus L. | not found | leaf | CRISPR/Cas9 |
| PCdb_3791 | 39138865 | CDPK | insect-resistance | TGGAGATGTTTTGGTCAAG | not found | Gossypium spp. | 0.8949 | leaf | CRISPR/Cas9 |
| PCdb_3792 | 39138865 | CDPK | insect-resistance | TGCTCTTTGTAACAGGTGAA | not found | Gossypium spp. | 0.8949 | leaf | CRISPR/Cas9 |
| PCdb_3793 | 38478115 | PDS | Phytoene desaturase catalyzing the conversion of phytoene to 味-carotene in carotenoid biosynthesis; essential for chlorophyll and carotenoid formation and photoprotection. | TGCCTTAAACCGATTTCTTC | not found | Cicer arietinum L. | 4-6% | protoplast | CRISPR/Cas9 |
| PCdb_3794 | 39138865 | CDPK | insect-resistance | TGATGTAATGTTCGACAATT | not found | Gossypium spp. | 0.8949 | leaf | CRISPR/Cas9 |
| PCdb_3795 | 39138865 | CDPK | insect-resistance | TGAGGAAAGACATGAGGCAA | not found | Gossypium spp. | 0.8949 | leaf | CRISPR/Cas9 |
| PCdb_3796 | 39138865 | CDPK | insect-resistance | TGACGATGGACCCAAGTAG | not found | Gossypium spp. | 0.8949 | leaf | CRISPR/Cas9 |
| PCdb_3797 | 38842584 | PhTFL1a | plant architecture and early flowering | TGAAGATGTTCCCGAAGGTA | not found | Petunia 脳 atkinsiana (Sweet) D.Don ex W.H.Baxter | not found | protoplast | CRISPR/Cas9 |
| PCdb_3798 | 39138865 | CDPK | insect-resistance | TGAAAGAGGCAGCTGCTTCCA | not found | Gossypium spp. | 0.8949 | leaf | CRISPR/Cas9 |
| PCdb_3799 | 39138865 | CDPK | insect-resistance | TCTTAGGGTAAAAGCACCAA | not found | Gossypium spp. | 0.8949 | leaf | CRISPR/Cas9 |
| PCdb_3800 | 39138865 | CDPK | insect-resistance | TCTTAGGGTAAAAGCACCAA | not found | Gossypium spp. | 0.8949 | leaf | CRISPR/Cas9 |
| PCdb_3801 | 39138865 | CDPK | insect-resistance | TCGAAGATATTCTCCCCGA | not found | Gossypium spp. | 0.8949 | leaf | CRISPR/Cas9 |
| PCdb_3802 | 39138865 | CDPK | insect-resistance | TCCTCTTCTCCGTTTCTGTG | not found | Gossypium spp. | 0.8949 | leaf | CRISPR/Cas9 |
| PCdb_3803 | 39138865 | CDPK | insect-resistance | TCCTCTTCTCCGTTTCTGTG | not found | Gossypium spp. | 0.8949 | leaf | CRISPR/Cas9 |
| PCdb_3804 | 38425137 | PDS | Phytoene desaturase catalyzing the conversion of phytoene to 味-carotene in carotenoid biosynthesis; essential for chlorophyll and carotenoid formation and photoprotection. | TCCATTGCAATCGGTCATTT | not found | Kalanchoe blossfeldiana Poelln. | not found | hairy root | CRISPR/Cas9 |
| PCdb_3805 | 39138865 | CDPK | insect-resistance | TCACACCCAAGTTCATATCT | not found | Gossypium spp. | 0.8949 | leaf | CRISPR/Cas9 |
| PCdb_3806 | 39138865 | CDPK | insect-resistance | TCACACCCAAGTTCATATCT | not found | Gossypium spp. | 0.8949 | leaf | CRISPR/Cas9 |
| PCdb_3807 | 39138865 | CDPK | insect-resistance | TCAATTTGGGAGAGCGGTTC | not found | Gossypium spp. | 0.8949 | leaf | CRISPR/Cas9 |
| PCdb_3808 | 39138865 | CDPK | insect-resistance | TATGTACCAGATTTTCGACT | not found | Gossypium spp. | 0.8949 | leaf | CRISPR/Cas9 |
| PCdb_3809 | 39138865 | CDPK | insect-resistance | TATGCAAGAGAATGAACGAG | not found | Gossypium spp. | 0.8949 | leaf | CRISPR/Cas9 |
| PCdb_3810 | 39138865 | CDPK | insect-resistance | TAGTGCTTGCTCTAGTCTT | not found | Gossypium spp. | 0.8949 | leaf | CRISPR/Cas9 |
| PCdb_3811 | 39138865 | CDPK | insect-resistance | TAGCGGGAGCATCGATTACG | not found | Gossypium spp. | 0.8949 | leaf | CRISPR/Cas9 |
| PCdb_3812 | 39138865 | CDPK | insect-resistance | TAGCAGTTCGTAAAAGCCGT | not found | Gossypium spp. | 0.8949 | leaf | CRISPR/Cas9 |
| PCdb_3813 | 39138865 | CDPK | insect-resistance | TAGCAGCAGCATATAATTGC | not found | Gossypium spp. | 0.8949 | leaf | CRISPR/Cas9 |
| PCdb_3814 | 39138865 | CDPK | insect-resistance | TAGCAGCAAACATAAACCGT | not found | Gossypium spp. | 0.8949 | leaf | CRISPR/Cas9 |
| PCdb_3815 | 39138865 | CDPK | insect-resistance | TAACATAAGACAACGTACCG | not found | Gossypium spp. | 0.8949 | leaf | CRISPR/Cas9 |
| PCdb_3816 | 39138865 | CDPK | insect-resistance | TAACATAAGACAACGTACCG | not found | Gossypium spp. | 0.8949 | leaf | CRISPR/Cas9 |
| PCdb_3817 | 39138865 | CDPK | insect-resistance | TAACAGACAGACAAACAAG | not found | Gossypium spp. | 0.8949 | leaf | CRISPR/Cas9 |
| PCdb_3818 | 39138865 | CDPK | insect-resistance | GTTGGACAACAAGTATGTGAA | not found | Gossypium spp. | 0.8949 | leaf | CRISPR/Cas9 |
| PCdb_3819 | 39138865 | CDPK | insect-resistance | GTTGGACAACAAGTATGTGAA | not found | Gossypium spp. | 0.8949 | leaf | CRISPR/Cas9 |
| PCdb_3820 | 39138865 | CDPK | insect-resistance | GTTATTTGAATCACGGCCAA | not found | Gossypium spp. | 0.8949 | leaf | CRISPR/Cas9 |
| PCdb_3821 | 39138865 | CDPK | insect-resistance | GTTATTTGAATCACGGCCAA | not found | Gossypium spp. | 0.8949 | leaf | CRISPR/Cas9 |
| PCdb_3822 | 39138865 | CDPK | insect-resistance | GTGTTGTGTAGGTGATTGCG | not found | Gossypium spp. | 0.8949 | leaf | CRISPR/Cas9 |
| PCdb_3823 | 39138865 | CDPK | insect-resistance | GTGTTAACATCCTGCAGACT | not found | Gossypium spp. | 0.8949 | leaf | CRISPR/Cas9 |
| PCdb_3824 | 39138865 | CDPK | insect-resistance | GTCGATATCGAAGACGAAGT | not found | Gossypium spp. | 0.8949 | leaf | CRISPR/Cas9 |
| PCdb_3825 | 39138865 | CDPK | insect-resistance | GTCGATATCGAAGACGAAGT | not found | Gossypium spp. | 0.8949 | leaf | CRISPR/Cas9 |
| PCdb_3826 | 38988621 | BnDAD1 | Defender Against Cell Death 1, negatively regulates programmed cell death and contributes to stress tolerance in rapeseed. | GTCCTCTGGTTCGAACAACC | not found | Brassica napus L. | not found | callus | CRISPR/Cas9 |
| PCdb_3827 | 38988621 | BnDAD1 | Defender Against Cell Death 1, negatively regulates programmed cell death and contributes to stress tolerance in rapeseed. | GTCCTCTGGTTCCAACAACC | not found | Brassica napus L. | not found | callus | CRISPR/Cas9 |
| PCdb_3828 | 39138865 | CDPK | insect-resistance | GTCACATTACTCAGAACCAG | not found | Gossypium spp. | 0.8949 | leaf | CRISPR/Cas9 |
| PCdb_3829 | 39138865 | CDPK | insect-resistance | GTATGCACGTTGATGATGT | not found | Gossypium spp. | 0.8949 | leaf | CRISPR/Cas9 |
| PCdb_3830 | 39138865 | CDPK | insect-resistance | GTAGTAATGAACCAACCCGT | not found | Gossypium spp. | 0.8949 | leaf | CRISPR/Cas9 |
| PCdb_3831 | 39138865 | CDPK | insect-resistance | GTAGTAATGAACCAACCCGT | not found | Gossypium spp. | 0.8949 | leaf | CRISPR/Cas9 |
| PCdb_3832 | 38988621 | BnDAD1 | Defender Against Cell Death 1, negatively regulates programmed cell death and contributes to stress tolerance in rapeseed. | GTACGGTCAGTTCGTGGAAT | not found | Brassica napus L. | not found | callus | CRISPR/Cas9 |
| PCdb_3833 | 39138865 | CDPK | insect-resistance | GGTTGGAAGTCCATATTATG | not found | Gossypium spp. | 0.8949 | leaf | CRISPR/Cas9 |
| PCdb_3834 | 39138865 | CDPK | insect-resistance | GGTTGGAAGTCCATATTATG | not found | Gossypium spp. | 0.8949 | leaf | CRISPR/Cas9 |
| PCdb_3835 | 39138865 | CDPK | insect-resistance | GGTCTCAAACAGCCGAAGA | not found | Gossypium spp. | 0.8949 | leaf | CRISPR/Cas9 |
| PCdb_3836 | 39138865 | CDPK | insect-resistance | GGTCTCAAACAGCCGAAGA | not found | Gossypium spp. | 0.8949 | leaf | CRISPR/Cas9 |
| PCdb_3837 | 39138865 | CDPK | insect-resistance | GGTCAACATCACCATGGCAA | not found | Gossypium spp. | 0.8949 | leaf | CRISPR/Cas9 |
| PCdb_3838 | 39138865 | CDPK | insect-resistance | GGGTTCGAGACCAGGTCGA | not found | Gossypium spp. | 0.8949 | leaf | CRISPR/Cas9 |
| PCdb_3839 | 39138865 | CDPK | insect-resistance | GGGTTCGAGACCAGGTCGA | not found | Gossypium spp. | 0.8949 | leaf | CRISPR/Cas9 |
| PCdb_3840 | 39138865 | CDPK | insect-resistance | GGGGAGGCTGTATTATTCCT | not found | Gossypium spp. | 0.8949 | leaf | CRISPR/Cas9 |
| PCdb_3841 | 39096692 | OsWNK9 | Regulates Cd transport and retention to reduce Cd accumulation in brown rice | GGCATACTGTGTCAAGCTCC | not found | Oryza sativa L. | not found | callus | CRISPR/Cas9 |
| PCdb_3842 | 39138865 | CDPK | insect-resistance | GGATGTGGAGGATGCTAGGA | not found | Gossypium spp. | 0.8949 | leaf | CRISPR/Cas9 |
| PCdb_3843 | 39138865 | CDPK | insect-resistance | GGATGACAATGCAGTCCATT | not found | Gossypium spp. | 0.8949 | leaf | CRISPR/Cas9 |
| PCdb_3844 | 39271542 | OsWRKY70 | negatively regulates blast resistance and positively regulates cold tolerance. | GGACGAGCAGCAACAGTACT | not found | Oryza sativa L. | not found | callus | CRISPR/Cas9 |
| PCdb_3845 | 39138865 | CDPK | insect-resistance | GGAAGGGAACAATGCCAAAA | not found | Gossypium spp. | 0.8949 | leaf | CRISPR/Cas9 |
| PCdb_3846 | 39138865 | CDPK | insect-resistance | GCTCTATATTGTCGAGCTCA | not found | Gossypium spp. | 0.8949 | leaf | CRISPR/Cas9 |
| PCdb_3847 | 39138865 | CDPK | insect-resistance | GCTCTATATTGTCGAGCTCA | not found | Gossypium spp. | 0.8949 | leaf | CRISPR/Cas9 |
| PCdb_3848 | 39138865 | CDPK | insect-resistance | GCTAACATTGGCAGAGCAGA | not found | Gossypium spp. | 0.8949 | leaf | CRISPR/Cas9 |
| PCdb_3849 | 39138865 | CDPK | insect-resistance | GCGTTCGGGTGAAGTCAAAA | not found | Gossypium spp. | 0.8949 | leaf | CRISPR/Cas9 |
| PCdb_3850 | 38478115 | PDS | Phytoene desaturase catalyzing the conversion of phytoene to 味-carotene in carotenoid biosynthesis; essential for chlorophyll and carotenoid formation and photoprotection. | GCGGCCACAGAAACCCTTGA | not found | Cicer arietinum L. | 4-6% | protoplast | CRISPR/Cas9 |
| PCdb_3851 | 38701041 | MeSWEET10a | Reduce cassava susceptibility to bacterial blight | GCCTTGCACTTGTCATTGGACTTC | not found | Manihot Mill. | not found | protoplast | CRISPR/Cas9 |
| PCdb_3852 | 39138865 | CDPK | insect-resistance | GCAGAAGGTTCACCACCAGC | not found | Gossypium spp. | 0.8949 | leaf | CRISPR/Cas9 |
| PCdb_3853 | 39138865 | CDPK | insect-resistance | GCACTTCACCCATATTATGT | not found | Gossypium spp. | 0.8949 | leaf | CRISPR/Cas9 |
| PCdb_3854 | 39138865 | CDPK | insect-resistance | GCAAGTTGTCGGCAACCACC | not found | Gossypium spp. | 0.8949 | leaf | CRISPR/Cas9 |
| PCdb_3855 | 39138865 | CDPK | insect-resistance | GCAAGTTGTCGGCAACCACC | not found | Gossypium spp. | 0.8949 | leaf | CRISPR/Cas9 |
| PCdb_3856 | 39138865 | CDPK | insect-resistance | GCAAGCTTAGGTAGAACTTA | not found | Gossypium spp. | 0.8949 | leaf | CRISPR/Cas9 |
| PCdb_3857 | 39138865 | CDPK | insect-resistance | GCAAGCTTAGGTAGAACTTA | not found | Gossypium spp. | 0.8949 | leaf | CRISPR/Cas9 |
| PCdb_3858 | 39138865 | CDPK | insect-resistance | GCAAATATGGAGAGATCCGT | not found | Gossypium spp. | 0.8949 | leaf | CRISPR/Cas9 |
| PCdb_3859 | 39138865 | CDPK | insect-resistance | GCAAATATGGAGAGATCCGT | not found | Gossypium spp. | 0.8949 | leaf | CRISPR/Cas9 |
| PCdb_3860 | 39138865 | CDPK | insect-resistance | GCAAACAAGAACATCCACAA | not found | Gossypium spp. | 0.8949 | leaf | CRISPR/Cas9 |
| PCdb_3861 | 39138865 | CDPK | insect-resistance | GATTGTGTAGGAGAGTGTTGA | not found | Gossypium spp. | 0.8949 | leaf | CRISPR/Cas9 |
| PCdb_3862 | 39138865 | CDPK | insect-resistance | GATTGTGTAGGAGAGTGTTGA | not found | Gossypium spp. | 0.8949 | leaf | CRISPR/Cas9 |
| PCdb_3863 | 39138865 | CDPK | insect-resistance | GATGAACTCATCGTAGTCTA | not found | Gossypium spp. | 0.8949 | leaf | CRISPR/Cas9 |
| PCdb_3864 | 39138865 | CDPK | insect-resistance | GAGGAAACTCAGAACTGCCG | not found | Gossypium spp. | 0.8949 | leaf | CRISPR/Cas9 |
| PCdb_3865 | 39138865 | CDPK | insect-resistance | GAGGAAACTCAGAACTGCCG | not found | Gossypium spp. | 0.8949 | leaf | CRISPR/Cas9 |
| PCdb_3866 | 39138865 | CDPK | insect-resistance | GACAGCAGAACCAAAGGAT | not found | Gossypium spp. | 0.8949 | leaf | CRISPR/Cas9 |
| PCdb_3867 | 39138865 | CDPK | insect-resistance | GACAGCAGAACCAAAGGAT | not found | Gossypium spp. | 0.8949 | leaf | CRISPR/Cas9 |
| PCdb_3868 | 39004308 | OsMYB14 | Regulates plant height through modulation of gibberellin and auxin metabolism. | GAAGCGGGGCAGCTTCTCGC | not found | Oryza sativa L. | not found | calli | CRISPR/Cas9 |
| PCdb_3869 | 39138865 | CDPK | insect-resistance | GAAGAAGCCAAGAGTCCTAA | not found | Gossypium spp. | 0.8949 | leaf | CRISPR/Cas9 |
| PCdb_3870 | 39138865 | CDPK | insect-resistance | GAACAATGCCAATAAGGCTT | not found | Gossypium spp. | 0.8949 | leaf | CRISPR/Cas9 |
| PCdb_3871 | 39138865 | CDPK | insect-resistance | GAACAATGCCAATAAGGCTT | not found | Gossypium spp. | 0.8949 | leaf | CRISPR/Cas9 |
| PCdb_3872 | 39138865 | CDPK | insect-resistance | GAAAGAGGCAGCTGCTTCCAT | not found | Gossypium spp. | 0.8949 | leaf | CRISPR/Cas9 |
| PCdb_3873 | 39138865 | CDPK | insect-resistance | CTTGTTTGTTGGCTTAATGG | not found | Gossypium spp. | 0.8949 | leaf | CRISPR/Cas9 |
| PCdb_3874 | 39138865 | CDPK | insect-resistance | CTTGCAAGTCGATCGCGAAA | not found | Gossypium spp. | 0.8949 | leaf | CRISPR/Cas9 |
| PCdb_3875 | 39370470 | SlWOX4 | Drought tolerance | CTTCTCCTTCACTTACTTGG | not found | Solanum lycopersicum L. | not found | seed | CRISPR/Cas9 |
| PCdb_3876 | 39138865 | CDPK | insect-resistance | CTTCACCTGTAAGAGATCCA | not found | Gossypium spp. | 0.8949 | leaf | CRISPR/Cas9 |
| PCdb_3877 | 38842584 | PhTFL1c | plant architecture and early flowering | CTCTTAGATAAGGATCACTA | not found | Petunia 脳 atkinsiana (Sweet) D.Don ex W.H.Baxter | not found | protoplast | CRISPR/Cas9 |
| PCdb_3878 | 38842584 | PhFT2 | plant architecture and early flowering | CTCCAATATCAACCCTAGGT | not found | Petunia 脳 atkinsiana (Sweet) D.Don ex W.H.Baxter | not found | protoplast | CRISPR/Cas9 |
| PCdb_3879 | 39138865 | CDPK | insect-resistance | CTAAGAAGAAGATGGTTTGG | not found | Gossypium spp. | 0.8949 | leaf | CRISPR/Cas9 |
| PCdb_3880 | 39138865 | CDPK | insect-resistance | CTAAGAAGAAGATGGTTTGG | not found | Gossypium spp. | 0.8949 | leaf | CRISPR/Cas9 |
| PCdb_3881 | 39138865 | CDPK | insect-resistance | CTAACCACTGACAAGGAGCT | not found | Gossypium spp. | 0.8949 | leaf | CRISPR/Cas9 |
| PCdb_3882 | 39138865 | CDPK | insect-resistance | CTAACCACTGACAAGGAGCT | not found | Gossypium spp. | 0.8949 | leaf | CRISPR/Cas9 |
| PCdb_3883 | 38842584 | PhFT2 | plant architecture and early flowering | CGTTGATAACATCTCTACTT | not found | Petunia 脳 atkinsiana (Sweet) D.Don ex W.H.Baxter | not found | protoplast | CRISPR/Cas9 |
| PCdb_3884 | 39138865 | CDPK | insect-resistance | CGTGCTTGCAGGAGTTCCAA | not found | Gossypium spp. | 0.8949 | leaf | CRISPR/Cas9 |
| PCdb_3885 | 39138865 | CDPK | insect-resistance | CGTGCTCTAATGCAGGCCGT | not found | Gossypium spp. | 0.8949 | leaf | CRISPR/Cas9 |
| PCdb_3886 | 39138865 | CDPK | insect-resistance | CGGTCGATATGTCGATTAGC | not found | Gossypium spp. | 0.8949 | leaf | CRISPR/Cas9 |
| PCdb_3887 | 39138865 | CDPK | insect-resistance | CGCTGCTTCTTTGCTTCGCA | not found | Gossypium spp. | 0.8949 | leaf | CRISPR/Cas9 |
| PCdb_3888 | 39138865 | CDPK | insect-resistance | CGCTGCTTCTTTGCTTCGCA | not found | Gossypium spp. | 0.8949 | leaf | CRISPR/Cas9 |
| PCdb_3889 | 39138865 | CDPK | insect-resistance | CGACAGCAGCAACCCAAGGA | not found | Gossypium spp. | 0.8949 | leaf | CRISPR/Cas9 |
| PCdb_3890 | 39138865 | CDPK | insect-resistance | CGACAGCAGCAACCCAAGGA | not found | Gossypium spp. | 0.8949 | leaf | CRISPR/Cas9 |
| PCdb_3891 | 39138865 | CDPK | insect-resistance | CCTTCCTAAGTGTTTGAAT | not found | Gossypium spp. | 0.8949 | leaf | CRISPR/Cas9 |
| PCdb_3892 | 39138865 | CDPK | insect-resistance | CCTTCCTAAGTGTTTGAAT | not found | Gossypium spp. | 0.8949 | leaf | CRISPR/Cas9 |
| PCdb_3893 | 39138865 | CDPK | insect-resistance | CCTGTCTGTGCAATAAGCAA | not found | Gossypium spp. | 0.8949 | leaf | CRISPR/Cas9 |
| PCdb_3894 | 38842584 | PhTFL1d | plant architecture and early flowering | CCTCTGTCACTTCTAAACCT | not found | Petunia 脳 atkinsiana (Sweet) D.Don ex W.H.Baxter | not found | protoplast | CRISPR/Cas9 |
| PCdb_3895 | 38842584 | PhTFL1b | plant architecture and early flowering | CCTCTGTCACTTCTAAACCT | not found | Petunia 脳 atkinsiana (Sweet) D.Don ex W.H.Baxter | not found | protoplast | CRISPR/Cas9 |
| PCdb_3896 | 38701041 | MeSWEET10a | Reduce cassava susceptibility to bacterial blight | CCTCCCCTATATAAACGCTTCTC | not found | Manihot Mill. | not found | protoplast | CRISPR/Cas9 |
| PCdb_3897 | 40014102 | HvGS3 | Barley homolog of rice GS3, a negative regulator of grain length, width, and thousand-grain weight; influences spike architecture and yield traits. | CCGCCAGATCAGCTTCCTCG | not found | Hordeum vulgare L. | not found | embryo | CRISPR/Cas9 |
| PCdb_3898 | 39370470 | SlWOX4 | Drought tolerance | CCCTCCTAACTTGCTTACAAT | not found | Solanum lycopersicum L. | not found | seed | CRISPR/Cas9 |
| PCdb_3899 | 39138865 | CDPK | insect-resistance | CCATTCATGACGTAACCATT | not found | Gossypium spp. | 0.8949 | leaf | CRISPR/Cas9 |
| PCdb_3900 | 39096692 | OsWNK9 | Regulates Cd transport and retention to reduce Cd accumulation in brown rice | CCATGACAGAGTCATCGATC | not found | Oryza sativa L. | not found | callus | CRISPR/Cas9 |
| PCdb_3901 | 39138865 | CDPK | insect-resistance | CAGTGGAACAATTAGCTTCG | not found | Gossypium spp. | 0.8949 | leaf | CRISPR/Cas9 |
| PCdb_3902 | 39138865 | CDPK | insect-resistance | CAGTGGAACAATTAGCTTCG | not found | Gossypium spp. | 0.8949 | leaf | CRISPR/Cas9 |
| PCdb_3903 | 39138865 | CDPK | insect-resistance | CAGTCCATATTAGCTTGCTC | not found | Gossypium spp. | 0.8949 | leaf | CRISPR/Cas9 |
| PCdb_3904 | 39138865 | CDPK | insect-resistance | CAGTCCATATTAGCTTGCTC | not found | Gossypium spp. | 0.8949 | leaf | CRISPR/Cas9 |
| PCdb_3905 | 39138865 | CDPK | insect-resistance | CAGCCAAATGGTGCATAATT | not found | Gossypium spp. | 0.8949 | leaf | CRISPR/Cas9 |
| PCdb_3906 | 39138865 | CDPK | insect-resistance | CACTTCGACAAAGACAATAG | not found | Gossypium spp. | 0.8949 | leaf | CRISPR/Cas9 |
| PCdb_3907 | 39138865 | CDPK | insect-resistance | CACTTACGTTGCAATAGACA | not found | Gossypium spp. | 0.8949 | leaf | CRISPR/Cas9 |
| PCdb_3908 | 39138865 | CDPK | insect-resistance | CAAGGGGACACTACACTGAA | not found | Gossypium spp. | 0.8949 | leaf | CRISPR/Cas9 |
| PCdb_3909 | 39138865 | CDPK | insect-resistance | CAAGCATTACGGACCGAGG | not found | Gossypium spp. | 0.8949 | leaf | CRISPR/Cas9 |
| PCdb_3910 | 39138865 | CDPK | insect-resistance | ATTGCACCACAGATCATCAA | not found | Gossypium spp. | 0.8949 | leaf | CRISPR/Cas9 |
| PCdb_3911 | 39138865 | CDPK | insect-resistance | ATTGCACCACAGATCATCAA | not found | Gossypium spp. | 0.8949 | leaf | CRISPR/Cas9 |
| PCdb_3912 | 39138865 | CDPK | insect-resistance | ATTCACAATTGCCCTGCACA | not found | Gossypium spp. | 0.8949 | leaf | CRISPR/Cas9 |
| PCdb_3913 | 39138865 | CDPK | insect-resistance | ATTCACAATTGCCCTGCACA | not found | Gossypium spp. | 0.8949 | leaf | CRISPR/Cas9 |
| PCdb_3914 | 39138865 | CDPK | insect-resistance | ATCCAAAGCCAAGCTGCGGA | not found | Gossypium spp. | 0.8949 | leaf | CRISPR/Cas9 |
| PCdb_3915 | 39138865 | CDPK | insect-resistance | ATCCAAAGCCAAGCTGCGGA | not found | Gossypium spp. | 0.8949 | leaf | CRISPR/Cas9 |
| PCdb_3916 | 39138865 | CDPK | insect-resistance | ATCACCCAACCCACTGAATAG | not found | Gossypium spp. | 0.8949 | leaf | CRISPR/Cas9 |
| PCdb_3917 | 39138865 | CDPK | insect-resistance | ATAGGGCAAGCAATGAAAGAC | not found | Gossypium spp. | 0.8949 | leaf | CRISPR/Cas9 |
| PCdb_3918 | 38842584 | PhFT1 | plant architecture and early flowering | AGTGGTTTACAACACTAGGG | not found | Petunia 脳 atkinsiana (Sweet) D.Don ex W.H.Baxter | not found | protoplast | CRISPR/Cas9 |
| PCdb_3919 | 39138865 | CDPK | insect-resistance | AGTGCACCGTGACATGAAAC | not found | Gossypium spp. | 0.8949 | leaf | CRISPR/Cas9 |
| PCdb_3920 | 39138865 | CDPK | insect-resistance | AGTGCACCGTGACATGAAAC | not found | Gossypium spp. | 0.8949 | leaf | CRISPR/Cas9 |
| PCdb_3921 | 39138865 | CDPK | insect-resistance | AGTGAGGAAGATGTTGACAA | not found | Gossypium spp. | 0.8949 | leaf | CRISPR/Cas9 |
| PCdb_3922 | 39138865 | CDPK | insect-resistance | AGGTTGATGTCTGGAGTGCT | not found | Gossypium spp. | 0.8949 | leaf | CRISPR/Cas9 |
| PCdb_3923 | 39138865 | CDPK | insect-resistance | AGCTGAAAGTCTTTCCGAGG | not found | Gossypium spp. | 0.8949 | leaf | CRISPR/Cas9 |
| PCdb_3924 | 39138865 | CDPK | insect-resistance | AGATGAGTTGGCTGATGAGC | not found | Gossypium spp. | 0.8949 | leaf | CRISPR/Cas9 |
| PCdb_3925 | 39138865 | CDPK | insect-resistance | ACTTCGGGAGCAACGTTAATA | not found | Gossypium spp. | 0.8949 | leaf | CRISPR/Cas9 |
| PCdb_3926 | 38977576 | TaQsd1 | Gene controlling seed dormancy; Trait: lengthened seed dormancy. | ACGGATCCACCTCCCTGCAG | not found | Triticum aestivum L. | 3-5% | Immature embryo | CRISPR/Cas9 |
| PCdb_3927 | 39138865 | CDPK | insect-resistance | ACAGACTGCTATAAAGAACG | not found | Gossypium spp. | 0.8949 | leaf | CRISPR/Cas9 |
| PCdb_3928 | 39138865 | CDPK | insect-resistance | ACAGAAGACCAGCCGATTGA | not found | Gossypium spp. | 0.8949 | leaf | CRISPR/Cas9 |
| PCdb_3929 | 39138865 | CDPK | insect-resistance | ACAGAAGACCAGCCGATTGA | not found | Gossypium spp. | 0.8949 | leaf | CRISPR/Cas9 |
| PCdb_3930 | 39138865 | CDPK | insect-resistance | ACAAGGAAGGGTCCAAGACA | not found | Gossypium spp. | 0.8949 | leaf | CRISPR/Cas9 |
| PCdb_3931 | 39138865 | CDPK | insect-resistance | ACAAGGAAGGGTCCAAGACA | not found | Gossypium spp. | 0.8949 | leaf | CRISPR/Cas9 |
| PCdb_3932 | 39138865 | CDPK | insect-resistance | AATGTTCTTCCCGATCCATT | not found | Gossypium spp. | 0.8949 | leaf | CRISPR/Cas9 |
| PCdb_3933 | 39138865 | CDPK | insect-resistance | AATGAAGCAGACCATCTAGT | not found | Gossypium spp. | 0.8949 | leaf | CRISPR/Cas9 |
| PCdb_3934 | 39138865 | CDPK | insect-resistance | AATGAAGCAGACCATCTAGT | not found | Gossypium spp. | 0.8949 | leaf | CRISPR/Cas9 |
| PCdb_3935 | 39138865 | CDPK | insect-resistance | AATCGCAATGCACAATCTTT | not found | Gossypium spp. | 0.8949 | leaf | CRISPR/Cas9 |
| PCdb_3936 | 39138865 | CDPK | insect-resistance | AATCCTGAAGTTGGTAAGAG | not found | Gossypium spp. | 0.8949 | leaf | CRISPR/Cas9 |
| PCdb_3937 | 39138865 | CDPK | insect-resistance | AAGTGGAACACTAAGCTACG | not found | Gossypium spp. | 0.8949 | leaf | CRISPR/Cas9 |
| PCdb_3938 | 40014102 | HvGS3 | Barley homolog of rice GS3, a negative regulator of grain length, width, and thousand-grain weight; influences spike architecture and yield traits. | AAGTCCCCGCTCGACCCCTG | not found | Hordeum vulgare L. | not found | embryo | CRISPR/Cas9 |
| PCdb_3939 | 38842584 | PhFT1 | plant architecture and early flowering | AAGGTCAACTAGCCTAAGAG | not found | Petunia 脳 atkinsiana (Sweet) D.Don ex W.H.Baxter | not found | protoplast | CRISPR/Cas9 |
| PCdb_3940 | 39138865 | CDPK | insect-resistance | AACATCGATACTGACAACAG | not found | Gossypium spp. | 0.8949 | leaf | CRISPR/Cas9 |
| PCdb_3941 | 26891616 | MPK1 | Mitogen-activated protein kinase 1, essential for stress and hormone signaling | NTGGCCCACGGGGTATAAAA | not found | Oryza sativa L. | not found | leaf | CRISPR-Cas9 |
| PCdb_3942 | 27452606 | GBSS | GBSS (Granule-bound starch synthase, EC 2.4.1.242, amylose biosynthesis) [Source: UniProt] | notfoind | not found | Solanum tuberosum L. | not found | protoplast | TALEN |
| PCdb_3943 | 27180265 | not found | not found | not found | not found | Oryza sativa L. | not found | protoplast | ZFN,TALEN |
| PCdb_3944 | 26153077 | not found | not found | not found | not found | Hordeum vulgare L. | not found | protoplast | ZFN,TALEN |
| PCdb_3945 | 23689819 | not found | not found | not found | not found | Hordeum vulgare L. | not found | protoplast | ZFN,TALEN |
| PCdb_3946 | 31360827 | not found | not found | not found | not found | Nicotiana tabacum L. | not found | protoplast | ZFN |
| PCdb_3947 | 31088537 | I-SceI | Homing endonuclease I-SceI | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | ZFN |
| PCdb_3948 | 31088537 | I-SceI | I-SceI homing endonuclease (site-specific DNA endonuclease) [Source: UniProt] | not found | not found | Oryza sativa L. | not found | protoplast | ZFN |
| PCdb_3949 | 25528147 | not found | not found | not found | not found | Malus x domestica Bork. | not found | protoplast | ZFN |
| PCdb_3950 | 23625357 | CRU3 | Cruciferin 3; seed storage protein in Arabidopsis seeds. | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | ZFN |
| PCdb_3951 | 23625357 | AT2G13770 | Arabidopsis thaliana gene AT2G13770 (uncharacterized protein) | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | ZFN |
| PCdb_3952 | 23279135 | TOPP2 | TOPP2 phosphatase (protein dephosphorylation) | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | ZFN |
| PCdb_3953 | 21262818 | not found | not found | not found | not found | Nicotiana tabacum L. | not found | protoplast | ZFN |
| PCdb_3954 | 21191373 | not found | not found | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | ZFN |
| PCdb_3955 | 21181530 | not found | not found | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | ZFN |
| PCdb_3956 | 20680843 | not found | not found | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | ZFN |
| PCdb_3957 | 20454835 | not found | not found | not found | not found | Nicotiana tabacum L. | not found | protoplast | ZFN |
| PCdb_3958 | 19754840 | GT | GT (Glycosyltransferase family protein) [Source: CAZy] | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | ZFN |
| PCdb_3959 | 19404258 | LOC107799742 | Hypothetical protein LOC107799742 [Source: NCBI] | not found | not found | Nicotiana tabacum L. | not found | protoplast | ZFN |
| PCdb_3960 | 18980651 | not found | not found | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | ZFN |
| PCdb_3961 | 16262717 | not found | not found | not found | not found | Nicotiana tabacum L. | not found | protoplast | ZFN |
| PCdb_3962 | 26687994 | ADH1 | Alcohol dehydrogenase 1 | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | ZFN |
| PCdb_3963 | 22082504 | not found | not found | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | ZFN |
| PCdb_3964 | 26426390 | not found | not found | not found | not found | Nicotiana tabacum L. | not found | Plant Cells | ZFN |
| PCdb_3965 | 21848915 | RAD54 | RAD54 DNA repair protein (homologous recombination) | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | Plant Cells | ZFN |
| PCdb_3966 | 19112554 | not found | not found | not found | not found | Nicotiana tabacum L. | not found | Cells, Cultured | ZFN |
| PCdb_3967 | 35561225 | atp1 | ATP synthase subunit alpha (mitochondrial) | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | Mitochondria | TALEN,Base editor |
| PCdb_3968 | 25846201 | not found | not found | not found | not found | Solanum tuberosum L. | not found | Vacuoles | TALEN |
| PCdb_3969 | 36703221 | nad7 | NADH dehydrogenase subunit 7 (mitochondrial) | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | TALEN |
| PCdb_3970 | 36365313 | not found | not found | not found | not found | Nicotiana tabacum L. | not found | protoplast | TALEN |
| PCdb_3971 | 35993881 | not found | not found | not found | not found | Hordeum vulgare L. | not found | protoplast | TALEN |
| PCdb_3972 | 35301443 | nad9 | NADH dehydrogenase subunit 9 (mitochondrial electron transport) [Source: NCBI] | not found | not found | Nicotiana tabacum L. | not found | protoplast | TALEN |
| PCdb_3973 | 35218074 | not found | not found | not found | not found | Oryza sativa L. | not found | protoplast | TALEN |
| PCdb_3974 | 34763881 | ycf2 | Chloroplast hypothetical protein YCF2 (plastid genome maintenance) | not found | not found | Nicotiana tabacum L. | not found | protoplast | TALEN |
| PCdb_3975 | 34763881 | rpoB | RNA polymerase beta subunit (rpoB, transcription) | not found | not found | Nicotiana tabacum L. | not found | protoplast | TALEN |
| PCdb_3976 | 34702578 | not found | not found | not found | not found | Solanum tuberosum L. | not found | protoplast | TALEN |
| PCdb_3977 | 33995462 | not found | not found | not found | not found | Hordeum vulgare L. | not found | protoplast | TALEN |
| PCdb_3978 | 33098708 | RPS5A | Ribosomal protein S5A | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | TALEN |
| PCdb_3979 | 32999297 | not found | not found | not found | not found | Chrysanthemum morifolium聽Ramat. | not found | protoplast | TALEN |
| PCdb_3980 | 32821228 | not found | not found | not found | not found | Solanum tuberosum L. | not found | protoplast | TALEN |
| PCdb_3981 | 32677892 | LOC107810216 | Hypothetical protein LOC107810216 [Source: NCBI] | not found | not found | Nicotiana tabacum L. | not found | protoplast | TALEN |
| PCdb_3982 | 32392723 | not found | not found | not found | not found | Hordeum vulgare L. | not found | protoplast | TALEN |
| PCdb_3983 | 32029874 | not found | not found | not found | not found | Oryza sativa L. | not found | protoplast | TALEN |
| PCdb_3984 | 31125501 | not found | not found | not found | not found | Triticum aestivum L. | not found | protoplast | TALEN |
| PCdb_3985 | 28360929 | not found | not found | not found | not found | Marchantia polymorpha L. | not found | protoplast | TALEN |
| PCdb_3986 | 26962325 | not found | not found | not found | not found | Hordeum vulgare L. | not found | protoplast | TALEN |
| PCdb_3987 | 26962325 | not found | not found | not found | not found | Nicotiana tabacum L. | not found | protoplast | TALEN |
| PCdb_3988 | 26668331 | Lig4 | affects the kinetics of TALEN-induced double-strand break repair in rice cells. | not found | not found | Oryza sativa L. | not found | protoplast | TALEN |
| PCdb_3989 | 26641666 | not found | not found | not found | not found | Oryza sativa L. | not found | protoplast | TALEN |
| PCdb_3990 | 25867543 | not found | not found | not found | not found | Oryza sativa L. | not found | protoplast | TALEN |
| PCdb_3991 | 25683503 | not found | not found | not found | not found | Oryza sativa L. | not found | protoplast | TALEN |
| PCdb_3992 | 25599829 | OsBADH2 | Betaine aldehyde dehydrogenase, key enzyme for 2-acetyl-1-pyrroline synthesis (fragrant rice compound) [Source: Gramene] | not found | not found | Oryza sativa L. | not found | protoplast | TALEN |
| PCdb_3993 | 24851712 | FAD2-1B | Omega-6 fatty acid desaturase | not found | not found | Glycine max (L.) Merr. | not found | protoplast | TALEN |
| PCdb_3994 | 24680698 | not found | not found | not found | not found | Oryza sativa L. | not found | protoplast | TALEN |
| PCdb_3995 | 24643227 | not found | not found | not found | not found | Hordeum vulgare L. | not found | protoplast | TALEN |
| PCdb_3996 | 23870552 | not found | not found | not found | not found | Brassica oleracea L. | not found | protoplast | TALEN |
| PCdb_3997 | 23288864 | OsDEP1 | heterotrimeric G protein 纬 subunit that regulates panicle architecture | not found | not found | Brachypodium distachyon (L.) P. Beauv. | 0.313 | protoplast | TALEN |
| PCdb_3998 | 22271303 | not found | not found | not found | not found | Nicotiana tabacum L. | not found | protoplast | TALEN |
| PCdb_3999 | 26011187 | not found | not found | not found | not found | Nicotiana attenuata Torr. ex S.Watson | not found | protoplast | TALEN |
| PCdb_4000 | 25848989 | not found | not found | not found | not found | Solanum tuberosum L. | not found | protoplast | TALEN |
| PCdb_4001 | 23124327 | LOC107799742 | Hypothetical protein LOC107799742 [Source: NCBI] | not found | not found | Nicotiana tabacum L. | not found | Plant Cells,Protoplasts | TALEN |
| PCdb_4002 | 28905511 | not found | not found | not found | not found | Saccharum officinarum L. | not found | Cell Wall | TALEN |
| PCdb_4003 | 27306903 | not found | not found | not found | not found | Saccharum officinarum L. | not found | Cell Wall | TALEN |
| PCdb_4004 | 31591150 | not found | not found | not found | not found | Medicago truncatula Gaertn. | not found | Cell Nucleus | TALEN |
| PCdb_4005 | 29061882 | ADF10 | Actin-depolymerizing factor 10, regulates actin cytoskeleton dynamics | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | Actin Cytoskeleton | TALEN |
| PCdb_4006 | 29061882 | ACT12 | Actin 12, cytoskeletal protein involved in cell structure and motility | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | Actin Cytoskeleton | TALEN |
| PCdb_4007 | 35314679 | AP1 | APETALA1 MADS-box transcription factor | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | SaCas9 |
| PCdb_4008 | 32362757 | PGN | plays an important role in plant defense against necrotrophic pathogens and the response to abiotic stress, such as abscisic acid, glucose, and salinity | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | MitochondrionPlastid | RNA editing |
| PCdb_4009 | 32362757 | MREF2 | involved in mitochondrial RNA editing | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | Mitochondrion | RNA editing |
| PCdb_4010 | 32362757 | MREF1 | involved in mitochondrial RNA editing | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | Mitochondrion | RNA editing |
| PCdb_4011 | 32358688 | PPRSp1 | pentatricopeptide repeat-containing protein At4g13650 | not found | not found | Hordeum vulgare L. | not found | Mitochondrion | RNA editing |
| PCdb_4012 | 32348368 | PpPPR_78 | involved in RNA editing but predominantly not in RNA recognition | not found | not found | Physcomitrella patens (Hedw.) Bruch & Schimp. | not found | Mitochondrion | RNA editing |
| PCdb_4013 | 32348368 | PpPPR_56 | involved in RNA editing but predominantly not in RNA recognition | not found | not found | Physcomitrella patens (Hedw.) Bruch & Schimp. | not found | Mitochondrion | RNA editing |
| PCdb_4014 | 19929879 | MEF11 | plays regulatory roles in cytosolic and plastidial isoprenoid biosynthesis through RNA editing | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | Mitochondrion | RNA editing |
| PCdb_4015 | 19934379 | OTP86 | chloroplast editing factors in Arabidopsis thaliana | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | chloroplast | RNA editing |
| PCdb_4016 | 19934379 | OTP85 | chloroplast editing factors in Arabidopsis thaliana | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | chloroplast | RNA editing |
| PCdb_4017 | 19934379 | OTP84 | chloroplast editing factors in Arabidopsis thaliana | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | chloroplast | RNA editing |
| PCdb_4018 | 19934379 | OTP81 | chloroplast editing factors in Arabidopsis thaliana | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | chloroplast | RNA editing |
| PCdb_4019 | 19934379 | OTP80 | chloroplast editing factors in Arabidopsis thaliana | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | chloroplast | RNA editing |
| PCdb_4020 | 37423765 | not found | improvement of barley abiotic stress tolerance | not found | not found | Hordeum vulgare L. | not found | protoplast | Prime editor,Base editor |
| PCdb_4021 | 34949802 | not found | not found | not found | not found | Oryza sativa L. | 0.243 | protoplast | Prime editor |
| PCdb_4022 | 37247094 | Hd3 | Florigen (mobile flowering signal) | not found | not found | Oryza sativa L. | not found | plants,flower,plant | Prime editor |
| PCdb_4023 | 26360626 | SPL & DD45 & LAT52 | Gametophytepecific promoters (SPL | not found | not found | Arabidopsis thaliana (L.) Heynh. | 43-53% | seed | not found |
| PCdb_4024 | 26360626 | SPL & DD45 & LAT52 | Gametophytepecific promoters (SPL | not found | not found | Arabidopsis thaliana (L.) Heynh. | 12-39% | seed | not found |
| PCdb_4025 | 35461452 | ICU2 | DNA polymerase catalytic subunit (ICU2) | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | seed | not found |
| PCdb_4026 | 35714805 | OsZIP11 | a trans-Golgi-residing transporter required for rice iron accumulation and development | not found | not found | Oryza sativa L. | not found | protoplast | not found |
| PCdb_4027 | 25398353 | AtBON1 | BONZAI1 (negative regulator of hypersensitive cell death) | not found | not found | Arabidopsis thaliana (L.) Heynh. | 0.2 | protoplast | not found |
| PCdb_4028 | 25398353 | AtBON1 | BONZAI1 (negative regulator of hypersensitive cell death) | not found | not found | Arabidopsis thaliana (L.) Heynh. | 0.2 | protoplast | not found |
| PCdb_4029 | 25269397 | RGEN | RNA-guided endonuclease (CRISPR/Cas) | not found | not found | Arabidopsis thaliana (L.) Heynh. | 0.9 | protoplast | not found |
| PCdb_4030 | 32098170 | PDM1 | improve the binding predictions of the A. thaliana E+ PPR proteins | not found | not found | Arabidopsis thaliana (L.) Heynh. | >30% | Plastid | not found |
| PCdb_4031 | 26123918 | PDM1 | involved in RNA editing and splicing of plastid genes in Arabidopsis thaliana | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | Plastid | not found |
| PCdb_4032 | 25315605 | TAD3 | leads to arrested embryo development at the globular stage. | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | Nucleus | not found |
| PCdb_4033 | 25315605 | TAD2 | leads to arrested embryo development at the globular stage. | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | Nucleus | not found |
| PCdb_4034 | 32098170 | PGN | improve the binding predictions of the A. thaliana E+ PPR proteins | not found | not found | Arabidopsis thaliana (L.) Heynh. | >30% | MitochondrionPlastid | not found |
| PCdb_4035 | 32098170 | OTP90 | improve the binding predictions of the A. thaliana E+ PPR proteins | not found | not found | Arabidopsis thaliana (L.) Heynh. | >30% | MitochondrionPlastid | not found |
| PCdb_4036 | 32098170 | MEF37 | improve the binding predictions of the A. thaliana E+ PPR proteins | not found | not found | Arabidopsis thaliana (L.) Heynh. | >30% | MitochondrionPlastid | not found |
| PCdb_4037 | 32098170 | DYW2 | improve the binding predictions of the A. thaliana E+ PPR proteins | not found | not found | Arabidopsis thaliana (L.) Heynh. | >30% | MitochondrionPlastid | not found |
| PCdb_4038 | 28760958 | NUWA | an RNA recognition motif-containing protein | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | MitochondrionPlastid | not found |
| PCdb_4039 | 28760958 | DYW2 | an RNA recognition motif-containing protein | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | MitochondrionPlastid | not found |
| PCdb_4040 | 32531050 | PPR27 | essential for complex III assembly and seed development in maize | not found | not found | Zea mays L. | not found | Mitochondrion | not found |
| PCdb_4041 | 32439621 | MEF47 | novel specificity factors for RNA editing sites in mitochondrial nad transcripts | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | Mitochondrion | not found |
| PCdb_4042 | 32439621 | MEF46 | novel specificity factors for RNA editing sites in mitochondrial nad transcripts | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | Mitochondrion | not found |
| PCdb_4043 | 32098170 | SLO4 | improve the binding predictions of the A. thaliana E+ PPR proteins | not found | not found | Arabidopsis thaliana (L.) Heynh. | >30% | Mitochondrion | not found |
| PCdb_4044 | 32098170 | SLO2 | improve the binding predictions of the A. thaliana E+ PPR proteins | not found | not found | Arabidopsis thaliana (L.) Heynh. | >30% | Mitochondrion | not found |
| PCdb_4045 | 32098170 | SLO1 | improve the binding predictions of the A. thaliana E+ PPR proteins | not found | not found | Arabidopsis thaliana (L.) Heynh. | >30% | Mitochondrion | not found |
| PCdb_4046 | 32098170 | SLG1 | improve the binding predictions of the A. thaliana E+ PPR proteins | not found | not found | Arabidopsis thaliana (L.) Heynh. | >30% | Mitochondrion | not found |
| PCdb_4047 | 32098170 | REME2 | improve the binding predictions of the A. thaliana E+ PPR proteins | not found | not found | Arabidopsis thaliana (L.) Heynh. | >30% | Mitochondrion | not found |
| PCdb_4048 | 32098170 | REME1 | improve the binding predictions of the A. thaliana E+ PPR proteins | not found | not found | Arabidopsis thaliana (L.) Heynh. | >30% | Mitochondrion | not found |
| PCdb_4049 | 32098170 | PPME | improve the binding predictions of the A. thaliana E+ PPR proteins | not found | not found | Arabidopsis thaliana (L.) Heynh. | >30% | Mitochondrion | not found |
| PCdb_4050 | 32098170 | OTP87 | improve the binding predictions of the A. thaliana E+ PPR proteins | not found | not found | Arabidopsis thaliana (L.) Heynh. | >30% | Mitochondrion | not found |
| PCdb_4051 | 32098170 | OTP72 | improve the binding predictions of the A. thaliana E+ PPR proteins | not found | not found | Arabidopsis thaliana (L.) Heynh. | >30% | Mitochondrion | not found |
| PCdb_4052 | 32098170 | OTP71 | improve the binding predictions of the A. thaliana E+ PPR proteins | not found | not found | Arabidopsis thaliana (L.) Heynh. | >30% | Mitochondrion | not found |
| PCdb_4053 | 32098170 | MEF9 | improve the binding predictions of the A. thaliana E+ PPR proteins | not found | not found | Arabidopsis thaliana (L.) Heynh. | >30% | Mitochondrion | not found |
| PCdb_4054 | 32098170 | MEF8S | improve the binding predictions of the A. thaliana E+ PPR proteins | not found | not found | Arabidopsis thaliana (L.) Heynh. | >30% | Mitochondrion | not found |
| PCdb_4055 | 32098170 | MEF8 | improve the binding predictions of the A. thaliana E+ PPR proteins | not found | not found | Arabidopsis thaliana (L.) Heynh. | >30% | Mitochondrion | not found |
| PCdb_4056 | 32098170 | MEF7 | improve the binding predictions of the A. thaliana E+ PPR proteins | not found | not found | Arabidopsis thaliana (L.) Heynh. | >30% | Mitochondrion | not found |
| PCdb_4057 | 32098170 | MEF57 | improve the binding predictions of the A. thaliana E+ PPR proteins | not found | not found | Arabidopsis thaliana (L.) Heynh. | >30% | Mitochondrion | not found |
| PCdb_4058 | 32098170 | MEF35 | improve the binding predictions of the A. thaliana E+ PPR proteins | not found | not found | Arabidopsis thaliana (L.) Heynh. | >30% | Mitochondrion | not found |
| PCdb_4059 | 32098170 | MEF32 | improve the binding predictions of the A. thaliana E+ PPR proteins | not found | not found | Arabidopsis thaliana (L.) Heynh. | >30% | Mitochondrion | not found |
| PCdb_4060 | 32098170 | MEF31 | improve the binding predictions of the A. thaliana E+ PPR proteins | not found | not found | Arabidopsis thaliana (L.) Heynh. | >30% | Mitochondrion | not found |
| PCdb_4061 | 32098170 | MEF3 | improve the binding predictions of the A. thaliana E+ PPR proteins | not found | not found | Arabidopsis thaliana (L.) Heynh. | >30% | Mitochondrion | not found |
| PCdb_4062 | 32098170 | MEF29 | improve the binding predictions of the A. thaliana E+ PPR proteins | not found | not found | Arabidopsis thaliana (L.) Heynh. | >30% | Mitochondrion | not found |
| PCdb_4063 | 32098170 | MEF26 | improve the binding predictions of the A. thaliana E+ PPR proteins | not found | not found | Arabidopsis thaliana (L.) Heynh. | >30% | Mitochondrion | not found |
| PCdb_4064 | 32098170 | MEF25 | improve the binding predictions of the A. thaliana E+ PPR proteins | not found | not found | Arabidopsis thaliana (L.) Heynh. | >30% | Mitochondrion | not found |
| PCdb_4065 | 32098170 | MEF22 | improve the binding predictions of the A. thaliana E+ PPR proteins | not found | not found | Arabidopsis thaliana (L.) Heynh. | >30% | Mitochondrion | not found |
| PCdb_4066 | 32098170 | MEF21 | improve the binding predictions of the A. thaliana E+ PPR proteins | not found | not found | Arabidopsis thaliana (L.) Heynh. | >30% | Mitochondrion | not found |
| PCdb_4067 | 32098170 | MEF20 | improve the binding predictions of the A. thaliana E+ PPR proteins | not found | not found | Arabidopsis thaliana (L.) Heynh. | >30% | Mitochondrion | not found |
| PCdb_4068 | 32098170 | MEF19 | improve the binding predictions of the A. thaliana E+ PPR proteins | not found | not found | Arabidopsis thaliana (L.) Heynh. | >30% | Mitochondrion | not found |
| PCdb_4069 | 32098170 | MEF18 | improve the binding predictions of the A. thaliana E+ PPR proteins | not found | not found | Arabidopsis thaliana (L.) Heynh. | >30% | Mitochondrion | not found |
| PCdb_4070 | 32098170 | MEF14 | improve the binding predictions of the A. thaliana E+ PPR proteins | not found | not found | Arabidopsis thaliana (L.) Heynh. | >30% | Mitochondrion | not found |
| PCdb_4071 | 32098170 | MEF13 | improve the binding predictions of the A. thaliana E+ PPR proteins | not found | not found | Arabidopsis thaliana (L.) Heynh. | >30% | Mitochondrion | not found |
| PCdb_4072 | 32098170 | MEF12 | improve the binding predictions of the A. thaliana E+ PPR proteins | not found | not found | Arabidopsis thaliana (L.) Heynh. | >30% | Mitochondrion | not found |
| PCdb_4073 | 32098170 | MEF11 | improve the binding predictions of the A. thaliana E+ PPR proteins | not found | not found | Arabidopsis thaliana (L.) Heynh. | >30% | Mitochondrion | not found |
| PCdb_4074 | 32098170 | MEF10 | improve the binding predictions of the A. thaliana E+ PPR proteins | not found | not found | Arabidopsis thaliana (L.) Heynh. | >30% | Mitochondrion | not found |
| PCdb_4075 | 32098170 | MEF1 | improve the binding predictions of the A. thaliana E+ PPR proteins | not found | not found | Arabidopsis thaliana (L.) Heynh. | >30% | Mitochondrion | not found |
| PCdb_4076 | 32098170 | GRS1 | improve the binding predictions of the A. thaliana E+ PPR proteins | not found | not found | Arabidopsis thaliana (L.) Heynh. | >30% | Mitochondrion | not found |
| PCdb_4077 | 32098170 | COD1 | improve the binding predictions of the A. thaliana E+ PPR proteins | not found | not found | Arabidopsis thaliana (L.) Heynh. | >30% | Mitochondrion | not found |
| PCdb_4078 | 32098170 | AHG11 | improve the binding predictions of the A. thaliana E+ PPR proteins | not found | not found | Arabidopsis thaliana (L.) Heynh. | >30% | Mitochondrion | not found |
| PCdb_4079 | 31996373 | PPR65 | moss (Physcomitrella patens) PPR proteins containing DYW-deaminase domains | not found | not found | Physcomitrella patens (Hedw.) Bruch & Schimp. | not found | Mitochondrion | not found |
| PCdb_4080 | 31598687 | DEK40 | required for mitochondrial function and kernel development in maize | not found | not found | Zea mays L. | not found | Mitochondrion | not found |
| PCdb_4081 | 31374076 | EMP21 | encodes a novel PPR-DYW protein | not found | not found | Zea mays L. | not found | Mitochondrion | not found |
| PCdb_4082 | 30168136 | EMP18 | Functions in Mitochondrial Atp6 and Cox2 Transcript Editing | not found | not found | Zea mays L. | not found | Mitochondrion | not found |
| PCdb_4083 | 30019754 | PPS1 | encodes a DYW motif-containing pentatricopeptide repeat protein required for five consecutive RNA-editing sites of nad3 in mitochondria | not found | not found | Oryza sativa L. | not found | Mitochondrion | not found |
| PCdb_4084 | 29216369 | MEF31 | The Pentatricopeptide Repeat Protein | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | Mitochondrion | not found |
| PCdb_4085 | 29035004 | MEF8 | affects editing at over 60 Arabidopsis mitochondrial C targets of RNA editing | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | Mitochondrion | not found |
| PCdb_4086 | 28549172 | ORRM5 | an RNA recognition motif-containing protein | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | Mitochondrion | not found |
| PCdb_4087 | 27942959 | SLO4 | affects the splicing of nad2 intron 1 | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | Mitochondrion | not found |
| PCdb_4088 | 27543091 | CWM2 | pentatricopeptide repeat (PPR)-like proteins | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | Mitochondrion | not found |
| PCdb_4089 | 27149614 | PPME | Arabidopsis mitochondrial P-type pentatricopeptide repeat protein-modulating editing protein | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | Mitochondrion | not found |
| PCdb_4090 | 26470017 | MEF35 | The DYW Subgroup PPR Protein | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | Mitochondrion | not found |
| PCdb_4091 | 26048647 | MEF13 | as being required for editing at eight sites in Arabidopsis thaliana | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | Mitochondrion | not found |
| PCdb_4092 | 25800738 | ORRM3 | plant mitochondrial editing factor | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | Mitochondrion | not found |
| PCdb_4093 | 25800738 | ORRM2 | plant mitochondrial editing factor | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | Mitochondrion | not found |
| PCdb_4094 | 25708384 | MEF11 | the PPR Protein | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | Mitochondrion | not found |
| PCdb_4095 | 25301889 | COD1 | the CYTOCHROME C OXIDASE DEFICIENT1 (COD1) gene, which encodes a mitochondria-localized PentatricoPeptide Repeat protein | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | Mitochondrion | not found |
| PCdb_4096 | 25173472 | MEF26 | The pentatricopeptide repeat protein | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | Mitochondrion | not found |
| PCdb_4097 | 24058147 | PpPPR_98 | involved in RNA editing for five editing sites of the moss mitochondrial transcripts | not found | not found | Physcomitrella patens (Hedw.) Bruch & Schimp. | not found | Mitochondrion | not found |
| PCdb_4098 | 24058147 | PpPPR_65 | involved in RNA editing for five editing sites of the moss mitochondrial transcripts | not found | not found | Physcomitrella patens (Hedw.) Bruch & Schimp. | not found | Mitochondrion | not found |
| PCdb_4099 | 23845994 | MEF12 | The longest mitochondrial RNA editing PPR protein | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | Mitochondrion | not found |
| PCdb_4100 | 23807026 | REME2 | a PPR-DYW protein required for editing of specific C targets in Arabidopsis mitochondria | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | Mitochondrion | not found |
| PCdb_4101 | 23762347 | MEF32 | mitochondrial editing factor 32 | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | Mitochondrion | not found |
| PCdb_4102 | 23762347 | MEF11 | the E-class PPR proteins | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | Mitochondrion | not found |
| PCdb_4103 | 23288601 | MEF10 | is required for RNA editing at nad2-842 in mitochondria of Arabidopsis thaliana and interacts with MORF8 | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | Mitochondrion | not found |
| PCdb_4104 | 22977245 | MEF8S | the related PPR proteins mitochondrial editing factor | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | Mitochondrion | not found |
| PCdb_4105 | 22977245 | MEF8 | the related PPR proteins mitochondrial editing factor | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | Mitochondrion | not found |
| PCdb_4106 | 22902704 | SLO2 | Loss-of-function mutation in SLO2 results in plant growth retardation, and delayed development, and leads to the dysfunction of mitochondrial complex I, III and IV | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | Mitochondrion | not found |
| PCdb_4107 | 22747551 | MPR25 | encodes a pentatricopeptide repeat protein | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | Mitochondrion | not found |
| PCdb_4108 | 22540321 | SLO2 | a mitochondrial tetratricopep repeat protein | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | Mitochondrion | not found |
| PCdb_4109 | 22319053 | PPR2263 | a DYW-Subgroup Pentatricopeptide Repeat Protein | not found | not found | Zea mays L. | not found | Mitochondrion | not found |
| PCdb_4110 | 22258224 | MEF7 | DYW-class PPR protein | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | Mitochondrion | not found |
| PCdb_4111 | 22248025 | SLG1 | affects mitochondrial RNA editing, plant development, and responses to abiotic stresses | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | Mitochondrion | not found |
| PCdb_4112 | 22186180 | MEF3 | E-class PPR protein | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | Mitochondrion | not found |
| PCdb_4113 | 21504904 | OTP87 | Pentatricopeptide Repeat Protein OTP87 | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | Mitochondrion | not found |
| PCdb_4114 | 21466601 | PpPPR_78 | involved in RNA editing for five editing sites of the moss mitochondrial transcripts | not found | not found | Physcomitrella patens (Hedw.) Bruch & Schimp. | not found | Mitochondrion | not found |
| PCdb_4115 | 21466601 | PpPPR_78 | involved in RNA editing for five editing sites of the moss mitochondrial transcripts | not found | not found | Physcomitrella patens (Hedw.) Bruch & Schimp. | not found | Mitochondrion | not found |
| PCdb_4116 | 21281638 | MEF14 | DYW-E-PPR protein MEF14 | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | Mitochondrion | not found |
| PCdb_4117 | 20974892 | REME1 | a pentatricopeptide repeat-DYW protein controlling the editing of mitochondrial transcripts | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | Mitochondrion | not found |
| PCdb_4118 | 20837503 | PpPPR_91 | involved in RNA editing for five editing sites of the moss mitochondrial transcripts | not found | not found | Physcomitrella patens (Hedw.) Bruch & Schimp. | not found | Mitochondrion | not found |
| PCdb_4119 | 20837503 | PpPPR_77 | involved in RNA editing for five editing sites of the moss mitochondrial transcripts | not found | not found | Physcomitrella patens (Hedw.) Bruch & Schimp. | not found | Mitochondrion | not found |
| PCdb_4120 | 20837503 | PpPPR_56 | involved in RNA editing for five editing sites of the moss mitochondrial transcripts | not found | not found | Physcomitrella patens (Hedw.) Bruch & Schimp. | not found | Mitochondrion | not found |
| PCdb_4121 | 20828567 | MEF1 | is modulated by ecotype-specific differences but requires the DYW domain | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | Mitochondrion | not found |
| PCdb_4122 | 20566637 | MEF22 | involved in RNA editing in plant mitochondria | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | Mitochondrion | not found |
| PCdb_4123 | 20566637 | MEF21 | involved in RNA editing in plant mitochondria | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | Mitochondrion | not found |
| PCdb_4124 | 20566637 | MEF20 | involved in RNA editing in plant mitochondria | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | Mitochondrion | not found |
| PCdb_4125 | 20566637 | MEF19 | involved in RNA editing in plant mitochondria | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | Mitochondrion | not found |
| PCdb_4126 | 20566637 | MEF18 | involved in RNA editing in plant mitochondria | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | Mitochondrion | not found |
| PCdb_4127 | 20497377 | SLO1 | is required for RNA editing at multiple sites with similar upstream sequences | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | Mitochondrion | not found |
| PCdb_4128 | 20436293 | MEF11 | plays regulatory roles in cytosolic and plastidial isoprenoid biosynthesis through RNA editing | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | Mitochondrion | not found |
| PCdb_4129 | 20163555 | PpPPR_71 | involved in RNA editing for five editing sites of the moss mitochondrial transcripts | not found | not found | Physcomitrella patens (Hedw.) Bruch & Schimp. | not found | Mitochondrion | not found |
| PCdb_4130 | 20163555 | PpPPR_71 | involved in RNA editing for five editing sites of the moss mitochondrial transcripts | not found | not found | Physcomitrella patens (Hedw.) Bruch & Schimp. | not found | Mitochondrion | not found |
| PCdb_4131 | 20117193 | PPR596 | PPR protein of the P subfamily in partial RNA editing of an Arabidopsis mitochondrial transcript | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | Mitochondrion | not found |
| PCdb_4132 | 20018598 | MEF9 | an E-Subclass Pentatricopeptide Repeat Protein, Is Required for an RNA Editing Event in the nad7 Transcript in Mitochondria of Arabidopsis | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | Mitochondrion | not found |
| PCdb_4133 | 19919573 | MEF11 | involved in RNA editing at three sites in mitochondria of Arabidopsis thaliana | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | Mitochondrion | not found |
| PCdb_4134 | 19453459 | OGR1 | encodes a pentatricopeptide repeatYW protein and is essential for RNA editing in mitochondria | not found | not found | Oryza sativa L. | not found | Mitochondrion | not found |
| PCdb_4135 | 19252080 | MEF1 | belongs to the DYW subfamily of pentatricopeptide repeat proteins. | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | Mitochondrion | not found |
| PCdb_4136 | 17213228 | LOI1 | a Potential Regulatory Factor of Isoprenoid Biosynthesis in Arabidopsis | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | Mitochondrion | not found |
| PCdb_4137 | 16489123 | RF1A | targeted to mitochondria and can restore male fertility by blocking ORF79 production via endonucleolytic cleavage (RF1A) or degradation (RF1B) of dicistronic B-atp6orf79 mRNA. | not found | not found | Oryza sativa L. | not found | Mitochondrion | not found |
| PCdb_4138 | 32505546 | TSL1 | important for maintaining chloroplast mRNA | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | chloroplast | not found |
| PCdb_4139 | 32505546 | DG1 | confers a high temperature sensitivity and impaired chloroplast development at an elevated ambient temperature | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | chloroplast | not found |
| PCdb_4140 | 32297039 | OsSLC1 | Encodes a Pentatricopeptide Repeat Protein Essential for Early Chloroplast Development and Seedling Survival | not found | not found | Oryza sativa L. | not found | chloroplast | not found |
| PCdb_4141 | 32121603 | OZ1 | controls the editing of 14 cytidine targets in Arabidopsis chloroplasts, contains two RanBP2-type zinc finger (Znf) domains. | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | chloroplast | not found |
| PCdb_4142 | 29140512 | WTG1 | have a function in chloroplast development and plastid gene expression by screening Arabidopsis leaf coloration mutants. | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | chloroplast | not found |
| PCdb_4143 | 28856519 | OsPPR6 | a pentatricopeptide repeat protein | not found | not found | Oryza sativa L. | not found | chloroplast | not found |
| PCdb_4144 | 28346704 | ISE2 | The chloroplast RNA helicase | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | chloroplast | not found |
| PCdb_4145 | 28158776 | PDM2 | PDM2 encodes a pentatricopeptide repeat protein that belongs to the P subgroup | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | chloroplast | not found |
| PCdb_4146 | 27622591 | WSP1 | Chloroplast Development in Rice | not found | not found | Oryza sativa L. | not found | chloroplast | not found |
| PCdb_4147 | 25768119 | OZ1 | Organelle Zinc finger 1 | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | chloroplast | not found |
| PCdb_4148 | 25277299 | PpPPR_45 | involved in RNA editing for five editing sites of the moss mitochondrial transcripts | not found | not found | Physcomitrella patens (Hedw.) Bruch & Schimp. | not found | chloroplast | not found |
| PCdb_4149 | 24204264 | OCP3 | the Arabidopsis nuclear-encoded homeodomain-containing protein | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | chloroplast | not found |
| PCdb_4150 | 24144791 | SEL1 | a Pentatricopeptide Repeat Protein | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | chloroplast | not found |
| PCdb_4151 | 21294841 | ECB2 | The ecb2-1 knockout shows an albino phenotype | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | chloroplast | not found |
| PCdb_4152 | 20143129 | ECB2 | The vac1 mutant is allelic to ecb2, which has been shown to be totally impaired in editing of the 794th nucleotide from the AUG of accD mRNA | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | chloroplast | not found |
| PCdb_4153 | 19602623 | TADA | Disruption of TADA has profound effects on chloroplast translation efficiency, leading to reduced yields of chloroplast-encoded proteins and impaired photosynthetic function. | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | chloroplast | not found |
| PCdb_4154 | 19500301 | ECB2 | a pentatricopeptide repeat protein, is required for chloroplast transcript accD RNA editing and early chloroplast biogenesis in Arabidopsis thaliana | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | chloroplast | not found |
| PCdb_4155 | 18032432 | p95 | 95 kDa viral replicase protein (p95, viral replication) | not found | not found | Nicotiana tabacum L. | not found | chloroplast | not found |
| PCdb_4156 | 14694196 | p70 | 70 kDa viral replicase protein (p70, viral replication) | not found | not found | Nicotiana tabacum L. | not found | chloroplast | not found |
| PCdb_4157 | 14694196 | p56 | 56 kDa movement protein (p56, viral cell-to-cell movement) | not found | not found | Nicotiana tabacum L. | not found | chloroplast | not found |
| PCdb_4158 | 32098170 | AEF1 | improve the binding predictions of the A. thaliana E+ PPR proteins | not found | not found | Arabidopsis thaliana (L.) Heynh. | >30% | chloroplast | not found |
| PCdb_4159 | 31797248 | AEF1 | The dual-targeted RNA editing factor | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | chloroplast | not found |
| PCdb_4160 | 25585673 | AEF1 | promotes atpF splicing in Arabidopsis and rice | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | chloroplast | not found |
| PCdb_4161 | 32583432 | OsPPR16 | affects chloroplast development during early leaf development in rice | not found | not found | Oryza sativa L. | not found | chloroplast | not found |
| PCdb_4162 | 32259001 | ORRM6 | nuclear encoded plastid targeted organelle RNA recognition motif (ORRM) proteins | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | chloroplast | not found |
| PCdb_4163 | 32098170 | YS1 | improve the binding predictions of the A. thaliana E+ PPR proteins | not found | not found | Arabidopsis thaliana (L.) Heynh. | >30% | chloroplast | not found |
| PCdb_4164 | 32098170 | RARE1 | improve the binding predictions of the A. thaliana E+ PPR proteins | not found | not found | Arabidopsis thaliana (L.) Heynh. | >30% | chloroplast | not found |
| PCdb_4165 | 32098170 | QED1 | improve the binding predictions of the A. thaliana E+ PPR proteins | not found | not found | Arabidopsis thaliana (L.) Heynh. | >30% | chloroplast | not found |
| PCdb_4166 | 32098170 | OTP86 | improve the binding predictions of the A. thaliana E+ PPR proteins | not found | not found | Arabidopsis thaliana (L.) Heynh. | >30% | chloroplast | not found |
| PCdb_4167 | 32098170 | OTP85 | improve the binding predictions of the A. thaliana E+ PPR proteins | not found | not found | Arabidopsis thaliana (L.) Heynh. | >30% | chloroplast | not found |
| PCdb_4168 | 32098170 | OTP84 | improve the binding predictions of the A. thaliana E+ PPR proteins | not found | not found | Arabidopsis thaliana (L.) Heynh. | >30% | chloroplast | not found |
| PCdb_4169 | 32098170 | OTP81 | improve the binding predictions of the A. thaliana E+ PPR proteins | not found | not found | Arabidopsis thaliana (L.) Heynh. | >30% | chloroplast | not found |
| PCdb_4170 | 32098170 | OTP80 | improve the binding predictions of the A. thaliana E+ PPR proteins | not found | not found | Arabidopsis thaliana (L.) Heynh. | >30% | chloroplast | not found |
| PCdb_4171 | 32098170 | EMB2261 | improve the binding predictions of the A. thaliana E+ PPR proteins | not found | not found | Arabidopsis thaliana (L.) Heynh. | >30% | chloroplast | not found |
| PCdb_4172 | 32098170 | ELI1 | improve the binding predictions of the A. thaliana E+ PPR proteins | not found | not found | Arabidopsis thaliana (L.) Heynh. | >30% | chloroplast | not found |
| PCdb_4173 | 32098170 | DOT4 | improve the binding predictions of the A. thaliana E+ PPR proteins | not found | not found | Arabidopsis thaliana (L.) Heynh. | >30% | chloroplast | not found |
| PCdb_4174 | 32098170 | CRR28 | improve the binding predictions of the A. thaliana E+ PPR proteins | not found | not found | Arabidopsis thaliana (L.) Heynh. | >30% | chloroplast | not found |
| PCdb_4175 | 32098170 | CRR22 | improve the binding predictions of the A. thaliana E+ PPR proteins | not found | not found | Arabidopsis thaliana (L.) Heynh. | >30% | chloroplast | not found |
| PCdb_4176 | 32098170 | CREF7 | improve the binding predictions of the A. thaliana E+ PPR proteins | not found | not found | Arabidopsis thaliana (L.) Heynh. | >30% | chloroplast | not found |
| PCdb_4177 | 32098170 | CREF3 | improve the binding predictions of the A. thaliana E+ PPR proteins | not found | not found | Arabidopsis thaliana (L.) Heynh. | >30% | chloroplast | not found |
| PCdb_4178 | 30988197 | MORF2 | egulate plastid RNA editing during retrograde signaling | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | chloroplast | not found |
| PCdb_4179 | 29973946 | EMB2261 | Essential for Arabidopsis Development | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | chloroplast | not found |
| PCdb_4180 | 29879897 | RARE1 | chloroplast editing factors | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | chloroplast | not found |
| PCdb_4181 | 29879897 | CRR28 | chloroplast editing factors | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | chloroplast | not found |
| PCdb_4182 | 28213559 | ORRM6 | Loss-of-function mutations in ORGANELLE RNA RECOGNITION MOTIF PROTEIN6 (ORRM6) result in the near absence of RNA editing of psbF-C77 and the reduction in accD-C794 | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | chloroplast | not found |
| PCdb_4183 | 25512379 | QED1 | a chloroplast PPR-DYW editing factor, quintuple editing factor 1 (QED1) | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | chloroplast | not found |
| PCdb_4184 | 25041347 | DYW1 | an editing factor required for editing of the ndhD-1 site in Arabidopsis chloroplasts | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | chloroplast | not found |
| PCdb_4185 | 23001034 | DYW1 | an RNA editing factor acting specifically on the plastid ndhD-1 editing site recognized by CRR4 | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | chloroplast | not found |
| PCdb_4186 | 19448041 | LPA66 | required for editing psbF chloroplast transcripts in Arabidopsis | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | chloroplast | not found |
| PCdb_4187 | 19395655 | RARE1 | required for editing of the chloroplast accD transcript | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | chloroplast | not found |
| PCdb_4188 | 19182104 | CRR28 | required for editing of multiple plastid transcripts | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | chloroplast | not found |
| PCdb_4189 | 19182104 | CRR22 | required for editing of multiple plastid transcripts | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | chloroplast | not found |
| PCdb_4190 | 19054358 | YS1 | required for editing of rpoB transcripts and the rapid development of chloroplasts during early growth | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | chloroplast | not found |
| PCdb_4191 | 29562289 | OsPGL1 | The loss of function of OsPGL1 resulted in defects in both chloroplast RNA editing of ndhD-878 and mitochondrial RNA editing of ccmFc-543, both of which could be restored in transgenic complementation lines. | not found | not found | Oryza sativa L. | not found | calli | not found |
| PCdb_4192 | 37819512 | not found | not found | not found | not found | Pimelea aeruginosa F.Muell. | not found | leaf | CRISPRi,CRISPR-Cas9 |
| PCdb_4193 | 30100899 | AT2G03770 | CCAAT-box binding factor (AT2G03770, flowering time regulation) | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPRi |
| PCdb_4194 | 28095853 | not found | not found | not found | not found | Petunia hybrida (Hook.) E. Vilm. | not found | protoplast | CRISPRi |
| PCdb_4195 | 37577569 | not found | not found | not found | not found | Amorphophallus baumannii (N.E.Br.) N.E.Br. | not found | not found | CRISPRi |
| PCdb_4196 | 29885839 | not found | not found | not found | not found | Marchantia polymorpha L. | not found | protoplast | CRISPR-Cas9,ZFN,TALEN |
| PCdb_4197 | 24710347 | LOC102577966 | Hypothetical protein LOC102577966 [Source: NCBI] | not found | not found | Citrus 脳 sinensis (L.) Osbeck | not found | protoplast | CRISPR-Cas9,ZFN,TALEN |
| PCdb_4198 | 30787936 | not found | not found | not found | not found | Malus x domestica Bork. | not found | protoplast | CRISPR-Cas9,ZFN |
| PCdb_4199 | 30787936 | not found | not found | not found | not found | Pyrus communis聽L. | not found | protoplast | CRISPR-Cas9,ZFN |
| PCdb_4200 | 30220095 | FAD2-1B | Improved soybean oil quality by targeted mutagenesis of the fatty acid desaturase 2 gene family. | not found | not found | Glycine max (L.) Merr. | not found | protoplast | CRISPR-Cas9,ZFN |
| PCdb_4201 | 37545762 | not found | not found | not found | not found | Populus sp. | not found | finger,plant | CRISPR-Cas9,ZFN |
| PCdb_4202 | 34728724 | LIN7 | LIN-7 homolog (scaffold protein involved in cell polarity) [Source: UniProt] | not found | not found | Solanum lycopersicum L. | not found | Cell Wall | CRISPR-Cas9,Target-AID |
| PCdb_4203 | 25403732 | Tfs-qqr-t | Transcription factor (QQR-type, stress response) | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9,TALEN,ZFN |
| PCdb_4204 | 25403732 | Tfs-qqr-t | Transcription factor (QQR-type, stress response) | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9,TALEN,ZFN |
| PCdb_4205 | 25403732 | Tfs-852-t | Transcription factor (852-type, developmental regulation) | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9,TALEN,ZFN |
| PCdb_4206 | 25403732 | Tfs-494 | Transcription factor (494-type, unknown function) | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9,TALEN,ZFN |
| PCdb_4207 | 25403732 | Tfs-494 | Transcription factor (494-type, unknown function) | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9,TALEN,ZFN |
| PCdb_4208 | 34667393 | not found | not found | not found | not found | Saccharum officinarum L. | not found | protoplast | CRISPR-Cas9,TALEN |
| PCdb_4209 | 31275001 | not found | not found | not found | not found | Malus prunifolia (Wild.) Borkh.264 鈥楽eishi鈥櫭桵. pumila Mill. var. paradisiaca Schneid. 鈥楳.9鈥?,not found" | protoplast | CRISPR-Cas9,TALEN | not found |
| PCdb_4210 | 31275001 | not found | not found | not found | not found | Malus x domestica Bork. | not found | protoplast | CRISPR-Cas9,TALEN |
| PCdb_4211 | 29356153 | WUS | WUSCHEL homeobox transcription factor (WUS, shoot meristem maintenance) | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9,TALEN |
| PCdb_4212 | 29356153 | HTR12 | Histone H3 variant (centromere-specific histone) [Source: UniProt] | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9,TALEN |
| PCdb_4213 | 28755320 | not found | not found | not found | not found | Hordeum vulgare L. | not found | protoplast | CRISPR-Cas9,TALEN |
| PCdb_4214 | 29656128 | not found | not found | not found | not found | Silene latifolia聽Poir. | not found | chloroplast | CRISPR-Cas9,TALEN |
| PCdb_4215 | 29312390 | not found | not found | not found | not found | Citrus 脳 insitorum 'Carrizo' | not found | protoplast | CRISPR-Cas9,SaCas9 |
| PCdb_4216 | 34878784 | not found | not found | not found | not found | Nicotiana tabacum L. | not found | protoplast | CRISPR-Cas9,Prime editor,CRISPRa,Base editor |
| PCdb_4217 | 34713238 | not found | not found | not found | not found | Hordeum vulgare L. | not found | protoplast | CRISPR-Cas9,Prime editor,Base editor |
| PCdb_4218 | 37243510 | not found | not found | not found | not found | Physcomitrella patens (Hedw.) Bruch & Schimp. | not found | protoplast | CRISPR-Cas9,Prime editor |
| PCdb_4219 | 34713247 | not found | not found | not found | not found | Nicotiana benthamiana Domin | not found | protoplast | CRISPR-Cas9,Prime editor |
| PCdb_4220 | 37460713 | not found | not found | not found | not found | Nicotiana tabacum L. | not found | not found | CRISPR-Cas9,Prime editor |
| PCdb_4221 | 36261092 | not found | not found | not found | not found | Nicotiana attenuata Torr. ex S.Watson | not found | protoplast | CRISPR-Cas9,CRISPRi |
| PCdb_4222 | 26357840 | not found | not found | not found | not found | Populus sp. | not found | protoplast | CRISPR-Cas9,CRISPRi |
| PCdb_4223 | 32289196 | not found | not found | not found | not found | Nicotiana attenuata Torr. ex S.Watson | not found | protoplast | CRISPR-Cas9,CRISPR-Cas13,CRISPR-Cas12 |
| PCdb_4224 | 33511745 | LOC107799742 | Hypothetical protein LOC107799742 [Source: NCBI] | not found | not found | Nicotiana tabacum L. | not found | protoplast | CRISPR-Cas9,CRISPR-Cas12,SaCas9 |
| PCdb_4225 | 35159125 | not found | not found | not found | not found | Citrus 脳 sinensis (L.) Osbeck | not found | protoplast | CRISPR-Cas9,CRISPR-Cas12 |
| PCdb_4226 | 35098208 | not found | not found | not found | not found | Thlaspi arvense L. | not found | protoplast | CRISPR-Cas9,CRISPR-Cas12 |
| PCdb_4227 | 34830492 | not found | not found | not found | not found | Malus x domestica Bork. | not found | protoplast | CRISPR-Cas9,CRISPR-Cas12 |
| PCdb_4228 | 34632687 | not found | not found | not found | not found | Nicotiana attenuata Torr. ex S.Watson | not found | protoplast | CRISPR-Cas9,CRISPR-Cas12 |
| PCdb_4229 | 34276739 | not found | not found | not found | not found | Nicotiana tabacum L. | not found | protoplast | CRISPR-Cas9,CRISPR-Cas12 |
| PCdb_4230 | 33913600 | not found | not found | not found | not found | Dendrocalamus latiflorus Munro | not found | protoplast | CRISPR-Cas9,CRISPR-Cas12 |
| PCdb_4231 | 36995625 | not found | not found | not found | not found | Citrus 脳 sinensis (L.) Osbeck | not found | plantCell Line | CRISPR-Cas9,CRISPR-Cas12 |
| PCdb_4232 | 36072833 | not found | not found | not found | not found | Pyrus communis聽L. | not found | protoplast | CRISPR-Cas9,CRISPRa,CRISPR-Cas12 |
| PCdb_4233 | 34168320 | ACT3 | Actin 3 (cytoskeletal structural protein) | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9,CRISPRa,CRISPR-Cas12 |
| PCdb_4234 | 33441979 | not found | not found | not found | not found | Picea rubens Sarg. | not found | protoplast | CRISPR-Cas9,CRISPRa |
| PCdb_4235 | 36993440 | not found | not found | not found | not found | Allium cepa L. | not found | protoplast | CRISPR-Cas9,CRISPR screen |
| PCdb_4236 | 37750448 | not found | not found | not found | not found | Allium cepa L. | not found | not found | CRISPR-Cas9,CRISPR screen |
| PCdb_4237 | 35647579 | not found | not found | not found | not found | Arachis hypogaea L. | not found | protoplast | CRISPR-Cas9,Base editor |
| PCdb_4238 | 35296063 | not found | not found | not found | not found | Citrus 脳 sinensis (L.) Osbeck | not found | protoplast | CRISPR-Cas9,Base editor |
| PCdb_4239 | 35095986 | not found | not found | not found | not found | Setaria italica (L.) P.Beauv. | not found | protoplast | CRISPR-Cas9,Base editor |
| PCdb_4240 | 34994854 | not found | not found | not found | not found | Medicago sativa L. | not found | protoplast | CRISPR-Cas9,Base editor |
| PCdb_4241 | 34713268 | not found | not found | not found | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9,Base editor |
| PCdb_4242 | 33850267 | RPS5A | Ribosomal protein S5A | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9,Base editor |
| PCdb_4243 | 33850267 | LFY | LEAFY transcription factor | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9,Base editor |
| PCdb_4244 | 32991731 | not found | not found | not found | not found | Nicotiana attenuata Torr. ex S.Watson | not found | protoplast | CRISPR-Cas9,Base editor |
| PCdb_4245 | 32033083 | not found | not found | not found | not found | Physcomitrella patens (Hedw.) Bruch & Schimp. | not found | protoplast | CRISPR-Cas9,Base editor |
| PCdb_4246 | 32033083 | not found | not found | not found | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9,Base editor |
| PCdb_4247 | 29797048 | not found | not found | not found | not found | Citrullus lanatus (Thunb.) Matsum. & Nakai | not found | protoplast | CRISPR-Cas9,Base editor |
| PCdb_4248 | 37222701 | not found | not found | not found | not found | Cypella mexicana C.V.Morton & R.C.Foster | not found | kinetoplastids | CRISPR-Cas9,Base editor |
| PCdb_4249 | 37222701 | not found | not found | not found | not found | Cyperus lipomexicanus T.Koyama | not found | kinetoplastids | CRISPR-Cas9,Base editor |
| PCdb_4250 | 37222701 | not found | not found | not found | not found | Juanulloa aurantiaca Otto & A.Dietr. | not found | kinetoplastids | CRISPR-Cas9,Base editor |
| PCdb_4251 | 37222701 | not found | not found | not found | not found | Lagarosiphon major (Ridl.) Moss | not found | kinetoplastids | CRISPR-Cas9,Base editor |
| PCdb_4252 | 37222701 | not found | not found | not found | not found | Leandra mexicana (Naudin) Cogn. | not found | kinetoplastids | CRISPR-Cas9,Base editor |
| PCdb_4253 | 37222701 | not found | not found | not found | not found | Lellingeria major (Copel.) A.R.Sm. & R.C.Moran | not found | kinetoplastids | CRISPR-Cas9,Base editor |
| PCdb_4254 | 37222701 | not found | not found | not found | not found | Lepechinia mexicana (S.Schauer) Epling | not found | kinetoplastids | CRISPR-Cas9,Base editor |
| PCdb_4255 | 37283391 | not found | not found | not found | not found | Cymbidium sinense (Andrews) Willd. | not found | vegetative,flower | CRISPR-Cas9 |
| PCdb_4256 | 37283391 | not found | not found | not found | not found | Phalaenopsis amabilis (L.) Blume | not found | vegetative,flower | CRISPR-Cas9 |
| PCdb_4257 | 37283391 | not found | not found | not found | not found | Phalaenopsis amabilis (L.) Blume | not found | vegetative,flower | CRISPR-Cas9 |
| PCdb_4258 | 37283391 | not found | not found | not found | not found | Phalaenopsis amabilis (L.) Blume | not found | vegetative,flower | CRISPR-Cas9 |
| PCdb_4259 | 37283391 | not found | not found | not found | not found | Prestonia amabilis J.F.Morales | not found | vegetative,flower | CRISPR-Cas9 |
| PCdb_4260 | 37283391 | not found | not found | not found | not found | Pseudolarix amabilis (J.Nelson) Rehder | not found | vegetative,flower | CRISPR-Cas9 |
| PCdb_4261 | 37283391 | not found | not found | not found | not found | Pseudosasa amabilis (McClure) Keng f. ex S.L.Chen et al. | not found | vegetative,flower | CRISPR-Cas9 |
| PCdb_4262 | 34576199 | TTG1 | Transparent testa glabra1 WD40 repeat protein | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | Trichomes | CRISPR-Cas9 |
| PCdb_4263 | 34576199 | GL3 | GLABRA3 bHLH transcription factor | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | Trichomes | CRISPR-Cas9 |
| PCdb_4264 | 34576199 | GL2 | GLABRA2 transcription factor | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | Trichomes | CRISPR-Cas9 |
| PCdb_4265 | 34576199 | CPC | CAPRICE Myb transcription factor | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | Trichomes | CRISPR-Cas9 |
| PCdb_4266 | 34202673 | SVB | Shavenbaby transcription factor (epidermal cell fate) | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | Trichomes | CRISPR-Cas9 |
| PCdb_4267 | 34202673 | EGL3 | Enhancer of glabra 3 (trichome development) | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | Trichomes | CRISPR-Cas9 |
| PCdb_4268 | 33962307 | LOC107832318 | Hypothetical protein LOC107832318 [Source: NCBI] | not found | not found | Nicotiana tabacum L. | not found | Trichomes | CRISPR-Cas9 |
| PCdb_4269 | 33155154 | GmNAC06 | enhances salt stress tolerance in soybean | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | Subcellular Fractions | CRISPR-Cas9 |
| PCdb_4270 | 32017998 | GmPRR3b | Regulates the Circadian Clock and Flowering Time in Soybean | not found | not found | Glycine max (L.) Merr. | not found | Subcellular Fractions | CRISPR-Cas9 |
| PCdb_4271 | 32179669 | wus | WUSCHEL homeobox transcription factor (wus, shoot meristem maintenance) | not found | not found | Solanum lycopersicum L. | not found | Stem Cells | CRISPR-Cas9 |
| PCdb_4272 | 35037245 | not found | not found | not found | not found | Physcomitrella patens (Hedw.) Bruch & Schimp. | not found | Spores, Fungal | CRISPR-Cas9 |
| PCdb_4273 | 35037245 | not found | not found | not found | not found | Physcomitrium patens | not found | Spores, Fungal | CRISPR-Cas9 |
| PCdb_4274 | 32220377 | not found | not found | not found | not found | Capsicum annuum L. | not found | Spores, Fungal | CRISPR-Cas9 |
| PCdb_4275 | 37503841 | not found | not found | not found | not found | Pimelea aeruginosa F.Muell. | not found | spike | CRISPR-Cas9 |
| PCdb_4276 | 37514268 | RGL3 | RGA-LIKE 3 (RGL3, gibberellin signaling) | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | Sperm,sperm,heart,pollen,plants,Germ Cell | CRISPR-Cas9 |
| PCdb_4277 | 37514268 | MBD3 | Methyl-CpG binding domain protein 3 (epigenetic regulation) [Source: NCBI] | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | Sperm,sperm,heart,pollen,plants,Germ Cell | CRISPR-Cas9 |
| PCdb_4278 | 37514268 | CUC1 | NAC-domain transcription factor controlling shoot meristem and organ boundary formation. | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | Sperm,sperm,heart,pollen,plants,Germ Cell | CRISPR-Cas9 |
| PCdb_4279 | 35185961 | not found | not found | not found | not found | Populus 脳 canescens 'INRA 717-1B5' | not found | shoot | CRISPR-Cas9 |
| PCdb_4280 | 37522631 | not found | not found | not found | not found | Populus 脳 canescens 'INRA 717-1B4' | not found | shoot | CRISPR-Cas9 |
| PCdb_4281 | 37522631 | not found | not found | not found | not found | Populus 脳 wettsteinii 'INRA 353-38' | not found | shoot | CRISPR-Cas9 |
| PCdb_4282 | 37446956 | not found | not found | not found | not found | Ocimum basilicum L. | not found | shoot | CRISPR-Cas9 |
| PCdb_4283 | 37111880 | not found | not found | not found | not found | Populus 脳 generosa | not found | shoot | CRISPR-Cas9 |
| PCdb_4284 | 37111880 | not found | not found | not found | not found | Populus 脳 generosa | not found | shoot | CRISPR-Cas9 |
| PCdb_4285 | 36836880 | RBOHF | Respiratory burst oxidase homolog F (RBOHF, ROS production) | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | seed | CRISPR-Cas9 |
| PCdb_4286 | 36836880 | RBOHD | Respiratory burst oxidase homolog D (RBOHD, ROS production) | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | seed | CRISPR-Cas9 |
| PCdb_4287 | 36836880 | HOS1 | HIGH EXPRESSION OF OSMOTICALLY RESPONSIVE GENES 1 (cold signaling) [Source: TAIR] | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | seed | CRISPR-Cas9 |
| PCdb_4288 | 36836880 | APX2 | Ascorbate peroxidase 2, scavenges hydrogen peroxide in chloroplasts under oxidative stress | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | seed | CRISPR-Cas9 |
| PCdb_4289 | 36836880 | APX1 | Ascorbate peroxidase 1, primary antioxidant enzyme converting H?O? to water | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | seed | CRISPR-Cas9 |
| PCdb_4290 | 35905898 | not found | not found | not found | not found | Citrus 脳 sinensis (L.) Osbeck | not found | seed | CRISPR-Cas9 |
| PCdb_4291 | 35905898 | not found | not found | not found | not found | Citrus 脳 sinensis (L.) Osbeck | not found | seed | CRISPR-Cas9 |
| PCdb_4292 | 32191315 | rbcS | Alters Nicotine Biosynthesis | not found | not found | Nicotiana tabacum L. | not found | root | CRISPR-Cas9 |
| PCdb_4293 | 37426959 | not found | not found | not found | not found | Cichorium intybus L. | not found | root | CRISPR-Cas9 |
| PCdb_4294 | 37426959 | not found | not found | not found | not found | Nicotiana attenuata Torr. ex S.Watson | not found | root | CRISPR-Cas9 |
| PCdb_4295 | 37429890 | not found | not found | not found | not found | Geranium lucidum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4296 | 37392322 | not found | not found | not found | not found | Catharanthus roseus (L.) G.Don | not found | protoplast | CRISPR-Cas9 |
| PCdb_4297 | 37336378 | not found | not found | not found | not found | Crinum graminicola I.Verd. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4298 | 37336378 | not found | not found | not found | not found | Crotalaria graminicola Taub. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4299 | 37323233 | not found | not found | not found | not found | Brassica napus L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4300 | 37323233 | not found | not found | not found | not found | Brassica rapa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4301 | 37323233 | not found | not found | not found | not found | Brassica rapa subsp. chinensis (L.) Makino | not found | protoplast | CRISPR-Cas9 |
| PCdb_4302 | 37309461 | not found | not found | not found | not found | Nicotiana tabacum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4303 | 37307061 | not found | not found | not found | not found | Populus sp. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4304 | 37283617 | not found | not found | not found | not found | Macrozamia polymorpha D.L.Jones | not found | protoplast | CRISPR-Cas9 |
| PCdb_4305 | 37283617 | not found | not found | not found | not found | Marchantia polymorpha L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4306 | 37283617 | not found | not found | not found | not found | Marchantia polymorpha L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4307 | 37283617 | not found | not found | not found | not found | Medicago polymorpha L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4308 | 37283617 | not found | not found | not found | not found | Mesoptychia polymorpha (R.M.Schust.) L.S枚derstr. & V谩艌a | not found | protoplast | CRISPR-Cas9 |
| PCdb_4309 | 37283617 | not found | not found | not found | not found | Metrosideros polymorpha Gaudich. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4310 | 37283617 | not found | not found | not found | not found | Mitrasacme polymorpha R.Br. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4311 | 37269452 | not found | not found | not found | not found | Erythranthe purpurea (A.L.Grant) N.S.Fraga | not found | protoplast | CRISPR-Cas9 |
| PCdb_4312 | 37249896 | not found | not found | not found | not found | Medicago sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4313 | 37226185 | not found | not found | not found | not found | Hordeum vulgare L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4314 | 37213679 | CsBPC 2 | BASIC PENTACYSTEINE protein; binds GAGA motifs, involved in seed development and transcriptional regulation. | not found | not found | Cucumis sativus L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4315 | 37191128 | not found | not found | not found | not found | Alopecurus pratensis L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4316 | 37191128 | not found | not found | not found | not found | Setaria viridis (L.) P. Beauv. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4317 | 37173533 | not found | not found | not found | not found | Adelia cinerea M眉ll.Arg. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4318 | 37173533 | not found | not found | not found | not found | Baccharis cinerea DC. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4319 | 37173533 | not found | not found | not found | not found | Baptisia cinerea (Raf.) Fernald & B.G.Schub. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4320 | 37173533 | not found | not found | not found | not found | Bossiaea cinerea R.Br. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4321 | 37173533 | not found | not found | not found | not found | Brocchia cinerea (Delile) Vis. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4322 | 37173533 | not found | not found | not found | not found | Bursera cinerea Engl. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4323 | 37173533 | not found | not found | not found | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4324 | 37139106 | not found | not found | not found | not found | Populus sp. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4325 | 37131068 | not found | not found | not found | not found | Cicer arietinum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4326 | 37131068 | not found | not found | not found | not found | Cicer arietinum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4327 | 37128708 | not found | not found | not found | not found | Chrysanthemum indicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4328 | 37127332 | not found | not found | not found | not found | Lens culinaris Medik. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4329 | 37047489 | not found | not found | not found | not found | Beta vulgaris L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4330 | 37036799 | not found | not found | not found | not found | Cichorium intybus L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4331 | 37035856 | SGR1 | STAY-GREEN 1 (SGR1, chlorophyll degradation) | not found | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4332 | 37035856 | Psy1 | Phytoene synthase 1 (Psy1, carotenoid biosynthesis) | not found | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4333 | 37035856 | pds | Phytoene desaturase (PDS, carotenoid biosynthesis) | not found | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4334 | 37035856 | dxs2 | 1-deoxy-D-xylulose-5-phosphate synthase 2, rate-limiting enzyme in plastidial isoprenoid pathway | not found | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4335 | 37035856 | CrtR-b2 | carotene hydroxylase, converts carotene to zeaxanthin in carotenoid biosynthesis | not found | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4336 | 37035856 | CrtL-e-1 | Lycopene cyclase, catalyzes formation of carotene from lycopene | not found | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4337 | 37035856 | CRTISO | Carotenoid isomerase, converts cis-carotenoids to all-trans forms (e.g., lycopene) | not found | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4338 | 37021953 | not found | not found | not found | not found | Physcomitrella patens (Hedw.) Bruch & Schimp. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4339 | 37009643 | not found | not found | not found | not found | Dendrocalamus latiflorus Munro | not found | protoplast | CRISPR-Cas9 |
| PCdb_4340 | 37008503 | not found | not found | not found | not found | Cucumis sativus L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4341 | 37007603 | not found | not found | not found | not found | Manihot esculenta Crantz | not found | protoplast | CRISPR-Cas9 |
| PCdb_4342 | 36998682 | LOC110435321 | Hypothetical protein LOC110435321 [Source: NCBI] | not found | not found | Sorghum bicolor (L.) Moench | not found | protoplast | CRISPR-Cas9 |
| PCdb_4343 | 36995630 | not found | not found | not found | not found | Medicago truncatula Gaertn. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4344 | 36995628 | not found | not found | not found | not found | Hordeum vulgare L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4345 | 36995626 | not found | not found | not found | not found | Nicotiana attenuata Torr. ex S.Watson | not found | protoplast | CRISPR-Cas9 |
| PCdb_4346 | 36994774 | not found | not found | not found | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4347 | 36991448 | not found | not found | not found | not found | Brachypodium distachyon (L.) P.Beauv. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4348 | 36982841 | not found | not found | not found | not found | Populus sp. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4349 | 36978193 | WRKY30 | WRKY transcription factor 30 (WRKY30, stress signaling) | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4350 | 36964962 | not found | not found | not found | not found | Medicago sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4351 | 36951091 | not found | not found | not found | not found | Citrullus lanatus (Thunb.) Matsum. & Nakai | not found | protoplast | CRISPR-Cas9 |
| PCdb_4352 | 36937998 | FMOGS-OX5 | improve the efficiency of the broccoli genetic transformation system | not found | not found | Brassica oleracea L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4353 | 36896653 | ZmKSL4 | Kaurene Synthase-Like 4 | not found | not found | Zea mays L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4354 | 36891812 | EIL2 | EIN3?LIKE 2 (EIL2): transcription factor in ethylene signaling pathway | not found | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4355 | 36890894 | not found | not found | not found | not found | Nicotiana attenuata Torr. ex S.Watson | not found | protoplast | CRISPR-Cas9 |
| PCdb_4356 | 36867321 | OsLOX10 | affects seed longevity and resistance to saline-alkaline stress | not found | not found | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4357 | 36866711 | TRM-OFP | module bilaterally fine-tunes tomato fruit shape | not found | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4358 | 36866373 | BnaSTM | leads to abnormal shoot apex development and cotyledon petiole fusion at the seedling stage | not found | not found | Brassica napus L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4359 | 36858204 | not found | not found | not found | not found | Vitis vinifera L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4360 | 36840757 | not found | not found | not found | not found | Medicago sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4361 | 36823691 | not found | not found | not found | not found | Actinidia eriantha Benth. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4362 | 36815241 | not found | not found | not found | not found | Malus x domestica Bork. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4363 | 36808553 | not found | not found | not found | not found | Lotus japonicus (Regel) K.Larsen | not found | protoplast | CRISPR-Cas9 |
| PCdb_4364 | 36796171 | not found | not found | not found | not found | Armoracia rusticana P.Gaertn., B.Mey. & Scherb. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4365 | 36795295 | not found | not found | not found | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4366 | 36768765 | DSS1(V) | Dwarf and sterility syndrome protein variant (viral interaction) | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4367 | 36768765 | DSS1(I) | Dwarf and sterility syndrome protein isoform (intracellular function) | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4368 | 36759580 | not found | not found | not found | not found | Hemisorghum C.E.Hubb. ex Bor | not found | protoplast | CRISPR-Cas9 |
| PCdb_4369 | 36755695 | not found | not found | not found | not found | Lepidium campestre (L.) R. Br | not found | protoplast | CRISPR-Cas9 |
| PCdb_4370 | 36736009 | not found | not found | not found | not found | Fragaria vesca L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4371 | 36732423 | not found | not found | not found | not found | Solanum tuberosum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4372 | 36721198 | not found | not found | not found | not found | Bazzania subtilis (Sande Lac.) Trevis. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4373 | 36721198 | not found | not found | not found | not found | Bulbostylis subtilis M.G.L贸pez | not found | protoplast | CRISPR-Cas9 |
| PCdb_4374 | 36714709 | not found | not found | not found | not found | Brassica rapa subsp. chinensis (L.) Makino | not found | protoplast | CRISPR-Cas9 |
| PCdb_4375 | 36674592 | not found | not found | not found | not found | Phaseolus vulgaris L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4376 | 36674507 | LOC107774226 | Hypothetical protein LOC107774226 [Source: NCBI] | not found | not found | Nicotiana tabacum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4377 | 36661038 | not found | not found | not found | not found | Nicotiana attenuata Torr. ex S.Watson | not found | protoplast | CRISPR-Cas9 |
| PCdb_4378 | 36645501 | DDB1 | DNA damage-binding protein; adapts CRL4 E3 ubiquitin ligase for DNA repair and light-signaling pathways. | not found | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4379 | 36643741 | SGR1 | STAY-GREEN 1 (SGR1, chlorophyll degradation) | not found | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4380 | 36643741 | Psy1 | Phytoene synthase 1 (Psy1, carotenoid biosynthesis) | not found | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4381 | 36643741 | MYB12 | MYB transcription factor 12 (phenylpropanoid pathway) [Source: TAIR] | not found | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4382 | 36636802 | HSP101 | Heat shock protein 101 (chaperone) | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4383 | 36636802 | HSFA2 | Heat shock transcription factor A2 | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4384 | 36632734 | not found | not found | not found | not found | Populus sp. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4385 | 36628476 | CLV3 | functions in the modulation of lateral root formation | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4386 | 36628476 | CLV1 | functions in the modulation of lateral root formation | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4387 | 36628476 | CLE3 | functions in the modulation of lateral root formation | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4388 | 36628476 | CLE2 | functions in the modulation of lateral root formation | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4389 | 36628476 | CLE17 | functions in the modulation of lateral root formation | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4390 | 36628476 | CLE1 | functions in the modulation of lateral root formation | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4391 | 36628476 | BAM1 | functions in the modulation of lateral root formation | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4392 | 36613993 | not found | not found | not found | not found | Brassica napus L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4393 | 36613993 | not found | not found | not found | not found | Brassica rapa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4394 | 36613549 | SGR1 | STAY-GREEN 1 (SGR1, chlorophyll degradation) | not found | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4395 | 36600929 | not found | not found | not found | not found | Cucumis sativus L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4396 | 36600915 | NtCXE22 | regulates axillary bud growth through strigolactone metabolism in tobacco | not found | not found | Nicotiana tabacum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4397 | 36596804 | MSH2 | MutS homolog 2 (DNA mismatch repair) | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4398 | 36593415 | not found | not found | not found | not found | Brassica napus L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4399 | 36559603 | not found | not found | not found | not found | Nicotiana tabacum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4400 | 36559601 | not found | not found | not found | not found | Salix purpurea L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4401 | 36553483 | not found | not found | not found | not found | Cucumis sativus L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4402 | 36531381 | not found | not found | not found | not found | Vitis vinifera L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4403 | 36531367 | RD21A | Papain-like cysteine protease RD21A | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4404 | 36501340 | ACA4 | Autoinhibited Ca??-ATPase 4 | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4405 | 36499334 | not found | not found | not found | not found | Brassica napus L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4406 | 36499334 | not found | not found | not found | not found | Brassica rapa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4407 | 36499273 | not found | not found | not found | not found | Brassica napus L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4408 | 36494098 | CIPK9 | CBL-interacting protein kinase 9 | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4409 | 36481955 | not found | not found | not found | not found | Hemisorghum C.E.Hubb. ex Bor | not found | protoplast | CRISPR-Cas9 |
| PCdb_4410 | 36479584 | not found | not found | not found | not found | Cucumis sativus L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4411 | 36467274 | not found | not found | not found | not found | Prunus persica (L.) Batsch | not found | protoplast | CRISPR-Cas9 |
| PCdb_4412 | 36467274 | not found | not found | not found | not found | Prunus salicina Lindl. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4413 | 36452068 | not found | not found | not found | not found | Nicotiana attenuata Torr. ex S.Watson | not found | protoplast | CRISPR-Cas9 |
| PCdb_4414 | 36406285 | LOC100233098 | Hypothetical protein LOC100233098 [Source: NCBI] | not found | not found | Vitis vinifera L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4415 | 36401738 | MdPGT1 | reduced foliar phloridzin without impacting plant growth | not found | not found | Malus x domestica Bork. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4416 | 36388608 | not found | not found | not found | not found | Manihot esculenta Crantz | not found | protoplast | CRISPR-Cas9 |
| PCdb_4417 | 36376294 | not found | not found | not found | not found | Mimosa pudica L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4418 | 36371609 | not found | not found | not found | not found | Beta vulgaris L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4419 | 36338853 | not found | not found | not found | not found | Daucus carota subsp. sativus (Hoffm.) Sch眉bl. & G.Martens | not found | protoplast | CRISPR-Cas9 |
| PCdb_4420 | 36334622 | trnY | tRNA-Tyr (trnY, mitochondrial genome) | not found | not found | Nicotiana tabacum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4421 | 36334622 | LOC107813371 | Hypothetical protein LOC107813371 [Source: NCBI] | not found | not found | Nicotiana tabacum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4422 | 36319615 | OsNCED3 | Oryza sativa 9-cis-epoxycarotenoid dioxygenase 3 (OsNCED3, ABA biosynthesis) | not found | not found | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4423 | 36311091 | LOC108853094 | Hypothetical protein LOC108853094 [Source: NCBI] | not found | not found | Raphanus sativus L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4424 | 36311091 | LOC108838841 | Hypothetical protein LOC108838841 [Source: NCBI] | not found | not found | Raphanus sativus L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4425 | 36305686 | not found | not found | not found | not found | Betula platyphylla Sukaczev | not found | protoplast | CRISPR-Cas9 |
| PCdb_4426 | 36303886 | PSY | Phytoene synthase | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4427 | 36303886 | BETA-OHASE 2 | Beta-carotene hydroxylase 2 | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4428 | 36294565 | not found | not found | not found | not found | Festuca filiformis Pourr. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4429 | 36275526 | not found | not found | not found | not found | Hordeum vulgare L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4430 | 36268892 | not found | not found | not found | not found | Physalis grisea (Waterf.) M.Mart铆nez | not found | protoplast | CRISPR-Cas9 |
| PCdb_4431 | 36268892 | not found | not found | not found | not found | Solanum tuberosum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4432 | 36264121 | PLDALPHA1 | Phospholipase D alpha-1 | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4433 | 36263914 | not found | not found | not found | not found | Cucumis sativus L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4434 | 36241651 | not found | not found | not found | not found | Coffea canephora Pierre ex A. Froehner | not found | protoplast | CRISPR-Cas9 |
| PCdb_4435 | 36204201 | not found | not found | not found | not found | Apium graveolens L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4436 | 36191156 | not found | not found | not found | not found | Allium cepa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4437 | 36183810 | OsPHS1 | is required for both male and female gamete development in rice | not found | not found | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4438 | 36178561 | not found | not found | not found | not found | Solanum tuberosum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4439 | 36165983 | not found | not found | not found | not found | Camelina sativa (L.) Crantz | not found | protoplast | CRISPR-Cas9 |
| PCdb_4440 | 36161449 | not found | not found | not found | not found | Brassica oleracea L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4441 | 36161010 | LOC107767349 | Hypothetical protein LOC107767349 [Source: NCBI] | not found | not found | Nicotiana tabacum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4442 | 36161010 | LOC107760241 | Hypothetical protein LOC107760241 [Source: NCBI] | not found | not found | Nicotiana tabacum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4443 | 36151927 | LHT2 | Lysine histidine transporter 2 | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4444 | 36151927 | LHT1 | Lysine histidine transporter 1 | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4445 | 36147557 | not found | not found | not found | not found | Lolium perenne L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4446 | 36140817 | not found | not found | not found | not found | Manihot esculenta Crantz | not found | protoplast | CRISPR-Cas9 |
| PCdb_4447 | 36130423 | Endo-LE | suppressed ENGase activity | not found | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4448 | 36068583 | QPT2A | Queuosine tRNA-ribosyltransferase (QPT2A, tRNA modification) | not found | not found | Nicotiana tabacum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4449 | 36068583 | LOC107829123 | Hypothetical protein LOC107829123 [Source: NCBI] | not found | not found | Nicotiana tabacum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4450 | 36061808 | not found | not found | not found | not found | Nicotiana attenuata Torr. ex S.Watson | not found | protoplast | CRISPR-Cas9 |
| PCdb_4451 | 36056465 | EDS1 | a transcription activator-like effector from tomato-pathogenic xanthomonads | not found | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4452 | 36056465 | Bs4 | a transcription activator-like effector from tomato-pathogenic xanthomonads | not found | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4453 | 36030243 | not found | not found | not found | not found | Prunus salicina Lindl. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4454 | 36030243 | not found | not found | not found | not found | Prunus salicina Lindl. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4455 | 36009189 | BAG9 | Confers Thermotolerance by Regulating Cellular Redox Homeostasis and the Stability of Heat Shock Proteins | not found | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4456 | 36005862 | NUC-L1 | Nucleolin-like protein 1 | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4457 | 35997636 | not found | not found | not found | not found | Cucumis sativus L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4458 | 35996008 | not found | not found | not found | not found | Musa acuminata Colla | not found | protoplast | CRISPR-Cas9 |
| PCdb_4459 | 35994211 | not found | not found | not found | not found | Dendrocalamus latiflorus Munro | not found | protoplast | CRISPR-Cas9 |
| PCdb_4460 | 35969610 | FT | FLOWERING LOCUS T | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4461 | 35966691 | not found | not found | not found | not found | Malus x domestica Bork. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4462 | 35966665 | not found | not found | not found | not found | Cucumis sativus L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4463 | 35956532 | not found | not found | not found | not found | Lolium perenne L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4464 | 35946779 | MYB108 | R2R3-MYB transcription factor MYB108 | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4465 | 35946779 | GSL8 | Glucan synthase-like 8 (callose synthase) | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4466 | 35937522 | not found | not found | not found | not found | Marchantia polymorpha L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4467 | 35937377 | OsAT10 | reduces p-coumaric acid incorporation into arabinoxylan without increasing saccharification | not found | not found | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4468 | 35898213 | CAX3 | Cation/H? exchanger 3 (vacuolar Ca?? transport) | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4469 | 35898213 | CAX1 | Cation/H? exchanger 1 (vacuolar Ca?? transport) | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4470 | 35887449 | not found | not found | not found | not found | Festuca filiformis Pourr. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4471 | 35887103 | not found | not found | not found | not found | Malus x domestica Bork. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4472 | 35867472 | not found | not found | not found | not found | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4473 | 35865098 | not found | not found | not found | not found | Panax ginseng C.A.Mey. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4474 | 35859217 | OsSNDP3 | Functions for the Polar Tip Growth in Rice Pollen | not found | not found | Nicotiana tabacum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4475 | 35854143 | CBF | Cold acclimation diversity in Arabidopsis thaliana | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4476 | 35820419 | not found | not found | not found | not found | Populus sp. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4477 | 35817824 | not found | not found | not found | not found | Medicago truncatula Gaertn. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4478 | 35812897 | not found | not found | not found | not found | Lactuca sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4479 | 35806003 | not found | not found | not found | not found | Brassica napus L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4480 | 35806003 | not found | not found | not found | not found | Brassica rapa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4481 | 35796629 | not found | not found | not found | not found | Actinidia chinensis Planch. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4482 | 35789421 | NtRAV4 | negatively regulates drought tolerance in tobacco | not found | not found | Nicotiana tabacum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4483 | 35778883 | not found | not found | not found | not found | Cucumis sativus L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4484 | 35769614 | PMEI | Pectin methylesterase inhibitor (PMEI, cell wall regulation) | not found | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4485 | 35744944 | not found | not found | not found | not found | Nicotiana tabacum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4486 | 35744944 | not found | not found | not found | not found | Nicotiana tabacum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4487 | 35736513 | TAPE | a possible mediator of actomyosin-driven transport of organelles and proteins in rice PT elongation | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4488 | 35736513 | TAPE | a possible mediator of actomyosin-driven transport of organelles and proteins in rice PT elongation | not found | not found | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4489 | 35734250 | not found | not found | not found | not found | Artemisia annua L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4490 | 35731022 | not found | not found | not found | not found | Panax ginseng C. A. Mey. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4491 | 35724659 | not found | not found | not found | not found | Nicotiana attenuata Torr. ex S.Watson | not found | protoplast | CRISPR-Cas9 |
| PCdb_4492 | 35723935 | not found | not found | not found | not found | Camelina sativa (L.) Crantz | not found | protoplast | CRISPR-Cas9 |
| PCdb_4493 | 35722301 | eIF4E1 | eukaryotic Initiation Factor 4E isoform 1 (eIF4E1): translation initiation and potyvirus susceptibility :contentReference[oaicite:3]{index=3} | not found | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4494 | 35717563 | not found | not found | not found | not found | Brassica oleracea L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4495 | 35703939 | not found | not found | not found | not found | Populus sp. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4496 | 35673604 | not found | not found | not found | not found | Citrus 脳 sinensis (L.) Osbeck | not found | protoplast | CRISPR-Cas9 |
| PCdb_4497 | 35669196 | CKX | Enhance Abiotic-Biotic Stress Tolerance and Food Security | not found | not found | Cicer arietinum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4498 | 35665185 | Qa-SNARE | Regulating Arbuscular Mycorrhizal Symbiosis and Seed Fertility | not found | not found | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4499 | 35665185 | not found | not found | not found | not found | Medicago truncatula Gaertn. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4500 | 35665160 | XOPG1 | Xanthomonas outer protein G1 (XOPG1, bacterial virulence effector) | not found | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4501 | 35660141 | not found | not found | not found | not found | Populus sp. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4502 | 35643085 | not found | not found | not found | not found | Dendrocalamus latiflorus Munro | not found | protoplast | CRISPR-Cas9 |
| PCdb_4503 | 35643085 | not found | not found | not found | not found | Hordeum vulgare L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4504 | 35640826 | not found | not found | not found | not found | Populus sp. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4505 | 35628572 | not found | not found | not found | not found | Castanea sativa Mill. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4506 | 35628413 | not found | not found | not found | not found | Gentiana triflora Pall. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4507 | 35620685 | LEC1 | LEAFY COTYLEDON1 transcription factor (seed development) | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4508 | 35608023 | not found | not found | not found | not found | Malus x domestica Bork. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4509 | 35603719 | not found | not found | not found | not found | Lens culinaris Medik. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4510 | 35603719 | not found | not found | not found | not found | Malus x domestica Bork. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4511 | 35601488 | not found | not found | not found | not found | Hordeum vulgare L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4512 | 35597910 | not found | not found | not found | not found | Nicotiana tabacum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4513 | 35563453 | not found | not found | not found | not found | Brassica rapa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4514 | 35560779 | not found | not found | not found | not found | Eragrostis tef (Zucc.) Trotter | not found | protoplast | CRISPR-Cas9 |
| PCdb_4515 | 35557714 | not found | not found | not found | not found | Petunia 脳 atkinsiana (Sweet) D.Don ex W.H.Baxter | not found | protoplast | CRISPR-Cas9 |
| PCdb_4516 | 35552695 | MYC2 | Basic helix-loop-helix transcription factor (jasmonate signaling) [Source: TAIR] | not found | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4517 | 35552406 | COI1 | Coronatine-insensitive 1 (jasmonate receptor) | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4518 | 35532172 | not found | not found | not found | not found | Populus sp. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4519 | 35526197 | not found | not found | not found | not found | Populus sp. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4520 | 35524464 | not found | not found | not found | not found | Nicotiana attenuata Torr. ex S.Watson | not found | protoplast | CRISPR-Cas9 |
| PCdb_4521 | 35498670 | APX2 | Ascorbate peroxidase 2, scavenges hydrogen peroxide in chloroplasts under oxidative stress | not found | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4522 | 35490366 | DGAT2 | Diacylglycerol acyltransferase 2 (triacylglycerol biosynthesis) | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4523 | 35490366 | DGAT2 | Diacylglycerol acyltransferase 2 (triacylglycerol biosynthesis) | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4524 | 35484202 | SMXLsD53 | SMXL/D53 strigolactone signaling protein (SL signaling) | not found | not found | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4525 | 35481141 | GH3-4 | GH3-4 (Gossypium hirsutum Gretchen Hagen 3 auxin-responsive protein 4) [Source: CottonGen] | not found | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4526 | 35472090 | not found | not found | not found | not found | Vitis vinifera L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4527 | 35471600 | PHO2 | Ubiquitin-conjugating enzyme PHO2 (phosphate homeostasis) | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4528 | 35471600 | PHO2 | Ubiquitin-conjugating enzyme PHO2 (phosphate homeostasis) | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4529 | 35471237 | not found | not found | not found | not found | Medicago truncatula Gaertn. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4530 | 35470589 | not found | not found | not found | not found | Panicum virgatum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4531 | 35456933 | not found | not found | not found | not found | Pandanus tectorius Parkinson ex Du Roi | not found | protoplast | CRISPR-Cas9 |
| PCdb_4532 | 35451132 | not found | not found | not found | not found | Hordeum vulgare L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4533 | 35427441 | not found | not found | not found | not found | Nicotiana attenuata Torr. ex S.Watson | not found | protoplast | CRISPR-Cas9 |
| PCdb_4534 | 35427441 | not found | not found | not found | not found | Nicotiana tabacum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4535 | 35422080 | MP | Auxin response factor MONOPTEROS (ARF5) | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4536 | 35403388 | not found | not found | not found | not found | Citrullus lanatus (Thunb.) Matsum. & Nakai | not found | protoplast | CRISPR-Cas9 |
| PCdb_4537 | 35403388 | not found | not found | not found | not found | Cucumis sativus L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4538 | 35401482 | not found | not found | not found | not found | Nicotiana attenuata Torr. ex S.Watson | not found | protoplast | CRISPR-Cas9 |
| PCdb_4539 | 35380264 | not found | not found | not found | not found | Nicotiana tabacum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4540 | 35364697 | not found | not found | not found | not found | Brassica oleracea L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4541 | 35350644 | not found | not found | not found | not found | Camelina sativa (L.) Crantz | not found | protoplast | CRISPR-Cas9 |
| PCdb_4542 | 35343248 | not found | not found | not found | not found | Lotus japonicus (Regel) K.Larsen | not found | protoplast | CRISPR-Cas9 |
| PCdb_4543 | 35339702 | not found | not found | not found | not found | Malus x domestica Bork. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4544 | 35322121 | not found | not found | not found | not found | Solanum nigrum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4545 | 35287861 | not found | not found | not found | not found | Hordeum vulgare L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4546 | 35269874 | PlCZF1 | Necessary for Oospore Development and Virulence in Peronophythora Litchi chinensisi | not found | not found | Litchi chinensis Sonn. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4547 | 35251097 | NtXXT1 | Xylosyltransferase involved in cell wall biosynthesis [Source: UniProt] | not found | not found | Nicotiana tabacum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4548 | 35239739 | not found | not found | not found | not found | Nicotiana attenuata Torr. ex S.Watson | not found | protoplast | CRISPR-Cas9 |
| PCdb_4549 | 35222448 | not found | not found | not found | not found | Cucumis sativus L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4550 | 35199890 | XERICO | attenuate ABA, osmotic and drought stress responses in Arabidopsis | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4551 | 35198543 | not found | not found | not found | not found | Tripterygium wilfordii Hook.f. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4552 | 35188654 | not found | not found | not found | not found | Nicotiana attenuata Torr. ex S.Watson | not found | protoplast | CRISPR-Cas9 |
| PCdb_4553 | 35188200 | ACC2 | Acetyl-CoA carboxylase 2, catalyzes first step in fatty acid biosynthesis | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4554 | 35185980 | GmBICs | Modulate Low Blue Light-Induced Stem Elongation in Soybean | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4555 | 35185980 | GmBICs | Modulate Low Blue Light-Induced Stem Elongation in Soybean | not found | not found | Glycine max (L.) Merr. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4556 | 35184164 | not found | not found | not found | not found | Vitis vinifera L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4557 | 35181968 | not found | encodes an auxin transporter that regulates the numerous spines trait | not found | not found | Cucumis sativus L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4558 | 35163510 | Pssi | Photosystem I subunit (Pssi, photosynthesis) | not found | not found | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4559 | 35151441 | eIF4E2 | eukaryotic Initiation Factor 4E isoform 2 (eIF4E2): translation initiation and potyvirus susceptibility :contentReference[oaicite:1]{index=1} | not found | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4560 | 35151441 | eIF4E1 | eukaryotic Initiation Factor 4E isoform 1 (eIF4E1): translation initiation and potyvirus susceptibility :contentReference[oaicite:2]{index=2} | not found | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4561 | 35142064 | not found | not found | not found | not found | Hemisorghum C.E.Hubb. ex Bor | not found | protoplast | CRISPR-Cas9 |
| PCdb_4562 | 35095953 | not found | not found | not found | not found | Medicago sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4563 | 35087546 | BOR4 | Boron transporter 4, regulates boron distribution in plants | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4564 | 35087546 | AMS | ABORTED MICROSPORES, basic helix-loop-helix TF essential for pollen development | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4565 | 35055011 | OsPAGN 1 | Polygalacturonase inhibitor protein 1 | not found | not found | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4566 | 35048122 | not found | not found | not found | not found | Cucumis sativus L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4567 | 35048110 | LOC101217775 | Hypothetical protein LOC101217775 [Source: NCBI] | not found | not found | Cucumis sativus L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4568 | 35046986 | not found | not found | not found | not found | Medicago sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4569 | 35043187 | ZjTCP7 | induces shoot proliferation | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4570 | 35043187 | ZjTCP7 | induces shoot proliferation | not found | not found | Ziziphus jujuba Mill. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4571 | 35036088 | not found | not found | not found | not found | Musa acuminata Colla | not found | protoplast | CRISPR-Cas9 |
| PCdb_4572 | 35014191 | HvARE1 | improvement of nitrogen use efficiency in barley | not found | not found | Hordeum vulgare L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4573 | 35009008 | not found | not found | not found | not found | 脳 Triticosecale Wittm. ex A.Camus | not found | protoplast | CRISPR-Cas9 |
| PCdb_4574 | 35005700 | CSR1 | Copper-stress-related gene; possibly an ubiquitin ligase involved in stress tolerance. | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4575 | 34988354 | SOG1 | SUPPRESSOR OF GAMMA RESPONSE 1 (SOG1, DNA damage response) | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4576 | 34979927 | not found | not found | not found | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4577 | 34963106 | not found | not found | not found | not found | Nicotiana attenuata Torr. ex S.Watson | not found | protoplast | CRISPR-Cas9 |
| PCdb_4578 | 34930557 | not found | not found | not found | not found | Malus x domestica Bork. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4579 | 34907541 | MADS-box gene | control budbreak in Actinidia Lindl.fruit | not found | not found | Actinidia chinensis Planch. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4580 | 34907313 | TGA | regulate maize inflorescence meristem development | not found | not found | Zea mays L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4581 | 34883285 | GH3.9 | GH3.9 (Gossypium hirsutum Gretchen Hagen 3 auxin-responsive protein 9) [Source: CottonGen] | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4582 | 34870274 | not found | not found | not found | not found | Lepidium campestre (L.) R. Br | not found | protoplast | CRISPR-Cas9 |
| PCdb_4583 | 34854968 | not found | not found | not found | not found | Hemisorghum C.E.Hubb. ex Bor | not found | protoplast | CRISPR-Cas9 |
| PCdb_4584 | 34848708 | not found | not found | not found | not found | Citrullus lanatus (Thunb.) Matsum. & Nakai | not found | protoplast | CRISPR-Cas9 |
| PCdb_4585 | 34848694 | not found | not found | not found | not found | Fragaria vesca L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4586 | 34848694 | not found | not found | not found | not found | Fragaria vesca L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4587 | 34837389 | YIGE1 | contributes to ear length and grain yield in maize | not found | not found | Zea mays L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4588 | 34837319 | not found | not found | not found | not found | Hemisorghum C.E.Hubb. ex Bor | not found | protoplast | CRISPR-Cas9 |
| PCdb_4589 | 34825772 | A G-type lectin receptor-like kinase | regulates the perception of oomycete apoplastic expansin-like proteins | not found | not found | Nicotiana attenuata Torr. ex S.Watson | not found | protoplast | CRISPR-Cas9 |
| PCdb_4590 | 34820200 | not found | not found | not found | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4591 | 34792751 | not found | not found | not found | not found | Manihot esculenta Crantz | not found | protoplast | CRISPR-Cas9 |
| PCdb_4592 | 34776565 | not found | not found | not found | not found | Euphorbia pulcherrima Willd. ex Klotzsch | not found | protoplast | CRISPR-Cas9 |
| PCdb_4593 | 34768853 | not found | not found | not found | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4594 | 34761387 | RECQ4A | RecQ helicase 4A DNA repair enzyme | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4595 | 34740849 | EIN3 | Ethylene Insensitive3 (EIN3) transcription factor | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4596 | 34740849 | EIL1 | Ethylene Insensitive3-Like 1 (EIL1) transcription factor | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4597 | 34721480 | not found | not found | not found | not found | Picea glauca (Moench) Voss | not found | protoplast | CRISPR-Cas9 |
| PCdb_4598 | 34721480 | not found | not found | not found | not found | Picea glauca (Moench) Voss | not found | protoplast | CRISPR-Cas9 |
| PCdb_4599 | 34719693 | OBV | regulates chloroplast development and bundle sheath extension formation in tomato (Solanum lycopersicum) leaf veins | not found | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4600 | 34713261 | not found | not found | not found | not found | Saccharum officinarum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4601 | 34713258 | not found | not found | not found | not found | Hordeum vulgare L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4602 | 34713253 | not found | not found | not found | not found | Ocimum basilicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4603 | 34713229 | LOC107774399 | Hypothetical protein LOC107774399 [Source: NCBI] | not found | not found | Nicotiana tabacum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4604 | 34713228 | not found | not found | not found | not found | Cichorium intybus L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4605 | 34713227 | not found | not found | not found | not found | Nicotiana tabacum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4606 | 34662405 | not found | not found | not found | not found | Brachypodium distachyon (L.) P. Beauv. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4607 | 34630367 | not found | not found | not found | not found | Prunus persica (L.) Batsch | not found | protoplast | CRISPR-Cas9 |
| PCdb_4608 | 34618129 | not found | not found | not found | not found | Nicotiana tabacum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4609 | 34618075 | GL3 | GLABRA3 (trichome initiation transcription factor) [Source: TAIR] | not found | not found | Cucumis sativus L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4610 | 34593776 | not found | not found | not found | not found | Citrullus lanatus (Thunb.) Matsum. & Nakai | not found | protoplast | CRISPR-Cas9 |
| PCdb_4611 | 34589102 | WAT1 | Walls Are Thin1 auxin transporter | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4612 | 34585814 | Dof | Ancient rapid functional differentiation and fixation | not found | not found | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4613 | 34575913 | not found | not found | not found | not found | Populus sp. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4614 | 34562094 | not found | not found | not found | not found | Atropa belladonna L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4615 | 34554293 | not found | not found | not found | not found | Citrus 脳 sinensis (L.) Osbeck | not found | protoplast | CRISPR-Cas9 |
| PCdb_4616 | 34514161 | not found | not found | not found | not found | Nicotiana tabacum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4617 | 34512704 | not found | not found | not found | not found | Castanea sativa Mill. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4618 | 34498373 | not found | not found | not found | not found | Brassica napus L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4619 | 34487614 | not found | not found | not found | not found | Hordeum vulgare L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4620 | 34430815 | PMEU1 | Pectin methylesterase unit 1 (PMEU1, cell wall modification) | not found | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4621 | 34393601 | not found | not found | not found | not found | Setaria viridis (L.) P. Beauv. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4622 | 34381478 | not found | not found | not found | not found | Medicago truncatula Gaertn. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4623 | 34376731 | not found | not found | not found | not found | Cryptomeria japonica (Thunb. ex L. f.) D. Don | not found | protoplast | CRISPR-Cas9 |
| PCdb_4624 | 34369095 | not found | not found | not found | not found | Dolichos montanus Lour. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4625 | 34360958 | WRKY | Determining Plant Height and Stem Development, by Encoding a WRKY Transcription Factor | not found | not found | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4626 | 34360680 | OSMOTIN 34 | Functions in the ABA Signaling Pathway and Is Regulated by Proteolysis | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4627 | 34360680 | OSMOTIN 34 | Functions in the ABA Signaling Pathway and Is Regulated by Proteolysis | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4628 | 34360680 | OSMOTIN 34 | Functions in the ABA Signaling Pathway and Is Regulated by Proteolysis | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4629 | 34355113 | not found | not found | not found | not found | Physcomitrella patens (Hedw.) Bruch & Schimp. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4630 | 34354261 | not found | not found | not found | not found | Populus sp. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4631 | 34322148 | not found | not found | not found | not found | Populus alba L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4632 | 34322148 | not found | not found | not found | not found | Prosopis glandulosa Torr. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4633 | 34304554 | not found | not found | not found | not found | Eucalyptus grandis聽W. Hill ex Maiden | not found | protoplast | CRISPR-Cas9 |
| PCdb_4634 | 34289223 | not found | not found | not found | not found | Glycine soja Siebold & Zucc. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4635 | 34270859 | not found | not found | not found | not found | Cichorium intybus L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4636 | 34270031 | not found | not found | not found | not found | Hordeum vulgare L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4637 | 34267775 | not found | not found | not found | not found | Camelina sativa (L.) Crantz | not found | protoplast | CRISPR-Cas9 |
| PCdb_4638 | 34254310 | not found | not found | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4639 | 34162328 | LOC107832422 | Hypothetical protein LOC107832422 [Source: NCBI] | not found | not found | Nicotiana tabacum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4640 | 34162328 | LOC107790102 | Hypothetical protein LOC107790102 [Source: NCBI] | not found | not found | Nicotiana tabacum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4641 | 34158505 | CRY1 | Cryptochrome 1 (blue light photoreceptor) | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4642 | 34152222 | SHP2 | Enhances Pod-Shattering Resistance in rape L | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4643 | 34152222 | SHP1 | Enhances Pod-Shattering Resistance in rape L | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4644 | 34152222 | LOC106395092 | Enhances Pod-Shattering Resistance in rape L | not found | not found | Brassica napus L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4645 | 34152222 | LOC106390624 | Enhances Pod-Shattering Resistance in rape L | not found | not found | Brassica napus L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4646 | 34152214 | not found | not found | not found | not found | Brassica oleracea L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4647 | 34124996 | not found | not found | not found | not found | Nicotiana attenuata Torr. ex S.Watson | not found | protoplast | CRISPR-Cas9 |
| PCdb_4648 | 34114251 | not found | not found | not found | not found | Populus sp. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4649 | 34113363 | not found | not found | not found | not found | Nicotiana tabacum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4650 | 34102014 | not found | not found | not found | not found | Nicotiana rustica L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4651 | 34093603 | IAA9 | Auxin response factor 9 (auxin signaling repressor) [Source: TAIR] | not found | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4652 | 34086068 | not found | not found | not found | not found | Rehmannia glutinosa (Gaertn.) Libosch. ex Fisch. & C. A. Mey. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4653 | 34029708 | not found | not found | not found | not found | Hordeum vulgare L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4654 | 34029322 | not found | not found | not found | not found | Eucalyptus grandis聽W. Hill ex Maiden | not found | protoplast | CRISPR-Cas9 |
| PCdb_4655 | 34009394 | SlPIF4 | enhances the tolerance of anthers to moderate high- and low-temperature stress | not found | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4656 | 34009359 | not found | not found | not found | not found | Lolium arundinaceum (Schreb.) Darbysh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4657 | 33968108 | not found | not found | not found | not found | Thlaspi arvense L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4658 | 33960612 | not found | not found | not found | not found | Cannabis sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4659 | 33960431 | AGO4A | Argonaute 4a, mediates RNA-directed DNA methylation | not found | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4660 | 33960379 | SHR | SHORT-ROOT transcription factor | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4661 | 33934462 | not found | not found | not found | not found | Musa acuminata Colla | not found | protoplast | CRISPR-Cas9 |
| PCdb_4662 | 33927731 | ANTH | Involved in Rice Pollen Germination | not found | not found | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4663 | 33927731 | ANTH | Involved in Rice Pollen Germination | not found | not found | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4664 | 33920210 | not found | not found | not found | not found | Capsicum annuum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4665 | 33815454 | not found | not found | not found | not found | Salvia miltiorrhiza Bunge | not found | protoplast | CRISPR-Cas9 |
| PCdb_4666 | 33805371 | not found | not found | not found | not found | Litchi chinensis Sonn. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4667 | 33801907 | not found | not found | not found | not found | Symphytum officinale聽L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4668 | 33790265 | not found | not found | not found | not found | Citrullus lanatus (Thunb.) Matsum. & Nakai | not found | protoplast | CRISPR-Cas9 |
| PCdb_4669 | 33790255 | VDE | regulates carotenoid biosynthesis and gene expression during tomato fruit ripening | not found | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4670 | 33768632 | not found | not found | not found | not found | Brachypodium distachyon (L.) P. Beauv. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4671 | 33763102 | not found | not found | not found | not found | Gossypium barbadense L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4672 | 33749085 | not found | not found | not found | not found | Setaria italica (L.) P.Beauv. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4673 | 33735477 | not found | not found | not found | not found | Cannabis sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4674 | 33710783 | not found | not found | not found | not found | Saccharum officinarum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4675 | 33704586 | not found | not found | not found | not found | Phelipanche aegyptiaca (Pers.) Pomel | not found | protoplast | CRISPR-Cas9 |
| PCdb_4676 | 33668636 | MLO1 | Mildew resistance locus O protein | not found | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4677 | 33659018 | CLV3 | CLAVATA3 signaling peptide | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4678 | 33643341 | not found | not found | not found | not found | Nicotiana tabacum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4679 | 33640986 | MtCEP | C-terminally encoded peptide (root nodulation signaling) [Source: Medicago Genome] | not found | not found | Medicago truncatula Gaertn. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4680 | 33627728 | not found | not found | not found | not found | Citrus 脳 sinensis (L.) Osbeck | not found | protoplast | CRISPR-Cas9 |
| PCdb_4681 | 33621369 | LmSTEE | Lemon STE-like protein (stress response) | not found | not found | Brassica napus L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4682 | 33595854 | AAT | Alanine aminotransferase | not found | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4683 | 33590894 | Psy1 | Phytoene synthase | not found | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4684 | 33584780 | LOC107802668 | Hypothetical protein LOC107802668 [Source: NCBI] | not found | not found | Nicotiana tabacum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4685 | 33584780 | LOC107800221 | Hypothetical protein LOC107800221 [Source: NCBI] | not found | not found | Nicotiana tabacum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4686 | 33584780 | LOC107767349 | Hypothetical protein LOC107767349 [Source: NCBI] | not found | not found | Nicotiana tabacum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4687 | 33572199 | not found | not found | not found | not found | Atropa belladonna L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4688 | 33567573 | not found | not found | not found | not found | Nicotiana tabacum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4689 | 33552096 | LOC107825155 | Hypothetical protein LOC107825155 [Source: NCBI] | not found | not found | Nicotiana tabacum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4690 | 33552096 | LOC107791671 | Hypothetical protein LOC107791671 [Source: NCBI] | not found | not found | Nicotiana tabacum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4691 | 33552096 | LOC107771685 | Hypothetical protein LOC107771685 [Source: NCBI] | not found | not found | Nicotiana tabacum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4692 | 33529193 | SPL | SQUAMOSA-promoter binding-like transcription factor | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4693 | 33529193 | MIR172a | microRNA 172a | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4694 | 33519877 | not found | not found | not found | not found | Betula platyphylla Sukaczev | not found | protoplast | CRISPR-Cas9 |
| PCdb_4695 | 33513785 | not found | not found | not found | not found | Hordeum vulgare L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4696 | 33503269 | not found | not found | not found | not found | Actinidia chinensis Planch. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4697 | 33471325 | hpt II | Hygromycin phosphotransferase II (antibiotic resistance) | not found | not found | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4698 | 33445042 | not found | not found | not found | not found | Humulus lupulus L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4699 | 33426339 | not found | not found | not found | not found | Crocus caspius Fisch. & C.A.Mey. ex Hohen. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4700 | 33426339 | not found | not found | not found | not found | Crocus sativus L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4701 | 33414794 | SlSBPASE | Sedoheptulose-1,7-bisphosphatase | not found | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4702 | 33396671 | not found | not found | not found | not found | Actinidia chinensis Planch. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4703 | 33396671 | not found | not found | not found | not found | Actinidia chinensis Planch. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4704 | 33389047 | not found | not found | not found | not found | Trifolium pratense L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4705 | 33369835 | not found | not found | not found | not found | Musa acuminata Colla | not found | protoplast | CRISPR-Cas9 |
| PCdb_4706 | 33345419 | GORI | is required for pollen tube germination and elongation in rice | not found | not found | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4707 | 33343607 | not found | not found | not found | not found | Solanum tuberosum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4708 | 33340318 | not found | not found | not found | not found | Ocimum basilicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4709 | 33328469 | not found | not found | not found | not found | Brassica napus L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4710 | 33324440 | LOC107767349 | Hypothetical protein LOC107767349 [Source: NCBI] | not found | not found | Nicotiana tabacum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4711 | 33324433 | not found | not found | not found | not found | Triticum aestivum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4712 | 33258411 | MIR482c | microRNA 482c | not found | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4713 | 33258411 | MIR482b | microRNA 482b | not found | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4714 | 33236982 | VHA-A3 | Vacuolar H?-ATPase subunit A3 | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4715 | 33236982 | VHA-A2 | Vacuolar H?-ATPase subunit A2 | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4716 | 33236982 | VHA-A1 | Vacuolar H?-ATPase subunit A1 | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4717 | 33236500 | LOC107807968 | Hypothetical protein LOC107807968 [Source: NCBI] | not found | not found | Nicotiana tabacum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4718 | 33236500 | LOC107807126 | Hypothetical protein LOC107807126 [Source: NCBI] | not found | not found | Nicotiana tabacum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4719 | 33214661 | not found | not found | not found | not found | Malus x domestica Bork. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4720 | 33167938 | not found | not found | not found | not found | Citrus 脳 sinensis (L.) Osbeck | not found | protoplast | CRISPR-Cas9 |
| PCdb_4721 | 33101338 | not found | not found | not found | not found | Panicum virgatum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4722 | 33101338 | not found | not found | not found | not found | Panicum virgatum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4723 | 33083135 | not found | not found | not found | not found | Sorghum bicolor (L.) Moench | not found | protoplast | CRISPR-Cas9 |
| PCdb_4724 | 33077493 | DCL2 | Dicer-like 2 RNase III enzyme | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4725 | 33058471 | FLS2 | Flagellin-sensing 2 receptor kinase | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4726 | 33050518 | OsmiR535 | a Potential Genetic Editing Target for Drought and Salinity Stress Tolerance in Oryza sativa | not found | not found | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4727 | 33048397 | Ve1 | Ve1 (Cellurface receptor Ve1) | not found | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4728 | 33048397 | ACS2 | ACS2 (1-aminocyclopropane-1-carboxylate synthase 2) | not found | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4729 | 33046875 | GRF-GIF chimeric protein | improves the regeneration efficiency of transgenic plants | not found | not found | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4730 | 33037631 | not found | not found | not found | not found | Nicotiana attenuata Torr. ex S.Watson | not found | protoplast | CRISPR-Cas9 |
| PCdb_4731 | 33024118 | not found | not found | not found | not found | Populus sp. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4732 | 33004008 | not found | not found | not found | not found | Capsicum annuum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4733 | 32980951 | CLV3 | regulates light-dependent carbohydrate metabolism in Arabidopsis shoots | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4734 | 32980951 | CLE7 | regulates light-dependent carbohydrate metabolism in Arabidopsis shoots | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4735 | 32980951 | CLE2 | regulates light-dependent carbohydrate metabolism in Arabidopsis shoots | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4736 | 32980951 | CLE1 | regulates light-dependent carbohydrate metabolism in Arabidopsis shoots | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4737 | 32956677 | not found | not found | not found | not found | Marchantia polymorpha L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4738 | 32947885 | not found | not found | not found | not found | Lilium pumilum DC. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4739 | 32927657 | not found | not found | not found | not found | Hieracium umbellatum聽L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4740 | 32922814 | ppc2 | ppc2 (Phosphoenolpyruvate carboxylase 2) | not found | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4741 | 32922814 | EZ2 | EZ2 (Enhancer of zeste homolog 2) | not found | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4742 | 32884578 | LOC103421948 | Hypothetical protein LOC103421948 [Source: NCBI] | not found | not found | Malus x domestica Bork. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4743 | 32882392 | not found | not found | not found | not found | Hemisorghum C.E.Hubb. ex Bor | not found | protoplast | CRISPR-Cas9 |
| PCdb_4744 | 32865553 | AHBP-1B | Arabidopsis histidine-binding protein 1B (AHBP-1B, metal ion transport) | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4745 | 32821399 | MLO11 | Mildew resistance locus O 11 (fungal susceptibility) [Source: TAIR] | not found | not found | Vitis vinifera L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4746 | 32821399 | LOC100233057 | Hypothetical protein LOC100233057 [Source: NCBI] | not found | not found | Vitis vinifera L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4747 | 32817523 | AT1G72490 | Cyclin-dependent kinase G1 (AT1G72490, cell cycle control) | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4748 | 32754185 | not found | not found | not found | not found | Hordeum vulgare L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4749 | 32721476 | LOC107823514 | Hypothetical protein LOC107823514 [Source: NCBI] | not found | not found | Nicotiana tabacum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4750 | 32721476 | F3H | F3H (Flavanone 3-hydroxylase, EC 1.14.11.9, flavonoid biosynthesis) [Source: UniProt] | not found | not found | Nicotiana tabacum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4751 | 32714289 | PsGH7a | Glycosyl hydrolase family 7 enzyme (PsGH7a) | not found | not found | Glycine max (L.) Merr. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4752 | 32685983 | not found | not found | not found | not found | Dendrocalamus latiflorus Munro | not found | protoplast | CRISPR-Cas9 |
| PCdb_4753 | 32669419 | not found | not found | not found | not found | Cannabis sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4754 | 32669419 | not found | not found | not found | not found | Parasponia andersonii Planch. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4755 | 32668582 | LRK1 | as a Dark Respiration Regulator | not found | not found | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4756 | 32665336 | not found | not found | not found | not found | Nicotiana attenuata Torr. ex S.Watson | not found | protoplast | CRISPR-Cas9 |
| PCdb_4757 | 32663371 | not found | not found | not found | not found | Populus sp. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4758 | 32601419 | not found | not found | not found | not found | Nicotiana tabacum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4759 | 32589719 | not found | not found | not found | not found | Salvia miltiorrhiza Bunge | not found | protoplast | CRISPR-Cas9 |
| PCdb_4760 | 32575125 | not found | not found | not found | not found | Hordeum vulgare L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4761 | 32560695 | not found | not found | not found | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4762 | 32529426 | not found | not found | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4763 | 32501639 | not found | not found | not found | not found | Hemisorghum C.E.Hubb. ex Bor | not found | protoplast | CRISPR-Cas9 |
| PCdb_4764 | 32450806 | LOC107823061 | Hypothetical protein LOC107823061 [Source: NCBI] | not found | not found | Nicotiana tabacum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4765 | 32444138 | MET1 | DNA methyltransferase MET1 | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4766 | 32444138 | IAMT1 | Indole-3-acetic acid methyltransferase 1 | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4767 | 32439662 | CAS922 | CRISPR-associated protein 922 (exact function in plants requires further characterization) | not found | not found | Helianthus annuus L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4768 | 32431055 | ZmPT7 | regulates Pi uptake and redistribution which is modulated by phosphorylation | not found | not found | Zea mays L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4769 | 32408486 | not found | not found | not found | not found | Eucalyptus grandis聽W. Hill ex Maiden | not found | protoplast | CRISPR-Cas9 |
| PCdb_4770 | 32372640 | MYC2 | Basic helix-loop-helix transcription factor (jasmonate signaling) [Source: TAIR] | not found | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4771 | 32372640 | loxD | Lipoxygenase D (jasmonate biosynthesis) [Source: TAIR] | not found | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4772 | 32372640 | Coi1 | Coronatine insensitive 1, jasmonate signaling component | not found | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4773 | 32358986 | CRT1a | Carotene isomerase (CRTISO) 1a | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4774 | 32342027 | not found | not found | not found | not found | Brachypodium distachyon (L.) P.Beauv. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4775 | 32338291 | NOR | Non-ripening (NOR) transcription factor regulating fruit maturation [Source: UniProt] | not found | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4776 | 32338291 | LOC101250914 | Hypothetical protein LOC101250914 [Source: NCBI] | not found | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4777 | 32338291 | ACS2 | 1-aminocyclopropane-1-carboxylic acid synthase 2, ethylene biosynthesis enzyme | not found | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4778 | 32333191 | not found | not found | not found | not found | Torenia fournieri Linden ex E. Fourn. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4779 | 32331715 | not found | not found | not found | not found | Beta vulgaris L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4780 | 32328868 | not found | not found | not found | not found | Vitis vinifera L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4781 | 32326260 | not found | not found | not found | not found | Eliokarmos dubius (Spreng.) F.M.Leight. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4782 | 32280363 | not found | not found | not found | not found | Crocus sativus L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4783 | 32239684 | not found | not found | not found | not found | Lupinus albus L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4784 | 32221665 | MYB75 | MYB transcription factor 75 (flavonoid biosynthesis) [Source: TAIR] | not found | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4785 | 32221665 | ANT1 | Anthocyanin transporter 1, involved in vacuolar pigment accumulation | not found | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4786 | 32173726 | GID1b-1 | suppress xylem proliferation and reduce water loss under water-deficit conditions | not found | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4787 | 32145071 | not found | not found | not found | not found | Populus sp. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4788 | 32139477 | SIP3 | Salt-induced protein 3 | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4789 | 32139477 | CBL2 | Calcineurin B-like calcium sensor protein CBL2 | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4790 | 32138192 | ARF4 | Auxin response factor 4, mediates auxin signaling in plant development | not found | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4791 | 32096293 | HTR12 | Histone H3 variant (centromere-specific histone) [Source: UniProt] | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4792 | 32085527 | not found | not found | not found | not found | Cardamine hirsuta L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4793 | 32061011 | not found | not found | not found | not found | Lolium perenne L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4794 | 32033421 | not found | not found | not found | not found | Hordeum vulgare L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4795 | 32006663 | not found | not found | not found | not found | Musa acuminata Colla | not found | protoplast | CRISPR-Cas9 |
| PCdb_4796 | 32001520 | not found | not found | not found | not found | Prunus persica (L.) Batsch | not found | protoplast | CRISPR-Cas9 |
| PCdb_4797 | 31998348 | NtFT5 | encodes a day-neutral floral activator | not found | not found | Nicotiana tabacum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4798 | 31983318 | Psy1 | Phytoene synthase 1 (PSY1) | not found | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4799 | 31983318 | AS1 | ASYMMETRIC LEAVES1 transcription factor | not found | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4800 | 31960023 | not found | not found | not found | not found | Petunia hybrida (Hook.) E. Vilm. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4801 | 31888281 | not found | not found | not found | not found | Pyrus communis聽L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4802 | 31873217 | not found | not found | not found | not found | Solanum tuberosum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4803 | 31872214 | not found | not found | not found | not found | Populus sp. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4804 | 31858701 | not found | not found | not found | not found | Dendrocalamus latiflorus Munro | not found | protoplast | CRISPR-Cas9 |
| PCdb_4805 | 31858701 | not found | not found | not found | not found | Dendrocalamus latiflorus Munro | not found | protoplast | CRISPR-Cas9 |
| PCdb_4806 | 31848794 | not found | not found | not found | not found | Nicotiana attenuata Torr. ex S.Watson | not found | protoplast | CRISPR-Cas9 |
| PCdb_4807 | 31838574 | not found | not found | not found | not found | Tripterygium wilfordii Hook.f. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4808 | 31836812 | SD1 | Semi-dwarf 1 gene (GA20ox-2) controlling plant height | not found | not found | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4809 | 31797132 | MIR160a | MicroRNA 160a (auxin response regulation) [Source: miRBase] | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4810 | 31791724 | not found | not found | not found | not found | Hordeum vulgare L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4811 | 31745156 | not found | not found | not found | not found | Cucumis sativus L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4812 | 31736216 | not found | not found | not found | not found | Populus sp. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4813 | 31684863 | RSR4 | the dispensability of PDX1.2 for Arabidopsis viability | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4814 | 31684863 | PDX1.2 | the dispensability of PDX1.2 for Arabidopsis viability | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4815 | 31676875 | not found | not found | not found | not found | Gentiana triflora Pall. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4816 | 31663642 | not found | not found | not found | not found | Vitis vinifera L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4817 | 31644604 | not found | not found | not found | not found | Capsicum annuum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4818 | 31625612 | MYB75 | fine-tune anthocyanin content in tomato fruit | not found | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4819 | 31625612 | ANT1 | fine-tune anthocyanin content in tomato fruit | not found | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4820 | 31583668 | not found | not found | not found | not found | Brassica napus L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4821 | 31562521 | not found | not found | not found | not found | Kalanchoe fedtschenkoi Raym.-Hamet & H.Perrier | not found | protoplast | CRISPR-Cas9 |
| PCdb_4822 | 31545795 | FT | FLOWERING LOCUS T | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4823 | 31543452 | not found | not found | not found | not found | Marchantia polymorpha L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4824 | 31523744 | not found | not found | not found | not found | Physcomitrella patens (Hedw.) Bruch & Schimp. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4825 | 31516942 | not found | not found | not found | not found | Nicotiana tabacum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4826 | 31495052 | not found | not found | not found | not found | Malus x domestica Bork. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4827 | 31485270 | not found | not found | not found | not found | Manihot esculenta Crantz | not found | protoplast | CRISPR-Cas9 |
| PCdb_4828 | 31483929 | RECQ 4 | increases homeologous crossovers in an interspecific tomato hybrid | not found | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4829 | 31475981 | not found | not found | not found | not found | Cannabis sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4830 | 31452297 | not found | not found | not found | not found | Physcomitrella patens (Hedw.) Bruch & Schimp. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4831 | 31418782 | not found | not found | not found | not found | Lotus japonicus (Regel) K.Larsen | not found | protoplast | CRISPR-Cas9 |
| PCdb_4832 | 31391538 | not found | not found | not found | not found | Phelipanche aegyptiaca (Pers.) Pomel | not found | protoplast | CRISPR-Cas9 |
| PCdb_4833 | 31391538 | not found | not found | not found | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4834 | 31379911 | not found | not found | not found | not found | Marchantia polymorpha L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4835 | 31374142 | not found | not found | not found | not found | Hemisorghum C.E.Hubb. ex Bor | not found | protoplast | CRISPR-Cas9 |
| PCdb_4836 | 31357516 | not found | not found | not found | not found | Hordeum vulgare L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4837 | 31357245 | MYB | MYB transcription factor family protein (regulation of secondary metabolism) [Source: TAIR] | not found | not found | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4838 | 31355948 | Lb | leghemoglobin genes in Lotus japonicus uncovers their synergistic roles in symbiotic nitrogen fixation | not found | not found | Lotus japonicus (Regel) K.Larsen | not found | protoplast | CRISPR-Cas9 |
| PCdb_4839 | 31350564 | not found | not found | not found | not found | Maytenus ilicifolia Mart. ex Reissek | not found | protoplast | CRISPR-Cas9 |
| PCdb_4840 | 31350363 | PIF | Maize Phytochrome-Interacting Factors in Light Signaling and Photomorphogenesis | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4841 | 31350363 | PIF | Maize Phytochrome-Interacting Factors in Light Signaling and Photomorphogenesis | not found | not found | Zea mays L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4842 | 31344908 | not found | not found | not found | not found | Populus sp. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4843 | 31344316 | not found | not found | not found | not found | Musa acuminata Colla | not found | protoplast | CRISPR-Cas9 |
| PCdb_4844 | 31320138 | not found | not found | not found | not found | Brassica rapa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4845 | 31317418 | not found | not found | not found | not found | Physcomitrella patens (Hedw.) Bruch & Schimp. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4846 | 31281290 | UvHOX2 | Regulates Chlamydospore Formation, Conidiogenesis, and Pathogenicity | not found | not found | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4847 | 31272394 | not found | not found | not found | not found | Camelina sativa (L.) Crantz | not found | protoplast | CRISPR-Cas9 |
| PCdb_4848 | 31228115 | not found | not found | not found | not found | Manihot esculenta Crantz | not found | protoplast | CRISPR-Cas9 |
| PCdb_4849 | 31222853 | not found | not found | not found | not found | Petunia hybrida (Hook.) E. Vilm. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4850 | 31207994 | not found | not found | not found | not found | Lilium longiflorum 'White Heaven' | not found | protoplast | CRISPR-Cas9 |
| PCdb_4851 | 31207994 | not found | not found | not found | not found | Lilium pumilum DC. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4852 | 31197230 | not found | not found | not found | not found | Manihot esculenta Crantz | not found | protoplast | CRISPR-Cas9 |
| PCdb_4853 | 31156675 | PDS1 | Phytoene desaturase suppressor 1 (PDS1, carotenoid regulation) | not found | not found | Vitis vinifera L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4854 | 31129735 | not found | not found | not found | not found | Brassica rapa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4855 | 31061537 | not found | not found | not found | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4856 | 31059138 | not found | not found | not found | not found | Hordeum vulgare L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4857 | 31018865 | not found | not found | not found | not found | Manihot esculenta Crantz | not found | protoplast | CRISPR-Cas9 |
| PCdb_4858 | 30976084 | not found | not found | not found | not found | Medicago truncatula Gaertn. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4859 | 30961525 | SPL9 | Squamosa-promoter binding-like 9 | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4860 | 30895623 | not found | not found | not found | not found | Tripterygium wilfordii Hook.f. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4861 | 30816950 | not found | not found | not found | not found | Marchantia polymorpha L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4862 | 30811314 | not found | not found | not found | not found | Capsicum annuum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4863 | 30774962 | FUL1 | MADS-box transcription factor FRUITFULL1 | not found | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4864 | 30774962 | ACS2 | 1-Aminocyclopropane-1-carboxylate synthase 2 | not found | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4865 | 30760561 | TDP1 | Tyrosyl-DNA phosphodiesterase 1 | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4866 | 30760561 | SMT3 | Small ubiquitin-related modifier SMT3 | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4867 | 30760561 | MUS81 | Structure-specific endonuclease MUS81 | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4868 | 30737425 | FUL2 | MADS-box transcription factor FRUITFULL2 | not found | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4869 | 30737425 | FUL1 | MADS-box transcription factor FRUITFULL1 | not found | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4870 | 30729184 | not found | not found | not found | not found | Musa balbisiana Colla | not found | protoplast | CRISPR-Cas9 |
| PCdb_4871 | 30723180 | WRKY40 | Response to Abscisic Acid | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4872 | 30723180 | GPRI1 | Response to Abscisic Acid | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4873 | 30723180 | GLK2 | Response to Abscisic Acid | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4874 | 30723180 | ABI5 | Response to Abscisic Acid | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4875 | 30697931 | not found | not found | not found | not found | Nicotiana tabacum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4876 | 30669982 | dhn | Dehydrin (stress-protective protein) | not found | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4877 | 30652405 | ACS2 | 1-Aminocyclopropane-1-carboxylate synthase 2 | not found | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4878 | 30649572 | not found | not found | not found | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4879 | 30636294 | not found | not found | not found | not found | Physcomitrella patens (Hedw.) Bruch & Schimp. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4880 | 30633425 | not found | not found | not found | not found | Hordeum vulgare L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4881 | 30610643 | not found | not found | not found | not found | Nicotiana tabacum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4882 | 30610635 | not found | not found | not found | not found | Brassica oleracea L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4883 | 30610166 | MYC2 | bHLH transcription factor MYC2 | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4884 | 30597099 | HY5 | Basic leucine zipper transcription factor HY5 | not found | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4885 | 30597099 | HY5 | Basic leucine zipper transcription factor HY5 | not found | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4886 | 30582769 | OsACL2 | negatively regulates cell death and disease resistance in rice | not found | not found | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4887 | 30573379 | not found | not found | not found | not found | Fragaria vesca L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4888 | 30568723 | not found | not found | not found | not found | Hordeum vulgare L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4889 | 30565826 | not found | not found | not found | not found | Beta vulgaris L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4890 | 30508598 | FLS2 | Flagellin-sensing receptor kinase FLS2 | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4891 | 30508598 | AT5G42000 | WRKY transcription factor AT5G42000 (stress response regulation) | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4892 | 30508598 | AT1G01230 | F-box/RNI-like protein (AT1G01230, protein degradation) | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4893 | 30460568 | not found | not found | not found | not found | Hordeum vulgare L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4894 | 30460562 | not found | not found | not found | not found | Hordeum vulgare L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4895 | 30459790 | SMG7 | SMG7, nonsense-mediated mRNA decay factor | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4896 | 30442644 | not found | not found | not found | not found | Marchantia polymorpha L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4897 | 30442644 | not found | not found | not found | not found | Marchantia polymorpha L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4898 | 30429497 | not found | not found | not found | not found | Brassica oleracea L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4899 | 30428077 | not found | not found | not found | not found | Fragaria vesca L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4900 | 30415491 | YUC2 | regulates auxin-mediated root development | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4901 | 30415491 | PIN4 | regulates auxin-mediated root development | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4902 | 30415491 | NAC6 | regulates auxin-mediated root development | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4903 | 30415491 | ARF8 | regulates auxin-mediated root development | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4904 | 30405661 | not found | not found | not found | not found | Hordeum vulgare L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4905 | 30390050 | not found | not found | not found | not found | Malus x domestica Bork. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4906 | 30390050 | not found | not found | not found | not found | Vitis vinifera L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4907 | 30379827 | not found | not found | not found | not found | Marchantia polymorpha L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4908 | 30377238 | not found | not found | not found | not found | Petunia hybrida (Hook.) E. Vilm. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4909 | 30338631 | PROCERA | one DELLA protein | not found | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4910 | 30327661 | PHR1 | Phosphate starvation response transcription factor PHR1 | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4911 | 30327661 | PHL1 | Phosphate starvation response transcription factor PHL1 | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4912 | 30302894 | not found | not found | not found | not found | Actinidia chinensis Planch. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4913 | 30285624 | not found | not found | not found | not found | Hordeum vulgare L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4914 | 30272678 | not found | not found | not found | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4915 | 30272678 | not found | not found | not found | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4916 | 30272676 | not found | not found | not found | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4917 | 30266091 | TT4 | Chalcone synthase (TT4) | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4918 | 30266091 | AP1 | APETALA1 MADS-box transcription factor | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4919 | 30266091 | AGO1 | Argonaute 1 (RNA-induced silencing complex) | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4920 | 30265349 | not found | not found | not found | not found | Populus sp. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4921 | 30183125 | not found | not found | not found | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4922 | 30125629 | not found | not found | not found | not found | Tripterygium wilfordii Hook.f. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4923 | 30102384 | not found | not found | not found | not found | Marchantia polymorpha L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4924 | 30049895 | not found | not found | not found | not found | Tripterygium wilfordii Hook.f. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4925 | 30018630 | LOC544055 | Putative protein LOC544055 | not found | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4926 | 30018630 | LOC101244084 | Putative protein LOC101244084 | not found | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4927 | 30006757 | LOC107791353 | Hypothetical protein LOC107791353 [Source: NCBI] | not found | not found | Nicotiana tabacum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4928 | 30006757 | LOC107775040 | Hypothetical protein LOC107775040 [Source: NCBI] | not found | not found | Nicotiana tabacum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4929 | 29987710 | not found | not found | not found | not found | Musa acuminata Colla | not found | protoplast | CRISPR-Cas9 |
| PCdb_4930 | 29979095 | not found | not found | not found | not found | Capsicum annuum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4931 | 29916068 | not found | not found | not found | not found | Hordeum vulgare L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4932 | 29890017 | not found | not found | not found | not found | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4933 | 29872452 | not found | not found | not found | not found | Nicotiana tabacum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4934 | 29797624 | EFS | EARLY FLOWERING IN SHORT DAYS (EFS): histone H3K36 methyltransferase, promotes flowering time | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4935 | 29785355 | not found | not found | not found | not found | Jatropha curcas聽L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4936 | 29752751 | NRPB1 | DNA-directed RNA polymerase II subunit RPB1 [Source: UniProt] | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4937 | 29752751 | CYCB1 | Cyclin B1, involved in cell cycle regulation (G2/M transition). | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4938 | 29739710 | not found | not found | not found | not found | Ipomoea nil (L.) Roth | not found | protoplast | CRISPR-Cas9 |
| PCdb_4939 | 29714687 | PIN1 | PIN-FORMED 1 auxin transporter (PIN1, polar auxin transport) | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4940 | 29668111 | Psy1 | Phytoene synthase 1 (Psy1) | not found | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4941 | 29668111 | CRTISO | Carotene isomerase (CRTISO) | not found | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4942 | 29668051 | not found | not found | not found | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4943 | 29625203 | not found | not found | not found | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4944 | 29614837 | not found | not found | not found | not found | Nicotiana tabacum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4945 | 29614837 | not found | not found | not found | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4946 | 29327444 | not found | not found | not found | not found | Hemisorghum C.E.Hubb. ex Bor | not found | protoplast | CRISPR-Cas9 |
| PCdb_4947 | 29247330 | not found | not found | not found | not found | Ipomoea nil (L.) Roth | not found | protoplast | CRISPR-Cas9 |
| PCdb_4948 | 29216494 | not found | not found | not found | not found | Camelina sativa (L.) Crantz | not found | protoplast | CRISPR-Cas9 |
| PCdb_4949 | 29213323 | not found | not found | not found | not found | Panicum virgatum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4950 | 29192328 | not found | not found | not found | not found | Petunia hybrida (Hook.) E. Vilm. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4951 | 29163593 | OsARM1 | Is Involved in Regulation of the Response to Arsenic Stress in Rice | not found | not found | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4952 | 29158545 | not found | not found | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4953 | 29141013 | HK3 | Hexokinase-3 (sugar sensing and signaling) [Source: UniProt] | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4954 | 29114020 | not found | not found | not found | not found | Rosa hybrida E.H.L.Krause | not found | protoplast | CRISPR-Cas9 |
| PCdb_4955 | 29085071 | not found | not found | not found | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4956 | 29021797 | OsFIGNL1 | Essential for Male Meiosis | not found | not found | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4957 | 28937992 | not found | not found | not found | not found | Brassica carinata A. Braun | not found | protoplast | CRISPR-Cas9 |
| PCdb_4958 | 28919533 | not found | not found | not found | not found | Cucumis sativus L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4959 | 28919077 | not found | not found | not found | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4960 | 28855641 | not found | not found | not found | not found | Ipomoea nil (L.) Roth | not found | protoplast | CRISPR-Cas9 |
| PCdb_4961 | 28765632 | LOC544313 | Ornithine transcarbamylase-like LOC544313 | not found | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4962 | 28765632 | GAD3 | Glutamate decarboxylase 3 | not found | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4963 | 28765632 | GAD2 | Glutamate decarboxylase 2 | not found | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4964 | 28667273 | SlMBP 21 MADS-box | Tomato MADS-box protein TM6 homolog | not found | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4965 | 28663331 | not found | not found | not found | not found | Nicotiana attenuata Torr. ex S.Watson | not found | protoplast | CRISPR-Cas9 |
| PCdb_4966 | 28642780 | XTH19 | Xyloglucan endotransglucosylase/hydrolase 19 (XTH19, cell wall remodeling) | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4967 | 28642780 | EXPA11 | EXPA10 (Expansin A10, cell wall loosening protein) [Source: UniProt] | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4968 | 28642780 | EXPA10 | ERF16 (Ethylene responsive factor 16, transcription factor) [Source: UniProt] | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4969 | 28523445 | PtrMYB57 | contributes to the negative regulation of anthocyanin and proanthocyanidin biosynthesis | not found | not found | Populus sp. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4970 | 28444797 | MYB115 | contributes to the regulation of proanthocyanidin biosynthesis and enhances fungal resistance in poplar | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4971 | 28444797 | MYB115 | contributes to the regulation of proanthocyanidin biosynthesis and enhances fungal resistance in poplar | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4972 | 28444797 | MYB115 | contributes to the regulation of proanthocyanidin biosynthesis and enhances fungal resistance in poplar | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4973 | 28432338 | Argonaute 2 | Reveals its Differential Involvement in Antiviral Responses | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4974 | 28396675 | LOC107767349 | Hypothetical protein LOC107767349 [Source: NCBI] | not found | not found | Nicotiana tabacum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4975 | 28396675 | LOC107760241 | Hypothetical protein LOC107760241 [Source: NCBI] | not found | not found | Nicotiana tabacum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4976 | 28371923 | NUMBER2 and OsMADS3 | Regulate Maintenance and Determinacy of the Flower Meristem in Rice | not found | not found | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4977 | 28371200 | not found | not found | not found | not found | Citrus 脳 sinensis (L.) Osbeck | not found | protoplast | CRISPR-Cas9 |
| PCdb_4978 | 28256553 | not found | not found | not found | not found | Salvia miltiorrhiza Bunge | not found | protoplast | CRISPR-Cas9 |
| PCdb_4979 | 28128458 | not found | not found | not found | not found | Nicotiana attenuata Torr. ex S.Watson | not found | protoplast | CRISPR-Cas9 |
| PCdb_4980 | 28127299 | not found | not found | not found | not found | Dendrobium officinale Kimura & Migo | not found | protoplast | CRISPR-Cas9 |
| PCdb_4981 | 28101094 | not found | not found | not found | not found | Nicotiana tabacum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4982 | 28066464 | LOC103451629 | Hypothetical protein LOC103451629 [Source: NCBI] | not found | not found | Malus x domestica Bork. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4983 | 28066464 | LOC103413654 | Hypothetical protein LOC103413654 [Source: NCBI] | not found | not found | Malus x domestica Bork. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4984 | 28066464 | LOC103403305 | Hypothetical protein LOC103403305 [Source: NCBI] | not found | not found | Malus x domestica Bork. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4985 | 27885771 | not found | not found | not found | not found | Camelina sativa (L.) Crantz | not found | protoplast | CRISPR-Cas9 |
| PCdb_4986 | 27834007 | not found | not found | not found | not found | Medicago truncatula Gaertn. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4987 | 27833912 | not found | not found | not found | not found | Nicotiana attenuata Torr. ex S.Watson | not found | protoplast | CRISPR-Cas9 |
| PCdb_4988 | 27815670 | CYP734A4 | the brassinosteroid catabolic gene | not found | not found | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4989 | 27613750 | not found | not found | not found | not found | Physcomitrella patens (Hedw.) Bruch & Schimp. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4990 | 27599367 | CBF1 | C-repeat binding factor 1 | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4991 | 27557689 | CaS | Callose synthase | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4992 | 27472659 | DREB1A | DRE-binding protein 1A | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4993 | 27472659 | CBF2 | C-repeat binding factor 2 | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4994 | 27472659 | CBF | C-repeat binding factor | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4995 | 27252305 | DREB1A | DRE-binding protein 1A | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4996 | 27252305 | CBF2 | C-repeat binding factor 2 | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4997 | 27252305 | CBF1 | C-repeat binding factor 1 | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4998 | 26870061 | not found | not found | not found | not found | Nicotiana tabacum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_4999 | 26616834 | not found | not found | not found | not found | Brassica oleracea L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5000 | 26616834 | not found | not found | not found | not found | Hordeum vulgare L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5001 | 26524930 | YAO | Zinc鈥恌inger protein YAO (female gametophyte development) | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5002 | 26496757 | not found | not found | not found | not found | Populus sp. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5003 | 26479970 | not found | not found | not found | not found | Medicago truncatula Gaertn. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5004 | 26039254 | not found | not found | not found | not found | Nicotiana attenuata Torr. ex S.Watson | not found | protoplast | CRISPR-Cas9 |
| PCdb_5005 | 25344637 | LOC107800572 | Hypothetical protein LOC107800572 [Source: NCBI] | not found | not found | Nicotiana tabacum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5006 | 25327456 | CaS | Callose synthase | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5007 | 25327456 | ADH1 | Alcohol dehydrogenase 1 | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5008 | 24918588 | GFP | Green fluorescent protein | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5009 | 24443494 | not found | not found | not found | not found | Marchantia polymorpha L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5010 | 23956122 | not found | not found | not found | not found | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5011 | 23929339 | FLS2 | FLS2 (Arabidopsis thaliana FLAGELLIN SENSING 2, pattern recognition receptor) [Source: TAIR] | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5012 | 0 | Solyc02g069400(SAG101-1) | Senescence-associated gene 101 homolog | not found | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5013 | 0 | Solyc02g067660(SAG101-2) | Senescence-associated gene 101 homolog | not found | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5014 | 0 | Solyc02g065110(MKKK15) | Mitogen-activated protein kinase kinase kinase 15 | not found | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5015 | 0 | Solyc02g032850(PAD4) | Phytoalexin deficient 4 lipase (PAD4) | not found | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5016 | 0 | Solyc02g032850(PAD4) | Phytoalexin deficient 4 lipase (PAD4) | not found | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5017 | 0 | Solyc02g031790(LRRXII-RLK) | Leucine-rich repeat receptor-like kinase | not found | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5018 | 0 | Solyc02g014040(BIK1) | BOTRYTIS-INDUCED KINASE1 (receptor-like cytoplasmic kinase) | not found | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5019 | 36995634 | not found | not found | not found | not found | Nicotiana attenuata Torr. ex S.Watson | not found | protoplast | CRISPR-Cas9 |
| PCdb_5020 | 35773498 | SP5G | SELF-PRUNING 5G (SP5G, flowering time regulation) | not found | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5021 | 35485960 | SPO11-2 | Meiotic DNA double-strand break formation protein SPO11-2 | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5022 | 35485960 | SPO11-2 | Meiotic DNA double-strand break formation protein SPO11-2 | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5023 | 35485960 | SPO11-2 | Meiotic DNA double-strand break formation protein SPO11-2 | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5024 | 35485960 | SPO11-2 | Meiotic DNA double-strand break formation protein SPO11-2 | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5025 | 35088855 | LOC543989 | Hypothetical protein LOC543989 [Source: NCBI] | not found | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5026 | 34569819 | not found | not found | not found | not found | Nicotiana attenuata Torr. ex S.Watson | not found | protoplast | CRISPR-Cas9 |
| PCdb_5027 | 32959126 | not found | not found | not found | not found | Petunia hybrida (Hook.) E. Vilm. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5028 | 32748081 | not found | not found | not found | not found | Citrus 脳 sinensis (L.) Osbeck | not found | protoplast | CRISPR-Cas9 |
| PCdb_5029 | 31981443 | FT5A | Flowering promoter FT homolog FT5a | not found | not found | Glycine max (L.) Merr. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5030 | 31981443 | FT2A | Flowering promoter FT homolog FT2a | not found | not found | Glycine max (L.) Merr. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5031 | 31981443 | FT1A | Flowering promoter FT homolog FT1a | not found | not found | Glycine max (L.) Merr. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5032 | 31702097 | not found | not found | not found | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5033 | 31208390 | not found | not found | not found | not found | Nicotiana attenuata Torr. ex S.Watson | not found | protoplast | CRISPR-Cas9 |
| PCdb_5034 | 28623586 | PAP1 | PRODUCTION OF ANTHOCYANIN PIGMENT 1 (PAP1, flavonoid biosynthesis) | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5035 | 28623586 | CSTF64 | Cleavage stimulation factor 64?kDa subunit; involved in pre-mRNA 3鈥?end processing. | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5036 | 28622347 | PAP1 | PRODUCTION OF ANTHOCYANIN PIGMENT 1 (PAP1, flavonoid biosynthesis) | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5037 | 28622347 | PAP1 | PRODUCTION OF ANTHOCYANIN PIGMENT 1 (PAP1, flavonoid biosynthesis) | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5038 | 28622347 | HSF1 | Heat shock factor 1 (stress response regulator) [Source: UniProt] | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5039 | 28622347 | AVP1 | Vacuolar H+-pyrophosphatase, involved in proton transport and pH regulation | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5040 | 28549739 | MFS | MFS deletion reduced damage to Bambusaceae Nakai leaves | not found | not found | Shiraia bambusicola Henn | not found | protoplast | CRISPR-Cas9 |
| PCdb_5041 | 28205546 | FAD2 | F3H (Flavanone 3-hydroxylase, EC 1.14.11.9, flavonoid biosynthesis) [Source: UniProt] | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5042 | 27368642 | not found | not found | not found | not found | Physcomitrella patens (Hedw.) Bruch & Schimp. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5043 | 26825596 | not found | not found | not found | not found | Petunia hybrida (Hook.) E. Vilm. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5044 | 37324668 | not found | not found | not found | not found | Solanum tuberosum L. | not found | pollen tube,fruit,ovary | CRISPR-Cas9 |
| PCdb_5045 | 37324668 | not found | not found | not found | not found | Symphytum tuberosum L. | not found | pollen tube,fruit,ovary | CRISPR-Cas9 |
| PCdb_5046 | 29358212 | BS1 | Brown streak virus protein 1 (viral pathogenesis factor) | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | Plasmodesmata | CRISPR-Cas9 |
| PCdb_5047 | 37961313 | SPEECHLESS | in response to changing climate conditions | not found | not found | Solanum lycopersicum L. | not found | Plants,plants,stomatal | CRISPR-Cas9 |
| PCdb_5048 | 35028494 | not found | not found | not found | not found | Oryza sativa L. | not found | Plants,plants,flag leaf,shoot | CRISPR-Cas9 |
| PCdb_5049 | 37547730 | not found | not found | not found | not found | Brassica napus L. | not found | plants,flower bud | CRISPR-Cas9 |
| PCdb_5050 | 37830787 | FLOWERING LOCUS T 5b | regulates photoperiodic flowering and improves the geographical adaptation | not found | not found | Glycine max (L.) Merr. | not found | Plants,flower | CRISPR-Cas9 |
| PCdb_5051 | 34360584 | LOC107818776 | Hypothetical protein LOC107818776 [Source: NCBI] | not found | not found | Nicotiana tabacum L. | not found | Plant Cells,Protoplasts | CRISPR-Cas9 |
| PCdb_5052 | 36795787 | LUC | the luciferase (LUC) gene | not found | not found | Nicotiana tabacum L. | not found | Plant Cells | CRISPR-Cas9 |
| PCdb_5053 | 37338208 | DcMYB11c | regulates carrot anthocyanins accumulation in petiole but not taproot | not found | not found | Daucus carota subsp. sativus (Hoffm.) Sch眉bl. & G.Martens | not found | petioles,plants,petiole,taproot,plant | CRISPR-Cas9 |
| PCdb_5054 | 37818992 | not found | not found | not found | not found | Petunia hybrida (Hook.) E. Vilm. | not found | petals,petal,adaxial epidermis,plants,EPIDERMIS,epidermis,epidermal cells | CRISPR-Cas9 |
| PCdb_5055 | 37394728 | not found | not found | not found | not found | Petunia axillaris (Lam.) Britton, Sterns & Poggenb. | not found | petal,flower bud,pistil,plants,flower,plant | CRISPR-Cas9 |
| PCdb_5056 | 37819983 | not found | not found | not found | not found | Oryza sativa L. | not found | panicle,plants,shoot,plant | CRISPR-Cas9 |
| PCdb_5057 | 36345265 | LOC101261271 | Hypothetical protein LOC101261271 [Source: NCBI] | not found | not found | Solanum lycopersicum L. | not found | Organelles | CRISPR-Cas9 |
| PCdb_5058 | 33385273 | not found | not found | not found | not found | Hemisorghum C.E.Hubb. ex Bor | not found | not found | CRISPR-Cas9 |
| PCdb_5059 | 28917642 | not found | not found | not found | not found | Solanum lycopersicum L. | not found | not found | CRISPR-Cas9 |
| PCdb_5060 | 38077491 | not found | not found | not found | not found | Brassica napus L. | not found | not found | CRISPR-Cas9 |
| PCdb_5061 | 38073233 | not found | not found | not found | not found | Manihot esculenta Crantz | not found | not found | CRISPR-Cas9 |
| PCdb_5062 | 38069102 | not found | not found | not found | not found | Capsicum annuum L. | not found | not found | CRISPR-Cas9 |
| PCdb_5063 | 38069102 | not found | not found | not found | not found | Capsicum annuum L. | not found | not found | CRISPR-Cas9 |
| PCdb_5064 | 38069102 | not found | not found | not found | not found | Capsicum annuum var. glabriusculum (Dunal) Heiser & Pickersgill | not found | not found | CRISPR-Cas9 |
| PCdb_5065 | 38041775 | not found | not found | not found | not found | Citrus 脳 sinensis (L.) Osbeck | not found | not found | CRISPR-Cas9 |
| PCdb_5066 | 38038993 | not found | not found | not found | not found | Sorghum bicolor (L.) Moench | not found | not found | CRISPR-Cas9 |
| PCdb_5067 | 38013635 | not found | not found | not found | not found | Musa acuminata Colla | not found | not found | CRISPR-Cas9 |
| PCdb_5068 | 38013483 | not found | not found | not found | not found | Tripterygium wilfordii Hook.f. | not found | not found | CRISPR-Cas9 |
| PCdb_5069 | 38001333 | not found | not found | not found | not found | Medicago truncatula Gaertn. | not found | not found | CRISPR-Cas9 |
| PCdb_5070 | 37929181 | not found | not found | not found | not found | Petroselinum crispum (Mill.) Fuss | not found | not found | CRISPR-Cas9 |
| PCdb_5071 | 37924917 | not found | not found | not found | not found | Salvia miltiorrhiza Bunge | not found | not found | CRISPR-Cas9 |
| PCdb_5072 | 37908609 | not found | not found | not found | not found | Solanum tuberosum L. | not found | not found | CRISPR-Cas9 |
| PCdb_5073 | 37900765 | DAD 2 | DECREASED APICAL DOMINANCE 2 (strigolactone receptor) | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | not found | CRISPR-Cas9 |
| PCdb_5074 | 37894996 | not found | not found | not found | not found | Camellia sinensis (L.) Kuntze | not found | not found | CRISPR-Cas9 |
| PCdb_5075 | 37888266 | not found | not found | not found | not found | Picea rubens Sarg. | not found | not found | CRISPR-Cas9 |
| PCdb_5076 | 37882269 | not found | not found | not found | not found | Brachypodium distachyon (L.) P. Beauv. | not found | not found | CRISPR-Cas9 |
| PCdb_5077 | 37874448 | not found | not found | not found | not found | Solanum tuberosum L. | not found | not found | CRISPR-Cas9 |
| PCdb_5078 | 37856192 | SlNOR-like1 | plays a dual regulatory role in tomato fruit cuticle formation | not found | not found | Solanum lycopersicum L. | not found | not found | CRISPR-Cas9 |
| PCdb_5079 | 37810390 | not found | not found | not found | not found | Pisum sativum L. | not found | not found | CRISPR-Cas9 |
| PCdb_5080 | 37805949 | AMP726 & VAMP725 | regulate vesicle secretion and pollen tube growth in Arabidopsis | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | not found | CRISPR-Cas9 |
| PCdb_5081 | 37805949 | AMP726 & VAMP725 | regulate vesicle secretion and pollen tube growth in Arabidopsis | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | not found | CRISPR-Cas9 |
| PCdb_5082 | 37805949 | AMP726 & VAMP725 | regulate vesicle secretion and pollen tube growth in Arabidopsis | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | not found | CRISPR-Cas9 |
| PCdb_5083 | 37796686 | not found | not found | not found | not found | Cichorium intybus L. | not found | not found | CRISPR-Cas9 |
| PCdb_5084 | 37790475 | not found | not found | not found | not found | Erysimum cheiranthoides L. | not found | not found | CRISPR-Cas9 |
| PCdb_5085 | 37790475 | not found | not found | not found | not found | Erysimum cheiranthoides聽L. | not found | not found | CRISPR-Cas9 |
| PCdb_5086 | 37746172 | not found | not found | not found | not found | Lolium perenne L. | not found | not found | CRISPR-Cas9 |
| PCdb_5087 | 37701798 | not found | not found | not found | not found | Allium cepa L. | not found | not found | CRISPR-Cas9 |
| PCdb_5088 | 37700173 | not found | not found | not found | not found | Nicotiana tabacum L. | not found | not found | CRISPR-Cas9 |
| PCdb_5089 | 37692430 | not found | not found | not found | not found | Vitis vinifera L. | not found | not found | CRISPR-Cas9 |
| PCdb_5090 | 37687275 | JcNAC1 & JcZFP8 | Enhanced Drought Resistance | not found | not found | Nicotiana Benthamiana L. | not found | not found | CRISPR-Cas9 |
| PCdb_5091 | 37687275 | JcNAC1 & JcZFP8 | Enhanced Drought Resistance | not found | not found | Nicotiana tabacum L. | not found | not found | CRISPR-Cas9 |
| PCdb_5092 | 37686051 | not found | not found | not found | not found | Brassica oleracea L. | not found | not found | CRISPR-Cas9 |
| PCdb_5093 | 37685921 | not found | not found | not found | not found | Brassica napus L. | not found | not found | CRISPR-Cas9 |
| PCdb_5094 | 37683750 | not found | not found | not found | not found | Populus tomentosa Carri猫re | not found | not found | CRISPR-Cas9 |
| PCdb_5095 | 37646674 | RPB 1 | RNA polymerase II subunit 1 (RPB1, transcription) | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | not found | CRISPR-Cas9 |
| PCdb_5096 | 37633915 | not found | not found | not found | not found | Sorghum bicolor (L.) Moench | not found | not found | CRISPR-Cas9 |
| PCdb_5097 | 37623635 | not found | not found | not found | not found | Litchi chinensis Sonn. | not found | not found | CRISPR-Cas9 |
| PCdb_5098 | 37616014 | not found | not found | not found | not found | Lupinus albus L. | not found | not found | CRISPR-Cas9 |
| PCdb_5099 | 37616013 | not found | not found | not found | not found | Cucumis sativus L. | not found | not found | CRISPR-Cas9 |
| PCdb_5100 | 37610064 | not found | not found | not found | not found | Nicotiana alata Link & Otto | not found | not found | CRISPR-Cas9 |
| PCdb_5101 | 37610064 | not found | not found | not found | not found | Nicotiana tabacum L. | not found | not found | CRISPR-Cas9 |
| PCdb_5102 | 37606277 | not found | not found | not found | not found | Dianthus caryophyllus L. | not found | not found | CRISPR-Cas9 |
| PCdb_5103 | 37600507 | not found | not found | not found | not found | Aconitum carmichaelii Debeaux | not found | not found | CRISPR-Cas9 |
| PCdb_5104 | 37511604 | not found | not found | not found | not found | Sedum alfredii Hance | not found | not found | CRISPR-Cas9 |
| PCdb_5105 | 37511604 | not found | not found | not found | not found | Sedum plumbizincicola X.H.Guo & S.B.Zhou ex X.H.Guo et al. | not found | not found | CRISPR-Cas9 |
| PCdb_5106 | 37429890 | not found | not found | not found | not found | Galium lucidum All. | not found | not found | CRISPR-Cas9 |
| PCdb_5107 | 33019636 | NIR1 | Controls Nitrogen Flux and Growth in Arabidopsis | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | Mitochondria,Plastids | CRISPR-Cas9 |
| PCdb_5108 | 29445053 | not found | not found | not found | not found | Physcomitrella patens (Hedw.) Bruch & Schimp. | not found | Microtubules | CRISPR-Cas9 |
| PCdb_5109 | 37158657 | not found | not found | not found | not found | Daucus carota subsp. sativus (Hoffm.) Sch眉bl. & G.Martens | not found | mature stage | CRISPR-Cas9 |
| PCdb_5110 | 37158657 | not found | not found | not found | not found | Daucus carota subsp. sativus (Hoffm.) Sch眉bl. & G.Martens | not found | mature stage | CRISPR-Cas9 |
| PCdb_5111 | 35396726 | CLE42 | delays leaf senescence | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | leaf | CRISPR-Cas9 |
| PCdb_5112 | 35396726 | CLE42 | delays leaf senescence | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | leaf | CRISPR-Cas9 |
| PCdb_5113 | 35396726 | CLE42 | delays leaf senescence | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | leaf | CRISPR-Cas9 |
| PCdb_5114 | 35396726 | CLE42 | delays leaf senescence | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | leaf | CRISPR-Cas9 |
| PCdb_5115 | 35396726 | CLE42 | delays leaf senescence | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | leaf | CRISPR-Cas9 |
| PCdb_5116 | 37952099 | not found | not found | not found | not found | Chelidonium majus L. | not found | Latex,plant,plants,latex | CRISPR-Cas9 |
| PCdb_5117 | 37952099 | not found | not found | not found | not found | Papaver somniferum L. | not found | Latex,plant,plants,latex | CRISPR-Cas9 |
| PCdb_5118 | 36247537 | OsARF4 | regulates leaf inclination via auxin and brassinosteroid pathways | not found | not found | Oryza sativa L. | not found | joint,plant | CRISPR-Cas9 |
| PCdb_5119 | 36555723 | Ospmei12 | Involved in Growth, Cell Wall Development, and Response to Phytohormone and Heavy Metal Stress | not found | not found | Oryza sativa L. | not found | internodes,plants,mature stage,seedling,plantCell Wall | CRISPR-Cas9 |
| PCdb_5120 | 37148653 | TFL1 | TERMINAL FLOWER 1 (TFL1, flowering time regulation) | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | inflorescence,plants,plant | CRISPR-Cas9 |
| PCdb_5121 | 37148653 | AGL79 | AGAMOUS-like 79, MADS-box transcription factor regulating floral development | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | inflorescence,plants,plant | CRISPR-Cas9 |
| PCdb_5122 | 37184575 | not found | not found | not found | not found | Andropogon drummondii Steud. | not found | inflorescence,plant,inflorescences | CRISPR-Cas9 |
| PCdb_5123 | 37184575 | not found | not found | not found | not found | Hemisorghum C.E.Hubb. ex Bor | not found | inflorescence,plant,inflorescences | CRISPR-Cas9 |
| PCdb_5124 | 37184575 | not found | not found | not found | not found | Sorghum bicolor (L.) Moench | not found | inflorescence,plant,inflorescences | CRISPR-Cas9 |
| PCdb_5125 | 36722358 | not found | not found | not found | not found | Malus x domestica Bork. | not found | hypocotyl | CRISPR-Cas9 |
| PCdb_5126 | 36722358 | not found | not found | not found | not found | Malus x domestica Bork. | not found | hypocotyl | CRISPR-Cas9 |
| PCdb_5127 | 31726763 | GmPPR4 | Responses to Drought Stress | not found | not found | Glycine max (L.) Merr. | 0.592 | hairy root | CRISPR-Cas9 |
| PCdb_5128 | 32265954 | not found | not found | not found | not found | Medicago truncatula Gaertn. | not found | hairy root | CRISPR-Cas9 |
| PCdb_5129 | 34685581 | not found | not found | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | Golgi Apparatus | CRISPR-Cas9 |
| PCdb_5130 | 36592318 | not found | not found | not found | not found | Nicotiana attenuata Torr. ex S.Watson | not found | germ cells,plants,plant | CRISPR-Cas9 |
| PCdb_5131 | 30603093 | SlARF2B | Auxin response factor 2B | not found | not found | Solanum lycopersicum L. | not found | Germ Cells | CRISPR-Cas9 |
| PCdb_5132 | 30603093 | SlACS2&4 | 1-Aminocyclopropane-1-carboxylate synthase (ACS2 & ACS4) | not found | not found | Solanum lycopersicum L. | not found | Germ Cells | CRISPR-Cas9 |
| PCdb_5133 | 38070579 | not found | not found | not found | not found | Citrus 脳 sinensis (L.) Osbeck | not found | fruit | CRISPR-Cas9 |
| PCdb_5134 | 37530518 | not found | not found | not found | not found | Solanum americanum Mill. | not found | fruit | CRISPR-Cas9 |
| PCdb_5135 | 37530518 | not found | not found | not found | not found | Solanum nigrum L. | not found | fruit | CRISPR-Cas9 |
| PCdb_5136 | 37289779 | not found | not found | not found | not found | Vitis vinifera L. | not found | fruit | CRISPR-Cas9 |
| PCdb_5137 | 35031800 | SlIDI1 | is involved in tomato carotenoid synthesis in a complex way. | not found | not found | Solanum lycopersicum L. | not found | fruit | CRISPR-Cas9 |
| PCdb_5138 | 37960050 | AGAMOUS | monitoring the floral development and floral form. | not found | not found | Malus x domestica Bork. | not found | fruit | CRISPR-Cas9 |
| PCdb_5139 | 38094587 | PetM cytochrome b6f subunit 7 domain | Cytochrome b6f complex subunit PetM | not found | not found | Solanum lycopersicum L. | not found | fruit | CRISPR-Cas9 |
| PCdb_5140 | 37343602 | not found | not found | not found | not found | Raphanus sativus L. | not found | fruit | CRISPR-Cas9 |
| PCdb_5141 | 37819050 | not found | not found | not found | not found | Dendrobium suzukii T.Yukawa | not found | fruit | CRISPR-Cas9 |
| PCdb_5142 | 37819050 | not found | not found | not found | not found | Diphyscium suzukii D.H.Norris | not found | fruit | CRISPR-Cas9 |
| PCdb_5143 | 36960430 | not found | not found | not found | not found | Cucumis sativus L. | not found | fruit | CRISPR-Cas9 |
| PCdb_5144 | 36960430 | not found | not found | not found | not found | Cucumis sativus L. | not found | fruit | CRISPR-Cas9 |
| PCdb_5145 | 36960430 | not found | not found | not found | not found | Solanum lycopersicum L. | not found | fruit | CRISPR-Cas9 |
| PCdb_5146 | 36960432 | not found | not found | not found | not found | Fragaria vesca L. | not found | fruit | CRISPR-Cas9 |
| PCdb_5147 | 37823527 | not found | not found | not found | not found | Campanula portenschlagiana Schult. | not found | fruit | CRISPR-Cas9 |
| PCdb_5148 | 25917172 | ccdB | Bacterial toxin CcdB (DNA gyrase inhibitor) | not found | not found | Arabidopsis thaliana (L.) Heynh. | 0.814 | four | CRISPR-Cas9 |
| PCdb_5149 | 34059660 | not found | not found | not found | not found | Petunia 脳 atkinsiana (Sweet) D.Don ex W.H.Baxter | not found | flower bud,corolla tube,plants,plant | CRISPR-Cas9 |
| PCdb_5150 | 34059660 | not found | not found | not found | not found | Petunia hybrida (Hook.) E. Vilm. | not found | flower bud,corolla tube,plants,plant | CRISPR-Cas9 |
| PCdb_5151 | 37217185 | not found | not found | not found | not found | Ranunculus viridis H.D.Wilson & Garn.-Jones | not found | flagellates,plants | CRISPR-Cas9 |
| PCdb_5152 | 37217185 | not found | not found | not found | not found | Rauvolfia viridis Willd. ex Roem. & Schult. | not found | flagellates,plants | CRISPR-Cas9 |
| PCdb_5153 | 37217185 | not found | not found | not found | not found | Reseda viridis Balf.f. | not found | flagellates,plants | CRISPR-Cas9 |
| PCdb_5154 | 37087999 | CAP1 | Cyclase-associated protein 1, regulates actin dynamics and cell morphology | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | filament,seedlings,cotyledons,plants,pollen tube,seedling,plant | CRISPR-Cas9 |
| PCdb_5155 | 34829981 | not found | not found | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | Euchromatin,Heterochromatin | CRISPR-Cas9 |
| PCdb_5156 | 29875274 | not found | not found | not found | not found | Solanum lycopersicum L. | not found | Euchromatin,Heterochromatin | CRISPR-Cas9 |
| PCdb_5157 | 37561192 | OsGER4 | involved in heat stress response in rice root development | not found | not found | Oryza sativa L. | not found | epidermis,primordial,lateral root,stele,root primordial | CRISPR-Cas9 |
| PCdb_5158 | 37935439 | not found | not found | not found | not found | Hemisorghum C.E.Hubb. ex Bor | not found | endosperm | CRISPR-Cas9 |
| PCdb_5159 | 37935439 | not found | not found | not found | not found | Sorghum bicolor (L.) Moench | not found | endosperm | CRISPR-Cas9 |
| PCdb_5160 | 36307477 | DIS1 | Distorted root hair initiation protein | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | embryo | CRISPR-Cas9 |
| PCdb_5161 | 36307477 | ARPC3 | ARP2/3 complex subunit 3 | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | embryo | CRISPR-Cas9 |
| PCdb_5162 | 36307477 | ARPC1A | ARP2/3 complex subunit 1A | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | embryo | CRISPR-Cas9 |
| PCdb_5163 | 36307477 | ARP2 | Actin-related protein 2 | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | embryo | CRISPR-Cas9 |
| PCdb_5164 | 36307477 | ACT12 | Actin 12 | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | embryo | CRISPR-Cas9 |
| PCdb_5165 | 34880893 | not found | not found | not found | not found | Elaeis guineensis Jacq. | not found | embryo | CRISPR-Cas9 |
| PCdb_5166 | 30834637 | PGK | Phosphoglycerate kinase | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | Cytosol,Plastids | CRISPR-Cas9 |
| PCdb_5167 | 37212708 | not found | not found | not found | not found | Anaphalis hancockii Maxim. | not found | cuticle,Ergot,ergot | CRISPR-Cas9 |
| PCdb_5168 | 37212708 | not found | not found | not found | not found | Astragalus hancockii Bunge ex Maxim. | not found | cuticle,Ergot,ergot | CRISPR-Cas9 |
| PCdb_5169 | 30521567 | DFR | Dihydroflavonol 4-reductase | not found | not found | Solanum lycopersicum L. | 0.538 | cotyledon and leaf | CRISPR-Cas9 |
| PCdb_5170 | 30521567 | DFR | Dihydroflavonol 4-reductase | not found | not found | Solanum lycopersicum L. | 0.538 | cotyledon and leaf | CRISPR-Cas9 |
| PCdb_5171 | 30521567 | DFR | Dihydroflavonol 4-reductase | not found | not found | Solanum lycopersicum L. | 0.538 | cotyledon and leaf | CRISPR-Cas9 |
| PCdb_5172 | 36448836 | RCA | Rubisco activase | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | chloroplast | CRISPR-Cas9 |
| PCdb_5173 | 36448836 | AT5G59613 | Uncharacterized protein (AT5G59613) | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | chloroplast | CRISPR-Cas9 |
| PCdb_5174 | 35748307 | not found | not found | not found | not found | Lactuca sativa L. | not found | chloroplast | CRISPR-Cas9 |
| PCdb_5175 | 35608125 | not found | not found | not found | not found | Setaria viridis (L.) P. Beauv. | not found | chloroplast | CRISPR-Cas9 |
| PCdb_5176 | 34380739 | LOC107822687 | Hypothetical protein LOC107822687 [Source: NCBI] | not found | not found | Nicotiana tabacum L. | not found | chloroplast | CRISPR-Cas9 |
| PCdb_5177 | 32560081 | YL | chloroplast RNA editing and photosynthesis | not found | not found | Glycine max (L.) Merr. | not found | chloroplast | CRISPR-Cas9 |
| PCdb_5178 | 31244201 | PE-1 | Impacts Heading Date and Chloroplast Development in Rice | not found | not found | Oryza sativa L. | not found | chloroplast | CRISPR-Cas9 |
| PCdb_5179 | 30828904 | not found | not found | not found | not found | Capsicum annuum L. | not found | chloroplast | CRISPR-Cas9 |
| PCdb_5180 | 30311663 | not found | not found | not found | not found | Sedum plumbizincicola X.H.Guo & S.B.Zhou ex X.H.Guo et al. | not found | chloroplast | CRISPR-Cas9 |
| PCdb_5181 | 30875368 | FZL | FZO-like chloroplast division factor | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | chloroplast | CRISPR-Cas9 |
| PCdb_5182 | 30760722 | FWA | FLOWERING WAGENINGEN homeotic protein | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | chloroplast | CRISPR-Cas9 |
| PCdb_5183 | 30218582 | not found | not found | not found | not found | Populus sp. | not found | chloroplast | CRISPR-Cas9 |
| PCdb_5184 | 29660180 | WUS | critical for plant meristem maintenance and determinacy | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | chloroplast | CRISPR-Cas9 |
| PCdb_5185 | 29660180 | TFL2 | critical for plant meristem maintenance and determinacy | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | chloroplast | CRISPR-Cas9 |
| PCdb_5186 | 29660180 | AG | critical for plant meristem maintenance and determinacy | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | chloroplast | CRISPR-Cas9 |
| PCdb_5187 | 29996713 | not found | not found | not found | not found | Echinochloa crus-galli (L.) P.Beauv. | not found | chloroplast | CRISPR-Cas9 |
| PCdb_5188 | 35487648 | not found | not found | not found | not found | Cucumis sativus L. | not found | chloroplast | CRISPR-Cas9 |
| PCdb_5189 | 34419551 | not found | not found | not found | not found | Salvia miltiorrhiza Bunge | not found | chloroplast | CRISPR-Cas9 |
| PCdb_5190 | 32483326 | not found | not found | not found | not found | Populus sp. | not found | chloroplast | CRISPR-Cas9 |
| PCdb_5191 | 32427850 | not found | not found | not found | not found | Medicago sativa L. | not found | chloroplast | CRISPR-Cas9 |
| PCdb_5192 | 32369642 | FLORAL4 | FLORAL4 (Arabidopsis thaliana FLORAL ORGAN NUMBER4, auxin response factor) [Source: TAIR] | not found | not found | Solanum lycopersicum L. | not found | chloroplast | CRISPR-Cas9 |
| PCdb_5193 | 30043304 | not found | not found | not found | not found | Medicago sativa L. | not found | chloroplast | CRISPR-Cas9 |
| PCdb_5194 | 30043304 | not found | not found | not found | not found | Medicago truncatula Gaertn. | not found | chloroplast | CRISPR-Cas9 |
| PCdb_5195 | 27098585 | not found | not found | not found | not found | Vitis vinifera L. | not found | chloroplast | CRISPR-Cas9 |
| PCdb_5196 | 33319863 | not found | not found | not found | not found | Vigna unguiculata (L.) Walp. | not found | Centromere | CRISPR-Cas9 |
| PCdb_5197 | 33898972 | not found | not found | not found | not found | Hordeum vulgare L. | not found | Cells, Cultured,Plant Cells | CRISPR-Cas9 |
| PCdb_5198 | 34204559 | not found | not found | not found | not found | Daucus carota subsp. sativus (Hoffm.) Sch眉bl. & G.Martens | not found | Cell Wall,Plastids | CRISPR-Cas9 |
| PCdb_5199 | 34303025 | Rsc4-3 | Rsc4-3 disease resistance protein (fungal resistance) | not found | not found | Glycine max (L.) Merr. | not found | Cell Wall,Inclusion Bodies | CRISPR-Cas9 |
| PCdb_5200 | 36856333 | XXT5 | Xyloglucan xylosyltransferase 5 (XXT5, cell wall biosynthesis) | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | Cell Wall | CRISPR-Cas9 |
| PCdb_5201 | 36856333 | XXT4 | Xyloglucan xylosyltransferase 4 (XXT4, cell wall biosynthesis) | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | Cell Wall | CRISPR-Cas9 |
| PCdb_5202 | 36856333 | XXT3 | Xyloglucan xylosyltransferase 3 (XXT3, cell wall biosynthesis) | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | Cell Wall | CRISPR-Cas9 |
| PCdb_5203 | 36856333 | XT2 | Xylosyltransferase 2 (XT2, hemicellulose synthesis) | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | Cell Wall | CRISPR-Cas9 |
| PCdb_5204 | 36856333 | XT1 | Xylosyltransferase 1 (XT1, hemicellulose synthesis) | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | Cell Wall | CRISPR-Cas9 |
| PCdb_5205 | 36040843 | not found | not found | not found | not found | Populus sp. | not found | Cell Wall | CRISPR-Cas9 |
| PCdb_5206 | 35266285 | not found | not found | not found | not found | Populus sp. | not found | Cell Wall | CRISPR-Cas9 |
| PCdb_5207 | 34446550 | not found | not found | not found | not found | Hordeum vulgare L. | not found | Cell Wall | CRISPR-Cas9 |
| PCdb_5208 | 33713445 | not found | not found | not found | not found | Populus sp. | not found | Cell Wall | CRISPR-Cas9 |
| PCdb_5209 | 32890421 | not found | not found | not found | not found | Hordeum vulgare L. | not found | Cell Wall | CRISPR-Cas9 |
| PCdb_5210 | 31690654 | stiff1 | Promoter Increases Stalk Strength | not found | not found | Zea mays L. | not found | Cell Wall | CRISPR-Cas9 |
| PCdb_5211 | 30883799 | not found | not found | not found | not found | Panicum virgatum L. | not found | Cell Wall | CRISPR-Cas9 |
| PCdb_5212 | 30806711 | NST1 | NAC secondary wall thickening promoter NST1 | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | Cell Wall | CRISPR-Cas9 |
| PCdb_5213 | 30773774 | OsMYB108 | increased expressions of lignin biosynthetic genes and enhanced lignin deposition in culm cell walls. | not found | not found | Oryza sativa L. | not found | Cell Wall | CRISPR-Cas9 |
| PCdb_5214 | 28117379 | not found | not found | not found | not found | Populus sp. | not found | Cell Wall | CRISPR-Cas9 |
| PCdb_5215 | 33955481 | TPL | TOPLESS co-repressor | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | Cell Nucleus | CRISPR-Cas9 |
| PCdb_5216 | 33955481 | CPR5 | Constitutive expresser of PR genes 5 | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | Cell Nucleus | CRISPR-Cas9 |
| PCdb_5217 | 33955481 | AT4G31570 | Cytochrome P450 71A13 (AT4G31570, secondary metabolism) | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | Cell Nucleus | CRISPR-Cas9 |
| PCdb_5218 | 31818903 | FIE | FIE (Arabidopsis thaliana FERTILIZATION INDEPENDENT ENDOSPERM, Polycomb group protein) [Source: TAIR] | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | Cell Nucleus | CRISPR-Cas9 |
| PCdb_5219 | 33139576 | AT5G40153 | Transposable element gene (AT5G40153, ATCOPIA93 family) | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | Cell Membrane,Cell Wall | CRISPR-Cas9 |
| PCdb_5220 | 35312013 | FAH2 | Fatty acid hydroxylase 2 | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | Cell Membrane | CRISPR-Cas9 |
| PCdb_5221 | 35312013 | FAH1 | Fatty acid hydroxylase 1 | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | Cell Membrane | CRISPR-Cas9 |
| PCdb_5222 | 35312013 | CERK1 | Chitin elicitor receptor kinase 1 | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | Cell Membrane | CRISPR-Cas9 |
| PCdb_5223 | 35312013 | BAK1 | BRI1-associated receptor kinase 1 | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | Cell Membrane | CRISPR-Cas9 |
| PCdb_5224 | 33846264 | not found | not found | not found | not found | Oryza sativa L. | not found | Cell Membrane | CRISPR-Cas9 |
| PCdb_5225 | 32514144 | not found | not found | not found | not found | Medicago truncatula Gaertn. | not found | Cell Membrane | CRISPR-Cas9 |
| PCdb_5226 | 28160363 | LOC107767349 | Hypothetical protein LOC107767349 [Source: NCBI] | not found | not found | Nicotiana tabacum L. | not found | Cell Line | CRISPR-Cas9 |
| PCdb_5227 | 37321436 | not found | not found | not found | not found | Camellia sinensis (L.) Kuntze | not found | callus | CRISPR-Cas9 |
| PCdb_5228 | 37077374 | not found | not found | not found | not found | Vitis vinifera L. | not found | callus | CRISPR-Cas9 |
| PCdb_5229 | 32849487 | AvrLm7 | Avirulence effector protein AvrLm7 | not found | not found | Brassica napus L. | not found | calli | CRISPR-Cas9 |
| PCdb_5230 | 37403333 | not found | not found | not found | not found | Crepidium oculatum (Rchb.f.) Szlach. | not found | adult stage,notochord,larval | CRISPR-Cas9 |
| PCdb_5231 | 31362589 | not found | not found | not found | not found | Medicago truncatula Gaertn. | not found | Endoplasmic Reticulum | CRISPR-Cas3,TALEN |
| PCdb_5232 | 31362589 | MtCAS31 | promotes autophagic degradation under drought stress | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | Endoplasmic Reticulum | CRISPR-Cas3,TALEN |
| PCdb_5233 | 29868087 | not found | not found | not found | not found | Medicago truncatula Gaertn. | not found | protoplast | CRISPR-Cas3 |
| PCdb_5234 | 15630625 | not found | not found | not found | not found | Manihot esculenta Crantz | not found | protoplast | CRISPR-Cas3 |
| PCdb_5235 | 37636103 | not found | not found | not found | not found | Nicotiana tabacum L. | not found | not found | CRISPR-Cas13,Prime editor,CRISPR-Cas9,Base editor,CRISPR-Cas12 |
| PCdb_5236 | 34686666 | not found | not found | not found | not found | Phyllanthus amarus Shumach. & Thonn. | not found | protoplast | CRISPR-Cas13,CRISPR-Cas12 |
| PCdb_5237 | 36325075 | not found | not found | not found | not found | Nicotiana attenuata Torr. ex S.Watson | not found | protoplast | CRISPR-Cas13 |
| PCdb_5238 | 34633749 | not found | not found | not found | not found | Ipomoea batatas (L.) Lam. | not found | protoplast | CRISPR-Cas13 |
| PCdb_5239 | 33642571 | not found | not found | not found | not found | Vitis vinifera L. | not found | protoplast | CRISPR-Cas13 |
| PCdb_5240 | 29301551 | not found | not found | not found | not found | Nicotiana attenuata Torr. ex S.Watson | not found | protoplast | CRISPR-Cas13 |
| PCdb_5241 | 37466441 | not found | not found | not found | not found | Pimelea aeruginosa F.Muell. | not found | not found | CRISPR-Cas13 |
| PCdb_5242 | 10998189 | not found | not found | not found | not found | Medicago sativa L. | not found | cotyledon | CRISPR-Cas13 |
| PCdb_5243 | 37402755 | not found | not found | not found | not found | Citrus 脳 sinensis (L.) Osbeck | not found | protoplast | CRISPR-Cas12 |
| PCdb_5244 | 37402755 | not found | not found | not found | not found | Citrus 脳 sinensis (L.) Osbeck | not found | protoplast | CRISPR-Cas12 |
| PCdb_5245 | 37161551 | not found | not found | not found | not found | Carex albicans Willd. ex Spreng. | not found | protoplast | CRISPR-Cas12 |
| PCdb_5246 | 37161551 | not found | not found | not found | not found | Chaptalia albicans (Sw.) Vent. ex Steud. | not found | protoplast | CRISPR-Cas12 |
| PCdb_5247 | 37161551 | not found | not found | not found | not found | Chondrorhyncha albicans Rolfe | not found | protoplast | CRISPR-Cas12 |
| PCdb_5248 | 37161551 | not found | not found | not found | not found | Chondrorhyncha albicans Rolfe | not found | protoplast | CRISPR-Cas12 |
| PCdb_5249 | 37161551 | not found | not found | not found | not found | Cineraria albicans N.E.Br. | not found | protoplast | CRISPR-Cas12 |
| PCdb_5250 | 37161551 | not found | not found | not found | not found | Cyathopsis albicans (Brongn. & Gris) Quinn | not found | protoplast | CRISPR-Cas12 |
| PCdb_5251 | 37161551 | not found | not found | not found | not found | Cyphanthera albicans (A.Cunn.) Miers | not found | protoplast | CRISPR-Cas12 |
| PCdb_5252 | 36853759 | not found | not found | not found | not found | Armoracia rusticana P.Gaertn., B.Mey. & Scherb. | not found | protoplast | CRISPR-Cas12 |
| PCdb_5253 | 36724657 | not found | not found | not found | not found | Arachis hypogaea L. | not found | protoplast | CRISPR-Cas12 |
| PCdb_5254 | 36235360 | not found | not found | not found | not found | Brassica juncea聽(L.) Czern. | not found | protoplast | CRISPR-Cas12 |
| PCdb_5255 | 36220409 | Citrus L.-associated Alternaria gene | Citrus L.-associated Alternaria gene | not found | not found | Citrus 脳 sinensis (L.) Osbeck | not found | protoplast | CRISPR-Cas12 |
| PCdb_5256 | 36216296 | not found | not found | not found | not found | Nicotiana attenuata Torr. ex S.Watson | not found | protoplast | CRISPR-Cas12 |
| PCdb_5257 | 36081307 | not found | not found | not found | not found | Arachis hypogaea L. | not found | protoplast | CRISPR-Cas12 |
| PCdb_5258 | 35786882 | not found | not found | not found | not found | Theobroma cacao L. | not found | protoplast | CRISPR-Cas12 |
| PCdb_5259 | 35635764 | not found | not found | not found | not found | Vicia faba L. | not found | protoplast | CRISPR-Cas12 |
| PCdb_5260 | 35563297 | not found | not found | not found | not found | Citrus 脳 sinensis (L.) Osbeck | not found | protoplast | CRISPR-Cas12 |
| PCdb_5261 | 35474904 | not found | not found | not found | not found | Sambucus nigra L. | not found | protoplast | CRISPR-Cas12 |
| PCdb_5262 | 35333864 | RPS5A | Ribosomal protein S5A | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas12 |
| PCdb_5263 | 35333864 | RPS5A | Ribosomal protein S5A | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas12 |
| PCdb_5264 | 34896246 | not found | not found | not found | not found | Nicotiana attenuata Torr. ex S.Watson | not found | protoplast | CRISPR-Cas12 |
| PCdb_5265 | 34887884 | not found | not found | not found | not found | Prunus persica (L.) Batsch | not found | protoplast | CRISPR-Cas12 |
| PCdb_5266 | 34830457 | not found | not found | not found | not found | Beta vulgaris L. | not found | protoplast | CRISPR-Cas12 |
| PCdb_5267 | 34698496 | SHZD32-1 | SHZD32-1 zinc finger protein (unknown function) | not found | not found | Glycine max (L.) Merr. | not found | protoplast | CRISPR-Cas12 |
| PCdb_5268 | 34558964 | not found | not found | not found | not found | Nicotiana attenuata Torr. ex S.Watson | not found | protoplast | CRISPR-Cas12 |
| PCdb_5269 | 33944602 | not found | not found | not found | not found | Citrus 脳 sinensis (L.) Osbeck | not found | protoplast | CRISPR-Cas12 |
| PCdb_5270 | 33329659 | not found | not found | not found | not found | Populus alba L. | not found | protoplast | CRISPR-Cas12 |
| PCdb_5271 | 32886837 | not found | not found | not found | not found | Malus x domestica Bork. | not found | protoplast | CRISPR-Cas12 |
| PCdb_5272 | 32396228 | not found | not found | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas12 |
| PCdb_5273 | 38079355 | not found | not found | not found | not found | Citrus 脳 sinensis (L.) Osbeck | not found | not found | CRISPR-Cas12 |
| PCdb_5274 | 38079355 | not found | not found | not found | not found | Citrus 脳 sinensis (L.) Osbeck | not found | not found | CRISPR-Cas12 |
| PCdb_5275 | 37622284 | not found | not found | not found | not found | Morinda officinalis How | not found | not found | CRISPR-Cas12 |
| PCdb_5276 | 37579713 | AFB1 | Auxin F-box protein 1, component of auxin receptor complex | not found | not found | Prunus dulcis (Mill.) D.A.Webb | not found | not found | CRISPR-Cas12 |
| PCdb_5277 | 34685941 | not found | not found | not found | not found | Citrus 脳 sinensis (L.) Osbeck | not found | fruit | CRISPR-Cas12 |
| PCdb_5278 | 31478642 | not found | not found | not found | not found | Vitis vinifera L. | not found | calli | CRISPR-Cas12 |
| PCdb_5279 | 36731748 | not found | not found | not found | not found | Solanum lycopersicum L. | not found | protoplast | CRISPRa |
| PCdb_5280 | 36044643 | not found | not found | not found | not found | Nicotiana attenuata Torr. ex S.Watson | not found | protoplast | CRISPRa |
| PCdb_5281 | 35822533 | not found | not found | not found | not found | Nicotiana attenuata Torr. ex S.Watson | not found | protoplast | CRISPRa |
| PCdb_5282 | 35514036 | not found | not found | not found | not found | Nicotiana attenuata Torr. ex S.Watson | not found | protoplast | CRISPRa |
| PCdb_5283 | 33004844 | ABF2 | ABRE-binding factor 2, bZIP transcription factor in ABA signaling | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPRa |
| PCdb_5284 | 30077009 | CRY2 | Cryptochrome 2 (blue-light receptor) | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPRa |
| PCdb_5285 | 30077009 | CIB1 | Cryptochrome-Interacting bHLH 1 (CIB1) | not found | not found | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPRa |
| PCdb_5286 | 36718951 | not found | not found | not found | not found | Cichorium intybus L. | not found | protoplast | CRISPR screen |
| PCdb_5287 | 36257366 | not found | not found | not found | not found | Camptotheca acuminata Decne. | not found | protoplast | CRISPR CasX |
| PCdb_5288 | 33235312 | Det1 | De-etiolated 1 regulator | not found | not found | Solanum lycopersicum L. | not found | protoplast | Base editor,Target-AID |
| PCdb_5289 | 33235312 | DDB1 | DNA damageinding protein 1 | not found | not found | Solanum lycopersicum L. | not found | protoplast | Base editor,Target-AID |
| PCdb_5290 | 37723203 | not found | not found | not found | not found | Nicotiana tabacum L. | not found | not found | Base editor,CRISPR-Cas12 |
| PCdb_5291 | 37286962 | not found | not found | not found | not found | Nicotiana attenuata Torr. ex S.Watson | not found | protoplast | Base editor |
| PCdb_5292 | 36739566 | not found | not found | not found | not found | Setaria italica (L.) P.Beauv. | not found | protoplast | Base editor |
| PCdb_5293 | 36606401 | not found | not found | not found | not found | Physcomitrella patens (Hedw.) Bruch & Schimp. | not found | protoplast | Base editor |
| PCdb_5294 | 34695289 | LOC544055 | Hypothetical protein LOC544055 [Source: NCBI] | not found | not found | Solanum lycopersicum L. | not found | protoplast | Base editor |
| PCdb_5295 | 34695289 | lin5 | lin-5 (spindle positioning protein required for asymmetric cell division) [Source: WormBase] | not found | not found | Solanum lycopersicum L. | not found | protoplast | Base editor |
| PCdb_5296 | 34669232 | not found | not found | not found | not found | Solanum lycopersicum L. | not found | protoplast | Base editor |
| PCdb_5297 | 33742755 | not found | not found | not found | not found | Populus sp. | not found | protoplast | Base editor |
| PCdb_5298 | 32883370 | not found | not found | not found | not found | Fragaria vesca L. | not found | protoplast | Base editor |
| PCdb_5299 | 37719272 | not found | not found | not found | not found | Citrullus lanatus (Thunb.) Matsum. & Nakai | not found | not found | Base editor |
| PCdb_5300 | 26891616 | BADH2 | Betaine aldehyde dehydrogenase (BADH2) | NGCAGATCTTGCAGAATCCT | not found | Oryza sativa L. | not found | leaf | CRISPR-Cas9 |
| PCdb_5301 | 26891616 | AtCHLI1 | Magnesium chelatase subunit I (CHLI) | NCCCCCATTTGCTTCAGGCC | not found | Oryza sativa L. | not found | leaf | CRISPR-Cas9 |
| PCdb_5302 | 26891616 | AtMRS2-2 | Magnesium transporter (MRS2) | NACAGGGTAATAGAGATAAA | not found | Oryza sativa L. | not found | leaf | CRISPR-Cas9 |
| PCdb_5303 | 29972722 | gl2 | glabra2 (epidermal cell fate regulator) [Source: TAIR] | GUCACAGAUCACAAACUUCAAAU | not found | Zea mays L. | 5-17% | embryo | CRISPR-Cas12 |
| PCdb_5304 | 28640964 | tb1a | Teosinte branched1a (tb1a, lateral branching) | GUACCUGAAUGGCGAAAUGG | not found | Panicum virgatum L. | 0.955 | calli | CRISPR-Cas9 |
| PCdb_5305 | 28640964 | tb1b | Teosinte branched1b (tb1b, lateral branching) | GUACCUGAAUGGCGAAAUGG | not found | Panicum virgatum L. | 0.11 | calli | CRISPR-Cas9 |
| PCdb_5306 | 34055482 | AT5G18360 | Pentatricopeptide repeat protein (AT5G18360, RNA editing) | GTTTGTATATCCGTGTACGT | not found | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5307 | 32537560 | ObDMR 1 | Downy mildew resistance 1 susceptibility factor (DMR1) | GTTTCCATTTCCAACATCAC | not found | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5308 | 0 | Solyc06g076910(LRRXII-1) | Leucine-rich repeat receptor-like kinase (subfamily XII-1) | GTTTCAGTGAACTCTCTGAC | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5309 | 0 | Solyc06g071810(SOBIR) | SOBIR1-type receptor-like kinase | GTTTATAGAGCAGAGCTACC | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5310 | 31370789 | 伪-gliadins | Alpha-gliadin storage protein | GTTGTGGTCGAAATGGTTG | not found | Triticum aestivum L. | 0.196 | embryo | CRISPR-Cas9 |
| PCdb_5311 | 0 | Solyc05g007510(RDRP1) | RNA-dependent RNA polymerase 1 | GTTGTGCTCCATCGTCCATA | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5312 | 34371684 | Ta-eIF4E | Eukaryotic initiation factor 4E | GTTGTCGAACCAGAAGGTCC | not found | Triticum aestivum L. | not found | embryo | CRISPR-Cas9 |
| PCdb_5313 | 0 | Solyc01g099520(RALF2) | Rapid alkalinization factor 2 peptide hormone | GTTGTAGTAGGAAGCTCCA | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5314 | 26891616 | PDS | Phytoene desaturase (carotenoid biosynthesis) | GTTGGTCTTTGCTCCTGCAG | not found | Oryza sativa L. | not found | leaf | CRISPR-Cas9 |
| PCdb_5315 | 0 | Solyc11g069220(MLO16) | MLO family protein (MLO16) | GTTGGAGCAAACGCCGACGT | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5316 | 0 | Solyc02g091840 | Tomato NAC transcription factor (Solyc02g091840, development regulation) | GTTGCTGTTAACCAGTTTAC | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5317 | 26891616 | AtFLS2 | Flagellin receptor kinase (FLS2) | GTTGCTCACGTAAGCGATTT | not found | Oryza sativa L. | not found | leaf | CRISPR-Cas9 |
| PCdb_5318 | 0 | Solyc02g077040(Cathepsin B2) | Cathepsin B2 cysteine protease | GTTGCGGGAAGTTACTATAA | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5319 | 31033104 | SBE1 | Starch branching enzyme I (SBE1, amylopectin biosynthesis) | GTTGCATAGTCTATCGTGGAA | not found | Solanum tuberosum L. | 0.67 | protoplast | not found |
| PCdb_5320 | 37017106 | ZmPLA1 | Phospholipase A1 (ZmPLA1, lipid metabolism) | GTTGCAGGAGCTGGACGGACCGG | not found | Zea mays L. | not found | immature embryos | not found |
| PCdb_5321 | 0 | Solyc05g009500(Peptide Transporter 3) | Oligopeptide transporter 3 | GTTGAGCGTATGCTGTGATC | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5322 | 35326106 | The E3 Ubiquitin Ligase Gene Sl1 | Is Critical for Cadmium Tolerance | GTTGAACTTGGAGCAATGAT | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5323 | 34055482 | AT5G45210 | CBL-interacting protein kinase (AT5G45210, calcium signaling) | GTTGAAAGCTAAGTGGAGGCC | not found | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5324 | 34055482 | AT5G45210 | CBL-interacting protein kinase (AT5G45210, calcium signaling) | GTTCTTTAGCCGATCCGTGTG | not found | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5325 | 32362750 | not found | not found | GTTCCAGCTCATTTCTGGGCAG | not found | Oryza sativa L. | not found | protoplast | not found |
| PCdb_5326 | 0 | Solyc11g010470(TFT1) | Trehalose-6-phosphate phosphatase (TFT1) | GTTCACTTCGAGCAGCGTGG | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5327 | 30796544 | Lhcb 1 | Light-harvesting chlorophyll a/b-binding protein 1 | GTTATATAATGCTTGATGGATGG | not found | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5328 | 0 | Solyc09g075820(STP13) | Sugar transporter STP13 | GTTATACCTAGCTGGTTTAA | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5329 | 0 | Solyc09g014720(Wak1) | Wall鈥恆ssociated kinase 1 | GTTAAGATTAGCATAAAACA | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5330 | 0 | Solyc01g067400(PBL-T2) | PBS1-like kinase T2 | GTTAAACAGCTTGATCGCAA | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5331 | 36743495 | CpSRP43C | Chloroplast signal recognition particle 43 kDa subunit | gtgtgTTCGGCGTCGACGTTCTCCG | not found | Oryza sativa L. | not found | leaf | CRISPR-Cas9 |
| PCdb_5332 | 36743495 | CpSRP43 | Photosynthesis in rice | gtgtgTTCGGCGTCGACGTTCTCCG | not found | Panicum miliaceum L. | not found | leaf | CRISPR-Cas9 |
| PCdb_5333 | 36743495 | CpSRP54a N | Chloroplast signal recognition particle 54 subunit a (CpSRP54a) | gtgtgTCTTATAAGAGGAGTCCGAC | not found | Oryza sativa L. | not found | leaf | CRISPR-Cas9 |
| PCdb_5334 | 36743495 | CpSRP54a | Photosynthesis in rice | gtgtgTCTTATAAGAGGAGTCCGAC | not found | Panicum miliaceum L. | not found | leaf | CRISPR-Cas9 |
| PCdb_5335 | 36743495 | CpSRP54a | Chloroplast signal recognition particle 54 kDa alpha subunit | gtgtgTCTTATAAGAGGAGTCCGAC | not found | Oryza sativa L. | not found | leaf | CRISPR-Cas9 |
| PCdb_5336 | 36743495 | CpSRP54a | Photosynthesis in rice | gtgtgTCTTATAAGAGGAGTCCGAC | not found | Panicum miliaceum L. | not found | leaf | CRISPR-Cas9 |
| PCdb_5337 | 36743495 | CpSRP54b N | Chloroplast signal recognition particle 54 subunit b (CpSRP54b) | gtgtgTCCCCGCAGCTTGTTCCACG | not found | Oryza sativa L. | not found | leaf | CRISPR-Cas9 |
| PCdb_5338 | 36743495 | CpSRP54b | Photosynthesis in rice | gtgtgTCCCCGCAGCTTGTTCCACG | not found | Panicum miliaceum L. | not found | leaf | CRISPR-Cas9 |
| PCdb_5339 | 36743495 | CpSRP54b | Chloroplast signal recognition particle 54 subunit b (CpSRP54b) | gtgtgGTAGGCACTGATGTGATTCG | not found | Oryza sativa L. | not found | leaf | CRISPR-Cas9 |
| PCdb_5340 | 36743495 | CpSRP54b | Photosynthesis in rice | gtgtgGTAGGCACTGATGTGATTCG | not found | Panicum miliaceum L. | not found | leaf | CRISPR-Cas9 |
| PCdb_5341 | 36743495 | CpSRP54a C | Chloroplast signal recognition particle 54 subunit a (CpSRP54a) | gtgtgGCTCTTCTGATATCCCGCAT | not found | Oryza sativa L. | not found | leaf | CRISPR-Cas9 |
| PCdb_5342 | 36743495 | CpSRP54a | Photosynthesis in rice | gtgtgGCTCTTCTGATATCCCGCAT | not found | Panicum miliaceum L. | not found | leaf | CRISPR-Cas9 |
| PCdb_5343 | 36743495 | CpSRP54a | Chloroplast signal recognition particle 54 kDa alpha subunit | gtgtgGCCACGCAGCTTGTTCCAGG | not found | Oryza sativa L. | not found | leaf | CRISPR-Cas9 |
| PCdb_5344 | 36743495 | CpSRP54a | Photosynthesis in rice | gtgtgGCCACGCAGCTTGTTCCAGG | not found | Panicum miliaceum L. | not found | leaf | CRISPR-Cas9 |
| PCdb_5345 | 36743495 | CpSRP54a C | Chloroplast signal recognition particle 54 subunit a (CpSRP54a) | gtgtgGCATTTGTAGATATGATGGT | not found | Oryza sativa L. | not found | leaf | CRISPR-Cas9 |
| PCdb_5346 | 36743495 | CpSRP54a | Photosynthesis in rice | gtgtgGCATTTGTAGATATGATGGT | not found | Panicum miliaceum L. | not found | leaf | CRISPR-Cas9 |
| PCdb_5347 | 0 | Solyc08g074760 | Tomato polygalacturonase (Solyc08g074760, fruit softening enzyme) | GTGTGGCAAACAAGTTAGTC | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5348 | 36743495 | CpSRP43 | Photosynthesis in rice | gtgtgCGAGCCTTCGTGGATCCCGG | not found | Panicum miliaceum L. | not found | leaf | CRISPR-Cas9 |
| PCdb_5349 | 36743495 | CpSRP54b N | Chloroplast signal recognition particle 54 subunit b (CpSRP54b) | gtgtgCCGCTGGTACTGGAAAGCGA | not found | Oryza sativa L. | not found | leaf | CRISPR-Cas9 |
| PCdb_5350 | 36743495 | CpSRP54b C | Chloroplast signal recognition particle 54 subunit b (CpSRP54b) | gtgtgCCGCTGGTACTGGAAAGCGA | not found | Oryza sativa L. | not found | leaf | CRISPR-Cas9 |
| PCdb_5351 | 36743495 | CpSRP54b | Photosynthesis in rice | gtgtgCCGCTGGTACTGGAAAGCGA | not found | Panicum miliaceum L. | not found | leaf | CRISPR-Cas9 |
| PCdb_5352 | 36743495 | CpSRP54b | Photosynthesis in rice | gtgtgCCGCTGGTACTGGAAAGCGA | not found | Panicum miliaceum L. | not found | leaf | CRISPR-Cas9 |
| PCdb_5353 | 36743495 | CpSRP43N | Chloroplast signal recognition particle 43 kDa subunit | gtgtgCCACTCGACGAGGTACTCCG | not found | Oryza sativa L. | not found | leaf | CRISPR-Cas9 |
| PCdb_5354 | 36743495 | CpSRP43 | Photosynthesis in rice | gtgtgCCACTCGACGAGGTACTCCG | not found | Panicum miliaceum L. | not found | leaf | CRISPR-Cas9 |
| PCdb_5355 | 26891616 | GmGT4 | Trihelix transcription factor (GT-4) | GTGTGAATGTTTATTGTGGT | not found | Oryza sativa L. | not found | leaf | CRISPR-Cas9 |
| PCdb_5356 | 34055482 | AT5G46270 | Glycosyl hydrolase family protein (AT5G46270, cell wall metabolism) | GTGTCGGTGGCAACATCTGT | not found | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5357 | 26891616 | MPK6 | Mitogen-activated protein kinase 6, stress signaling and development regulator | GTGTCCGCTTGGCATCGATA | not found | Oryza sativa L. | not found | leaf | CRISPR-Cas9 |
| PCdb_5358 | 26891616 | Os10g0548600 | Hypothetical protein [Source: RGAP] | GTGGTGGCAGCGCTGGTCGG | not found | Oryza sativa L. | not found | leaf | CRISPR-Cas9 |
| PCdb_5359 | 34055482 | AT3G25510 | Peroxidase family protein (oxidative stress response) | GTGGTGGAGCCCTACATGAA | not found | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5360 | 0 | Solyc10g047320(NRC2) | NRC2 (Solyc10g047320, NLR immune receptor) | GTGGTCAACAATACTCGATT | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5361 | 37816147 | RIN | Ripening inhibitor (RIN) transcription factor | GTGGTATCTCTCCAATGTCT | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5362 | 36743495 | CpSRP54a | Chloroplast signal recognition particle subunit 54a (CpSRP54a) | gtggGCCACGCAGCTTGTTCCAGG | not found | Oryza sativa L. | not found | leaf | CRISPR-Cas9 |
| PCdb_5363 | 33135782 | not found | not found | GTGGCACTCGCTCCCGGACG | not found | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5364 | 34055482 | AT1G72890 | Circular RNA (potential regulatory function) | GTGGATGTGCCACTTGTGTA | not found | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5365 | 26891616 | NtPDR6 | Pleiotropic drug resistance protein 6 (ABC transporter family) [Source: UniProt] | GTGGAATCATCAAACCAGGA | not found | Oryza sativa L. | not found | leaf | CRISPR-Cas9 |
| PCdb_5366 | 34782773 | HPPD | conferred herbicide tolerance in transgenic rice to FCD and bipyrazone | GTGCTGGTTGCCTTGGCTGC | not found | Oryza sativa L. | not found | protoplast | not found |
| PCdb_5367 | 35696903 | BB | BIG BROTHER E3 ubiquitin ligase (organ size regulator) | GTGCTGCAGTTGTGAACGAA | not found | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5368 | 36743495 | CpSRP54b N | Chloroplast signal recognition particle 54 subunit b (CpSRP54b) | gtgCCGCTGGTACTGGAAAGCGA | not found | Oryza sativa L. | not found | leaf | CRISPR-Cas9 |
| PCdb_5369 | 36743495 | CpSRP54b C | Chloroplast signal recognition particle 54 subunit b (CpSRP54b) | gtgCCGCTGGTACTGGAAAGCGA | not found | Oryza sativa L. | not found | leaf | CRISPR-Cas9 |
| PCdb_5370 | 0 | Solyc08g067360(WRKY9b) | WRKY transcription factor 9b | GTGATTTCTCTTGGCCTCTT | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5371 | 32537560 | ObDMR 1 | Downy mildew resistance 1 susceptibility factor (DMR1) | GTGATGTTGGAAATGGAAA | not found | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5372 | 26891616 | AtRACK1b | Receptor for activated C kinase (RACK1) | GTGATCGTACGATTAAGCTT | not found | Oryza sativa L. | not found | leaf | CRISPR-Cas9 |
| PCdb_5373 | 34055482 | AT1G17615 | Dense and erect panicle 1 (panicle architecture control) | GTGAGTTGTCATTGGTAACG | not found | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5374 | 31050154 | not found | not found | GTGAGGGTGATGGGATTGAC | not found | Zea mays L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5375 | 37816147 | PIF4 | Phytochrome-interacting factor 4 | GTGAGGAAGAAGCTCTTGCA | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5376 | 33629353 | PdGNC | confers drought tolerance | GTGACAGATCAATCACATA | not found | Populus sp. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5377 | 0 | Solyc02g090380(NRG1) | Solyc02g090380 (NRG1, N requirement gene 1 for pathogen resistance) | GTGAAGTTCTGCCAGATACA | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5378 | 31480315 | TaDA2 | Wheat ubiquitin receptor DA2 (growth regulator) | GTCTTACTTGTGGCTCGAGT | not found | Triticum aestivum L. | 0.312 | calli | CRISPR-Cas9 |
| PCdb_5379 | 34055482 | AT5G66900 | MYB family transcription factor (AT5G66900, development) | GTCTGCATCATACGGTAAAG | not found | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5380 | 34055482 | AT1G63730 | Circular RNA (potential regulatory function) | GTCTGATAAACTGGACAGTG | not found | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5381 | 26891616 | Waxy | Granule-bound starch synthase I (Waxy) | GTCTGAATCTTTTTCACTGC | not found | Oryza sativa L. | not found | leaf | CRISPR-Cas9 |
| PCdb_5382 | 34055482 | AT1G12280 | Glutamine synthetase 1 (nitrogen metabolism) | GTCTCATTACAGGATCTGTG | not found | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5383 | 0 | Solyc10g085990(Mai5) | Mai5 | GTCTACGAATATATGCCATT | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5384 | 26891616 | LOC_Os03g27280 | LOC_Os03g27280 (hypothetical) | GTCGTTGAGGGGATATGGAG | not found | Oryza sativa L. | not found | leaf | CRISPR-Cas9 |
| PCdb_5385 | 36072839 | MIR160a | MicroRNA 160a (auxin response regulation) [Source: miRBase] | GTCGTGTACACGTATATGCC | not found | Solanum tuberosum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5386 | 26891616 | Os07g0411300 | Hypothetical protein with no known domains [Source: RGAP] | GTCGTCCATGGCCCCCAACC | not found | Oryza sativa L. | not found | leaf | CRISPR-Cas9 |
| PCdb_5387 | 28955376 | OsMIR820c | Rice microRNA 820c, regulates gene expression through mRNA silencing | GTCGGCCTCGTGGATGGACC | not found | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5388 | 28955376 | OsMIR820b | Rice microRNA 820b, regulates gene expression through mRNA silencing | GTCGGCCTCGTGGATGGACC | not found | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5389 | 28955376 | OsMIR820a | Rice microRNA 820a, regulates gene expression through mRNA silencing | GTCGGCCTCGTGGATGGACC | not found | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5390 | 26891616 | OsFTL1 | Flowering locus T-like protein 1 (florigen signal) | GTCGGCCGGCAGCCGGATGA | not found | Oryza sativa L. | not found | leaf | CRISPR-Cas9 |
| PCdb_5391 | 34055482 | AT1G63750 | Circular RNA (potential regulatory function) | GTCGCACTCTCTATAATGGC | not found | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5392 | 26891616 | LOC_Os04g31290 | LOC_Os04g31290 (hypothetical) | GTCGATCATCGCCGACGCGG | not found | Oryza sativa L. | not found | leaf | CRISPR-Cas9 |
| PCdb_5393 | 0 | Solyc04g007070(NRC4a) | Solyc04g007070 (NRC4a, NB-LRR disease resistance protein helper) | GTCGATATTATCCCCGTGG | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5394 | 35313160 | not found | not found | GTCGAGGATTCTTGCCTCTT | not found | Nicotiana tabacum L. | not found | Vacuoles | CRISPR-Cas9 |
| PCdb_5395 | 32620100 | not found | not found | GTCGACGCAGGGGTTCCAGT | not found | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5396 | 35168613 | GmPDS11g | Glycine max phytoene desaturase 11g (carotenoid biosynthesis) [Source: SoyBase] | GTCCTTCCCGCCCCATTAAA | not found | Glycine max (L.) Merr. | not found | leaf | CRISPR-Cas9 |
| PCdb_5397 | 33772993 | ZmTGA10 | TGA transcription factor 10 (jasmonic acid signaling) | GTCCTGTCCCCGGCGCCGG | not found | Zea mays L. | not found | anther | CRISPR-Cas9 |
| PCdb_5398 | 33772993 | ZmMYB84 | MYB transcription factor 84 (ZmMYB84, secondary metabolism) | GTCCTGTCCCCGGCGCCGG | not found | Zea mays L. | not found | anther | CRISPR-Cas9 |
| PCdb_5399 | 34055482 | AT1G72890 | Circular RNA (potential regulatory function) | GTCCGTTGATGTTGCGTCGG | not found | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5400 | 30272679 | TaMTL | Wheat MATRILINEAL (phospholipase鈥恖ike haploid induction factor) | GTCCGACCAGGGGCTCTACA | not found | Triticum aestivum L. | 0.32 | protoplast | PBE |
| PCdb_5401 | 36061810 | GmHdz4 | enhances drought tolerance | GTCCGAAAGAAAGGATAGGC | not found | Glycine max (L.) Merr. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5402 | 34055482 | AT3G04220 | LEA protein (dehydration response) | GTCCCACTAACATAATGTCT | not found | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5403 | 0 | Solyc03g117980(RbohB) | NADPH oxidase (respiratory burst oxidase homolog B) | GTCCACAGTGTGAAAACTGC | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5404 | 0 | Solyc05g005960(Peptide Transporter 2) | Oligopeptide transporter 2 | GTCCACAAACACCATTAAAC | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5405 | 34980227 | CaS | Calcium-sensitive protein (generic term; may refer to calcium-binding or calcium-regulated proteins) | GTCCAATTTGGGGCATTTTATTGAACAA | not found | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas13 |
| PCdb_5406 | 37437572 | FLYC | FLYC (Arabidopsis thaliana FLOWERING LOCUS Y COMPLEX, chromatin remodeling complex subunit) [Source: TAIR] | GTCCAAAAGCTTCAGAGTGC | not found | Dionaea muscipula J.Ellis | not found | not found | not found |
| PCdb_5407 | 0 | Solyc02g070910(LRRXII-RLK) | Leucine-rich repeat receptor-like kinase (subfamily XII) | GTCAGCATTCCAATGGAGGT | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5408 | 34055482 | AT5G17680 | GRAS family transcription factor (AT5G17680, root development) | GTCACGCGTCATTGAAAAGT | not found | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5409 | 26891616 | OsFTL4 | Flowering locus T-like protein 4 | GTCACGAGGTAGGGATCCTT | not found | Oryza sativa L. | not found | leaf | CRISPR-Cas9 |
| PCdb_5410 | 0 | Solyc03g123860(PEPR12) | PEP RECEPTOR 12 (leucine-rich repeat receptor-like kinase) | GTCACCTCTTTGAACCTCTC | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5411 | 0 | Solyc06g006070(LRRXII-RLK) | Leucine-rich repeat receptor-like kinase (subfamily XII) | GTCACCACAAAGTGCATCAT | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5412 | 0 | Solyc06g006040(LRRXII-RLK) | Leucine-rich repeat receptor-like kinase (subfamily XII) | GTCACCACAAAGTGCATCAT | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5413 | 34055482 | AT3G04220 | LEA protein (dehydration response) | GTCACACATACCATGAGAAG | not found | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5414 | 0 | Solyc12g009340(Epk1) | Solyc12g009340 (Epk1 kinase) | GTCACAATACACCACACCAT | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5415 | 34055482 | AT5G38850 | Zinc finger protein (AT5G38850, transcriptional regulation) | GTCAATCCTATAGTTTGCTC | not found | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5416 | 34371684 | TaBAK1-2 | BRI1-associated receptor kinase 1 | GTCAAGTTCCCGAGTTCCAA | not found | Triticum aestivum L. | not found | embryo | CRISPR-Cas9 |
| PCdb_5417 | 34055482 | AT5G46470 | Leucine-rich repeat protein kinase (AT5G46470, immune response) | GTCAAGCTTTCACTTGTGATG | not found | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5418 | 34055482 | AT5G46470 | Leucine-rich repeat protein kinase (AT5G46470, immune response) | GTATTGCCGCGATGAATTCTG | not found | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5419 | 0 | Solyc05g005700(ADE ) | Adenine deaminase (ADE) | GTATGATCCACATTGACAGT | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5420 | 35170044 | SlCRCb | SlCRCb (CRISPR-associated complex in Solanum lycopersicum) | GTATCCATTAGCCTCTTGTA | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5421 | 35170044 | SlCRCa | SlCRCa (CRISPR-associated complex in Solanum lycopersicum) | GTATCCAACAACTTCTTGCA | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5422 | 0 | Solyc06g069290 | Tomato ethylene-responsive factor (Solyc06g069290, ripening regulator) | GTATATATTGTTATGTACAA | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5423 | 0 | Solyc01g099520(RALF2) | Rapid alkalinization factor 2 peptide hormone | GTAGCTACCACTGTCGCCGG | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5424 | 31572408 | LCH3 | Leaf color and height regulator 3 (developmental control) | GTAGCGAGAGCGGGTTCGCGC | not found | Oryza sativa L. | not found | callus | CRISPR-Cas9 |
| PCdb_5425 | 34055482 | AT5G63020 | NAC domain transcription factor (AT5G63020, stress response) | GTAGCGACGACTTTAGAGTT | not found | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5426 | 26891616 | MYB5 | MYB transcription factor 5, regulates flavonoid and anthocyanin biosynthesis | GTAGCCCTGCTGTTGAAGAA | not found | Oryza sativa L. | not found | leaf | CRISPR-Cas9 |
| PCdb_5427 | 0 | Solyc03g096190(CORE) | Tomato CORE cold shock protein (Solyc03g096190, stress adaptation) | GTAGCATTTGACAATGTCCC | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5428 | 26891616 | NtPDR6 | Pleiotropic drug resistance protein 6 (ABC transporter family) [Source: UniProt] | GTAGATGCAGAAGCTAGAGT | not found | Oryza sativa L. | not found | leaf | CRISPR-Cas9 |
| PCdb_5429 | 34343415 | LIGULELESS-1 | provides a rapidly scorable phenotype by altering leaf inclination angle | gtagaactgaaggatgtcgt | not found | Hemisorghum C.E.Hubb. ex Bor | not found | protoplast | CRISPR-Cas9 |
| PCdb_5430 | 34943026 | not found | not found | GTACTTGGCTAGTTGTTTAG | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5431 | 0 | Solyc03g111800(SOBIR-like) | SOBIR1-like receptor-like kinase | GTACTCTGTCTCCTGCCATT | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5432 | 34055482 | AT5G45260 | Calmodulin-like protein (AT5G45260, calcium sensing) | GTACTCTAACGCACACCAGTG | not found | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5433 | 35996876 | not found | not found | GTACTACAGTTCCGTATATTGACAGGTGTA | not found | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5434 | 33024447 | TrxH | Thioredoxin H | gtacgtacaagctcacaaag | not found | Zea mays L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5435 | 34055482 | AT2G17050 | Circular RNA (potential regulatory function) | GTACGTAAGCACACGGACGG | not found | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5436 | 31572408 | HHZ(TS3) | Thermosensitive rice line HHZ variant 3 (specific function undefined) | GTACGAGAGCGGGTTCGCGC | not found | Oryza sativa L. | not found | callus | CRISPR-Cas9 |
| PCdb_5437 | 37816147 | MLO1 | Mildew resistance locus O 1 | GTACAAAGTTAATCAAGAAT | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5438 | 30083222 | At3g04220 | Heat shock protein 101 (At3g04220, stress response) | GTAATCATTGACAAAGTAGC | not found | Arabidopsis thaliana (L.) Heynh. | 35-83% | protoplast | not found |
| PCdb_5439 | 36995618 | GmPDS | Phytoene desaturase | GTAAGAAGCTCTTCACCGTTCCA | not found | Glycine max (L.) Merr. | not found | protoplast | CRISPR-Cas12 |
| PCdb_5440 | 37816147 | LOL1 | LATERAL ORGAN LOBES 1 transcription factor | GTAACAGCAGTACCACCTCC | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5441 | 0 | Solyc11g008200(Nodulin-like) | Solyc11g008200 (Nodulin-like protein, potential symbiosis-related function) | GTAAAGTCTTCGCCCCGAGC | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5442 | 29575603 | CAT2 | Catalase 2, hydrogen peroxide-degrading enzyme involved in oxidative stress response | GTAAAGGCAAGATATCTTC | not found | Arabidopsis thaliana (L.) Heynh. | not found | Peroxisomes | CRISPR-Cas9 |
| PCdb_5443 | 35485227 | GmPIN1 | regulates leaf petiole angle and plant architecture in soybean | GTAAACTCCATGTCACTGTG | not found | Glycine max (L.) Merr. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5444 | 0 | Solyc04g082260(Mai1) | MAMP-INDUCED IMMUNE RECEPTOR KINASE Mai1 | GTAAACGCACGAGCTTCTAA | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5445 | 26891616 | LOC_Os10g41490 | LOC_Os10g41490 (hypothetical) | GGTTTCGAGGGGGCCAATGG | not found | Oryza sativa L. | not found | leaf | CRISPR-Cas9 |
| PCdb_5446 | 27918538 | SELF PRUNING | SELF-PRUNING flowering regulator | GGTTTAGAAGTTACTGAGGA | not found | Solanum lycopersicum L. | not found | seed | CRISPR-Cas9 |
| PCdb_5447 | 0 | Solyc06g074350 | Tomato thaumatin-like protein (Solyc06g074350, pathogenesis-related) | GGTTTAGAAGTTACTGAGGA | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5448 | 34884880 | the Wheat Multi-Copy 伪-Gliadin Gene Family | are responsible for bread viscoelastic properties | GGTTGTGATGGAAATGGTTG | not found | Triticum aestivum L. | 0.75 | protoplast | CRISPR-Cas9 |
| PCdb_5449 | 23956122 | not found | not found | GGTTGGAGACCGAGGTCTCG | not found | Oryza sativa L. | not found | protoplast | not found |
| PCdb_5450 | 34055482 | AT5G45050 | F-box protein (AT5G45050, protein degradation) | GGTTCGGACATCCAAACCTG | not found | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5451 | 0 | Solyc03g005820(Permease Transporter ) | Permease transporter (solute carrier) | GGTTCATAATAACGAGTCTG | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5452 | 0 | Solyc08g006320(WRKY11) | WRKY transcription factor 11 | GGTTACTGATGATTCGTCTA | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5453 | 36682886 | GSTU25 | regulate sulfur assimilation and arsenic stress response in Arabidopsis | GGTTAAGCATGCGTAATACGTTG | not found | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5454 | 37816147 | MLO1 | Mildew resistance locus O 1 | GGTGTACCTGTGGTGGAGAC | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5455 | 32549675 | DST | Drought and salt tolerance protein, negative regulator of stomatal closure | GGTGGGCTGCAGTACTACGC | not found | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5456 | 0 | Solyc04g012100(LRRXII-2) | Leucineich repeat receptorike kinase (subfamily XII-2) | GGTGGCGTACCGTACAGACT | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5457 | 36347113 | OsbHLH044 | salt-resistant | GGTGGCATCCAAGGATAACT | not found | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5458 | 33772993 | ZmTGA10 | TGA transcription factor 10 (jasmonic acid signaling) | GGTGCTGCTGGCTCAGCAG | not found | Zea mays L. | not found | anther | CRISPR-Cas9 |
| PCdb_5459 | 33772993 | ZmMYB84 | MYB transcription factor 84 (ZmMYB84, secondary metabolism) | GGTGCTGCTGGCTCAGCAG | not found | Zea mays L. | not found | anther | CRISPR-Cas9 |
| PCdb_5460 | 0 | Solyc09g015170 | Tomato stress-responsive protein (Solyc09g015170) | GGTCTTGGAGCTTGTGCTGG | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5461 | 34371684 | Ta-eIF(iso)4E | Eukaryotic initiation factor 4E isoform | GGTCTGGATGTCGTACCAGA | not found | Triticum aestivum L. | not found | embryo | CRISPR-Cas9 |
| PCdb_5462 | 32555281 | DMR6 | 2-oxoglutarate Fe(II) oxygenase DMR6 (pathogen susceptibility) | GGTCTCCAGATCTTGATCGA | not found | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5463 | 0 | Solyc06g006040(LRRXII-RLK) | Leucine-rich repeat receptor-like kinase (subfamily XII) | GGTCTAATTTCAAAATCACT | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5464 | 34055482 | AT3G14460 | Peroxidase family protein (oxidative stress response) | GGTCGAACCGAGAGATTGGC | not found | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5465 | 33015858 | nhx1 | Vacuolar Na+/H+ antiporter 1 (ion homeostasis) [Source: RAP-DB] | GGTCCTCGGCCACCTCCTCG | not found | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5466 | 29959585 | Ms45 | Male sterility 45 protein (pollen development) | GGTCATGCAGCGCTGGCCGA | not found | Triticum aestivum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5467 | 0 | Solyc08g075600(LRRXII-RLK) | Leucine鈥恟ich repeat receptor鈥恖ike kinase | GGTCAGATACCTAGTACAAT | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5468 | 0 | Solyc03g093560(ERF5) | Ethylene-responsive transcription factor 5 | GGTATTGCTACGTTCAGAGA | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5469 | 34055482 | AT4G26090 | Heat shock protein (stress response) | GGTACAGGTGACGTCAGCCG | not found | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5470 | 24918588 | GFP | GFP (Green Fluorescent Protein, Aequorea victoria, transformation control) [Source: Addgene] | GGTACACGTGGAACTTCGCG | not found | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5471 | 34111225 | ObDMR6 | Ornithogalum DMR6-like protein (pathogen susceptibility) | GGTAATCCGAAAGTCAGATC | not found | Arabidopsis thaliana (L.) Heynh. | 0.96 | leaf | not found |
| PCdb_5472 | 0 | Solyc10g011910(WRKY25) | WRKY transcription factor 25 (Solyc10g011910, stress response) | GGTAAAACTGATGTCGCCGG | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5473 | 0 | Solyc08g081940(APR219) | Aldose epimeraseelated protein (APR219) | GGGTTGTTTCTGTTGTCGCA | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5474 | 36061810 | GmHdz4 | Glycine max homeodomain leucine zipper 4 (developmental regulation) [Source: SoyBase] | GGGTTGGTCCGAAAGAAAGGATAGGC | not found | Glycine max (L.) Merr. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5475 | 34750721 | BEI | Bacterial extracellular invertase, involved in carbohydrate metabolism | GGGTTGATCGTATTCCCGCA | not found | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5476 | 36873055 | not found | not found | GGGTATGGTGGTGCAATGGG | not found | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5477 | 36873055 | not found | not found | GGGTATGGTGGTGCAATGGG | not found | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5478 | 26891616 | Os06g0275000-B | DUF640 domain-containing protein (isoform B) [Source: RGAP] | GGGTATAGTACCAGACAGCA | not found | Oryza sativa L. | not found | leaf | CRISPR-Cas9 |
| PCdb_5479 | 34750721 | BEI | Bacterial extracellular invertase, involved in carbohydrate metabolism | GGGGAGGTGATGATCCCCGA | not found | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5480 | 34055482 | AT3G25510 | Peroxidase family protein (oxidative stress response) | GGGCTTATTATAGTACTGCT | not found | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5481 | 26891616 | Os10g0413900-B | Expressed protein of unknown function (isoform B) [Source: RGAP] | GGGCGAGGGGATGGCGGCAC | not found | Oryza sativa L. | not found | leaf | CRISPR-Cas9 |
| PCdb_5482 | 0 | Solyc08g066840(Aquaporin transporter 3) | Aquaporin water channel 3 | GGGCCAATATTATGGCTGGT | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5483 | 0 | Solyc00g174340?(PR1b) | Pathogenesis-related protein 1b | GGGCACGTTGCAACAACGGA | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5484 | 31033104 | SBE2 | Starch branching enzyme II (SBE2, amylopectin biosynthesis) | GGGATTCACTGGGAACTACG | not found | Solanum tuberosum L. | 0.67 | protoplast | not found |
| PCdb_5485 | 32887261 | IPK | Inositol polyphosphate kinase | GGGATCCGTCTCCTTCTCCC | not found | Zea mays L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5486 | 26891616 | ZmIPK1A | Inositol pentakisphosphate 2-kinase (ZmIPK1A) | GGGAGAAGGAGACGGATCCC | not found | Oryza sativa L. | not found | leaf | CRISPR-Cas9 |
| PCdb_5487 | 31344311 | TaPLA | Phospholipase A1 (haploid induction factor) | GGGACGTCAACCGCTTC | not found | Zea mays L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5488 | 33772993 | ZmMYB33 | MYB transcription factor 33 (ZmMYB33, developmental regulation) | GGGAAGAGCCAACAACCAT | not found | Zea mays L. | not found | anther | CRISPR-Cas9 |
| PCdb_5489 | 26891616 | OsFTL10 | Flowering locus T-like protein 10 | GGCTTGCTTACAACTGCAGA | not found | Oryza sativa L. | not found | leaf | CRISPR-Cas9 |
| PCdb_5490 | 0 | Solyc09g098290 | Tomato protein Solyc09g098290 (uncharacterized) | GGCTTATCAGGGAATATCCC | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5491 | 34371684 | Ta-eIF(iso)4E | Eukaryotic initiation factor 4E isoform | GGCTGGGGTAGAACCAAAGT | not found | Triticum aestivum L. | not found | embryo | CRISPR-Cas9 |
| PCdb_5492 | 35046975 | 0sXLG 1 | Extra-large G protein alpha subunit 1 | GGCTGCGCGGTGGGAATCGC | not found | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5493 | 0 | Solyc07g066260(Pic1) | Chloroplast iron transporter (PIC1) | GGCTGCATCATATTCCCGGA | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5494 | 34055482 | AT5G45250 | Calcium-binding EF-hand protein (AT5G45250, calcium signaling) | GGCTGATTAGCTGAACTGTG | not found | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5495 | 34055482 | AT1G53350 | Circular RNA (potential regulatory function) | GGCTGAGGCAGTTGTATCATT | not found | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5496 | 26891616 | LOC_Os07g35870 | LOC_Os07g35870 (hypothetical) | GGCTCTGTGGACTGTGAACA | not found | Oryza sativa L. | not found | leaf | CRISPR-Cas9 |
| PCdb_5497 | 26891616 | Os02g0459600 | Glycosyltransferase family 61 protein [Source: RAP-DB] | GGCTATTGGATCGTGCACCA | not found | Oryza sativa L. | not found | leaf | CRISPR-Cas9 |
| PCdb_5498 | 0 | Solyc06g005880(LRRXII-RLK) | Leucine-rich repeat receptor-like kinase (subfamily XII) | GGCTACAGCTTGTTAATAGT | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5499 | 34055482 | AT1G50180 | Phytoene desaturase (carotenoid biosynthesis) | GGCGTCCTATGTTTCAACAA | not found | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5500 | 37446265 | SRL1 | SHORT ROOT LENGTH 1 (SRL1, root development) | GGCGGTTTGACAAGCTACGC | not found | Oryza sativa L. | not found | not found | not found |
| PCdb_5501 | 35180223 | not found | not found | GGCGGGCAACACTTACCGCT | not found | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5502 | 26891616 | MPK2 | Mitogen-activated protein kinase 2, stress response and developmental signaling | GGCGGCGGCCATGGCCATCA | not found | Oryza sativa L. | not found | leaf | CRISPR-Cas9 |
| PCdb_5503 | 26891616 | OsGSTU | Glutathione S-transferase U family member | GGCGGCCGCTCTTCCGCGGG | not found | Oryza sativa L. | not found | leaf | CRISPR-Cas9 |
| PCdb_5504 | 0 | Solyc10g085120(LRRXII-RLK) | LRR receptor-like kinase XII (Solyc10g085120, pathogen recognition) | GGCGGCCAACCATCCACACT | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5505 | 0 | Solyc06g074820(Aquaporin transporter 2) | Aquaporin water channel | GGCGCTTAAAGCGGCCTTGG | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5506 | 0 | Solyc06g074820(Aquaporin transporter 2) | Aquaporin water channel | GGCGCTTAAAGCGGCCTTGG | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5507 | 26891616 | Os07g0625500-B | Putative transposase-related protein (isoform B) [Source: RAP-DB] | GGCGCTCGCCAAGTTCGACA | not found | Oryza sativa L. | not found | leaf | CRISPR-Cas9 |
| PCdb_5508 | 26891616 | MYB1 | MYB transcription factor 1, involved in secondary metabolism regulation | GGCGCGCGTCGAGGCGTTGG | not found | Oryza sativa L. | not found | leaf | CRISPR-Cas9 |
| PCdb_5509 | 24854982 | OsMYB1 | Oryza sativa MYB1 transcription factor (OsMYB1, stress response) | GGCGCGCGTCGAGGCGTTGG | not found | Oryza sativa L. | 21.1-66.7% | embryo | CRISPR-Cas9 |
| PCdb_5510 | 28913802 | the wheat phytoene desaturase gene | Wheat phytoene desaturase | GGCGCCCTTAAATGGAGTGT | not found | Triticum aestivum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5511 | 26891616 | SPP | Sucrose-phosphatase | GGCGATTGGGAGCCTCGGCG | not found | Oryza sativa L. | not found | leaf | CRISPR-Cas9 |
| PCdb_5512 | 24854982 | OsSPP | Oryza sativa sucrose phosphate phosphatase (OsSPP, sucrose metabolism) | GGCGATTGGGAGCCTCGGCG | not found | Oryza sativa L. | 21.1-66.7% | embryo | CRISPR-Cas9 |
| PCdb_5513 | 26891616 | LOC_Os05g38140 | LOC_Os05g38140 (hypothetical) | GGCGAGACAGGCTCAATGAA | not found | Oryza sativa L. | not found | leaf | CRISPR-Cas9 |
| PCdb_5514 | 37367609 | FGSG | Fusarium gene locus prefix | GGCGACTACACCGTCACCTC | not found | Triticum aestivum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5515 | 35696903 | DA1 | Ubiquitin receptor DA1 (cell proliferation regulator) | GGCCTGCAGAAGACACAGCA | not found | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5516 | 31004275 | not found | not found | GGCCGCCGGTGAGGGCGAC | not found | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5517 | 31645950 | TGase | Transglutaminase | GGCCCTTCAGTCTCATTACC | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5518 | 0 | Solyc09g008010(Bti9-interactor) | Bti9鈥恑nteractor (not found) | GGCCACAGTAAAGACTGGTG | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5519 | 26891616 | GmMET1 | DNA methyltransferase (MET1) | GGCATGGTGCGGTCTATGAG | not found | Oryza sativa L. | not found | leaf | CRISPR-Cas9 |
| PCdb_5520 | 0 | Solyc06g071280(EDS1) | Enhanced Disease Susceptibility 1 (lipase-like immune regulator) | GGCACTGATGAAGTAGCTA | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5521 | 34685581 | KNR6 | KERNEL NUMBER6 (cytokinin oxidase/dehydrogenase) [Source: MaizeGDB] | GGCAATAAGATTGGTGAGGG | not found | Zea mays L. | not found | Golgi Apparatus | CRISPR-Cas9 |
| PCdb_5522 | 37429191 | FC19 | FC19 (Oryza sativa fatty acid hydroxylase, fatty acid metabolism) [Source: Gramene] | GGCAAGCTGCTGAAGAAGGATCCT | not found | Oryza sativa L. | not found | shoot | CRISPR-Cas9 |
| PCdb_5523 | 0 | Solyc04g009440(NAC1) | NAM/NAC family transcription factor 1 | GGCAACCGGAGCTGATAAAC | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5524 | 31134125 | OsALS | Acetolactate synthase involved in branched-chain amino acid biosynthesis [Source: RiceWiki] | GGCAACCCGGAATGTGAGAG | not found | Oryza sativa L. | 0.1 | calli | CBE |
| PCdb_5525 | 0 | Solyc11g006000(MKKK80 (alpha)) | MKKK80 (alpha-type MAPKKK) | GGCAAAGCAGAAGGACTGGG | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5526 | 0 | Solyc02g070890(LRRXII-RLK) | Leucine-rich repeat receptor-like kinase (subfamily XII) | GGATTTTGCCCAGATGACAA | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5527 | 0 | Solyc03g123860(PEPR12) | PEP RECEPTOR 12 (leucine-rich repeat receptor-like kinase) | GGATTGGTGTACCCTCTTCT | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5528 | 26891616 | EPSPS | 5-Enolpyruvylshikimate-3-phosphate synthase (EPSPS) | GGATGTTCACTACATGCTTG | not found | Oryza sativa L. | not found | leaf | CRISPR-Cas9 |
| PCdb_5529 | 24854982 | OsEPSPS | Oryza sativa 5-enolpyruvylshikimate-3-phosphate synthase (OsEPSPS, aromatic amino acid biosynthesis) | GGATGTTCACTACATGCTTG | not found | Oryza sativa L. | 21.1-66.7% | embryo | CRISPR-Cas9 |
| PCdb_5530 | 0 | Solyc04g009440(NAC1) | NAM/NAC family transcription factor 1 | GGATGGAATCTGAATCCCGC | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5531 | 28955376 | OSMIR408 | MicroRNA 408 | GGATGAGGCAGAGCATGGGA | not found | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5532 | 37340958 | OsMADS5 | restricting cell proliferation of root meristem under ammonium supply | GGATCGAGAACAAGATAAGC | not found | Oryza sativa L. | not found | root | CRISPR-Cas9 |
| PCdb_5533 | 0 | Solyc08g075550(AOX) | Alternative oxidase | GGATCCTCCCAAAATCTCCA | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5534 | 37816147 | SdelA | Suppressor of deltA protein | GGATCAGCTATTGAAAGAAG | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5535 | 28640964 | tb1a | Teosinte branched1a (tb1a, lateral branching) | GGAGUCGAUGGUCCAGCCAG | not found | Panicum virgatum L. | 0.955 | calli | CRISPR-Cas9 |
| PCdb_5536 | 28640964 | tb1b | Teosinte branched1b (tb1b, lateral branching) | GGAGUCGAUGGUCCAGCCAG | not found | Panicum virgatum L. | 0.11 | calli | CRISPR-Cas9 |
| PCdb_5537 | 0 | Solyc12g098100 | Tomato protein Solyc12g098100 (unknown function) | GGAGTATATGACTCAAGAAC | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5538 | 0 | Solyc07g049180(Bti9) | Disease resistance NLR receptor (Bti9) | GGAGTAGTCTTGCTGTTGGC | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5539 | 34055482 | AT1G63730 | Circular RNA (potential regulatory function) | GGAGGTGACCGTCCGTCGTG | not found | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5540 | 26891616 | MSH1 | MutS homolog 1, maintains mitochondrial and plastid genome stability | GGAGGTCCTGGTCTAAACCA | not found | Oryza sativa L. | not found | leaf | CRISPR-Cas9 |
| PCdb_5541 | 24854982 | OsMSH1 | Oryza sativa MutS homolog 1 (OsMSH1, DNA mismatch repair) | GGAGGTCCTGGTCTAAACCA | not found | Oryza sativa L. | 21.1-66.7% | embryo | CRISPR-Cas9 |
| PCdb_5542 | 26891616 | Os03g0216800 | Protein phosphatase 2C family protein [Source: RAP-DB] | GGAGGCTCCATCGAATCGAT | not found | Oryza sativa L. | not found | leaf | CRISPR-Cas9 |
| PCdb_5543 | 26891616 | OsAnP | not found | GGAGGAGGACGCGGCCGCCG | not found | Oryza sativa L. | not found | leaf | CRISPR-Cas9 |
| PCdb_5544 | 34055482 | AT5G46450 | Serine/threonine kinase (AT5G46450, signal transduction) | GGAGGAGCCTTCTGTCAAGT | not found | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5545 | 31863838 | LmCBP1 | s required for the pathogenicity of Leptosphaeria maculans on rape | GGAGCTGATGTAGCCGGGGG | not found | Brassica napus L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5546 | 34055482 | AT4G33300 | Cytochrome P450 family protein (AT4G33300, secondary metabolism) | GGAGCTCCATTGACTTGACT | not found | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5547 | 32549675 | DST | Drought and salt tolerance protein, negative regulator of stomatal closure | GGAGCTAGAGGCTCAAGTTG | not found | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5548 | 26891616 | TaMLO | Powdery mildew susceptibility MLO protein (TaMLO) | GGAGATTGGGTCCTGCGTGA | not found | Oryza sativa L. | not found | leaf | CRISPR-Cas9 |
| PCdb_5549 | 26891616 | LOC_Os02g34600 | LOC_Os02g34600 (hypothetical) | GGAGAAGTACGAGCTGCTCA | not found | Oryza sativa L. | not found | leaf | CRISPR-Cas9 |
| PCdb_5550 | 26891616 | AtPDS3 | Phytoene desaturase (PDS) | GGACTTTTGCCAGCCATGGT | not found | Oryza sativa L. | not found | leaf | CRISPR-Cas9 |
| PCdb_5551 | 34055482 | AT1G27170 | Phytoene desaturase (carotenoid biosynthesis) | GGACTTTAGATCACAGAGCA | not found | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5552 | 33772993 | ZmbHLH51 | regulating male sterility and their functional conservation | GGACTACTGCGTCTACTGG | not found | Zea mays L. | not found | anther | CRISPR-Cas9 |
| PCdb_5553 | 0 | Solyc03g097920(MKK4) | Mitogen-activated protein kinase kinase 4 | GGACGTCGTTCGGAGGGTTC | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5554 | 0 | Solyc03g117980(RbohB) | NADPH oxidase (respiratory burst oxidase homolog B) | GGACCGCTGAACAAACGAGG | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5555 | 26891616 | DERF1 | Ethylene-responsive transcription factor (ERF1) | GGAATTAGCGGCGGCGGCGA | not found | Oryza sativa L. | not found | leaf | CRISPR-Cas9 |
| PCdb_5556 | 24854982 | OsDERF1 | Oryza sativa Drought-responsive ERF 1 (OsDERF1, stress response) | GGAATTAGCGGCGGCGGCGA | not found | Oryza sativa L. | 21.1-66.7% | embryo | CRISPR-Cas9 |
| PCdb_5557 | 28955376 | OsMIR528 | MicroRNA 528 | GGAATGGAAGAGGCAAGCAC | not found | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5558 | 0 | Solyc02g076980(Cathepsin B1) | Cathepsin B1 cysteine protease | GGAATCTGTCTTACAAGTTA | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5559 | 34055482 | AT5G45050 | F-box protein (AT5G45050, protein degradation) | GGAAGTGGTGGGCACAGATC | not found | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5560 | 26891616 | PDS | Phytoene desaturase (carotenoid biosynthesis) | GGAAGGATGAAGATGGAGAT | not found | Oryza sativa L. | not found | leaf | CRISPR-Cas9 |
| PCdb_5561 | 37479448 | ssIIIa | Starch synthase IIIa (ssIIIa, amylopectin synthesis) | GGAAGCGACTTCCGTATGAA | not found | Oryza sativa L. | not found | endosperm | CRISPR-Cas9 |
| PCdb_5562 | 28955376 | OSMIR408 | MicroRNA 408 | GGAAGAGGCAGCAGGGGA | not found | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5563 | 36704157 | Tsn1 | Sensitivity gene for host-selective toxin produced by wheat tan spot fungus | GGAACTGTCTACTAATATAT | not found | Triticum aestivum L. | 5.8-62% | protoplast | CRISPR-Cas9 |
| PCdb_5564 | 28528644 | Solyc04g005320 | 5-enolpyruvylshikimate-3-phosphate synthase | GGAACAGCTTGAGCGTCAAC | not found | Solanum lycopersicum L. | 1 | seed | CRISPR-Cas9 |
| PCdb_5565 | 0 | Solyc04g005320 | Tomato fruit ripening regulator (Solyc04g005320) | GGAACAGCTTGAGCGTCAAC | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5566 | 26891616 | AtPDS3 | Phytoene desaturase (PDS) | GGAACAACGAGATGCTGACA | not found | Oryza sativa L. | not found | leaf | CRISPR-Cas9 |
| PCdb_5567 | 36028578 | eIF4E | enhance PVY resistance in tobacco | GGAAATCAAAACAGGCTGCT | not found | Solanum tuberosum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5568 | 34055482 | AT5G04720 | RNA recognition motif protein (AT5G04720, RNA processing) | GGAAAGCCGTGGTCGTCTAG | not found | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5569 | 0 | Solyc12g038510 | Solyc12g038510 (not found) | GCTTTTGCTAAGAGAAGAAA | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5570 | 24122057 | pds | Phytoene desaturase | GCTTTTCCCTGATGAAATTT | not found | Triticum aestivum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5571 | 26891616 | NbPDS | Phytoene desaturase (carotenoid biosynthesis) [Source: SolGenomics] | GCTTTTCCCTGATGAAATTT | not found | Oryza sativa L. | not found | leaf | CRISPR-Cas9 |
| PCdb_5572 | 0 | Solyc03g006100(LRRXII-RLK) | Leucine-rich repeat receptor-like kinase (subfamily XII) | GCTTTGGAATATCTTCACCA | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5573 | 34055482 | AT4G26090 | Heat shock protein (stress response) | GCTTGCGATTGCGGGCAAAG | not found | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5574 | 30467959 | CGF3 | Cucumber green mottle mosaic virus factor 3 (viral pathogenicity factor) | GCTTCTCTAACACGCTCACAC | not found | Gossypium hirsutum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5575 | 0 | Solyc01g099840(Drm-3) | Domains rearranged methyltransferase 3 | GCTTCCTCAGTAAAGGATCT | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5576 | 34055482 | AT5G63020 | NAC domain transcription factor (AT5G63020, stress response) | GCTTAAGAACACAGCTGTTA | not found | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5577 | 34685581 | KNR6 | KERNEL NUMBER6 (cytokinin oxidase/dehydrogenase) [Source: MaizeGDB] | GCTGTGTAGAAGGAAACCAC | not found | Zea mays L. | not found | Golgi Apparatus | CRISPR-Cas9 |
| PCdb_5578 | 26946469 | AtSH3P3 | SH3 domainontaining protein 3 | GCTGTGATAAAGCAATTCAG | not found | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5579 | 0 | Solyc08g082990(Transporter gene) | Transporter (generic) | GCTGCTAACCACACAAGTAC | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5580 | 35087548 | LOB1 | LATERAL ORGAN BOUNDARIES 1 (transcription factor regulating lateral organ development) [Source: TAIR] | GCTGCATGGAAAGATGATGA | not found | Citrus 脳 sinensis (L.) Osbeck | not found | protoplast | CRISPR-Cas9 |
| PCdb_5581 | 26891616 | NtPDS | Phytoene desaturase involved in carotenoid biosynthesis [Source: UniProt] | GCTGCATGGAAAGATGATGA | not found | Oryza sativa L. | not found | leaf | CRISPR-Cas9 |
| PCdb_5582 | 31480315 | TaLPR2 | Wheat low-phytic-acid locus 2 protein | GCTGAGCGCGAAGAGCTCGC | not found | Triticum aestivum L. | 0.467 | calli | CRISPR-Cas9 |
| PCdb_5583 | 31480315 | TaNCED1 | Wheat 9-cis-epoxycarotenoid dioxygenase 1 | GCTGAGCGCGAAGAGCTCGC | not found | Triticum aestivum L. | 0.312 | calli | CRISPR-Cas9 |
| PCdb_5584 | 0 | Solyc12g098980(Pti1a) | Pti1a protein kinase | GCTGAATTGTGTGCCATGAA | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5585 | 35506331 | AtC2GnT | miR398b and AtC2GnT form a negative feedback loop to regulate Arabidopsis thaliana resistance against Phytophthora parasitica. | GCTGAAGGTTGGAAGGAACA | not found | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5586 | 26891616 | SWEET1A | Sugar transporter (SWEET1A) | GCTGAAGATGATGGGTCTCC | not found | Oryza sativa L. | not found | leaf | CRISPR-Cas9 |
| PCdb_5587 | 26891616 | Os02g23823 | not found | GCTGAAAGATTTGACGTCCC | not found | Oryza sativa L. | not found | leaf | CRISPR-Cas9 |
| PCdb_5588 | 35652435 | CI2 | Carboxypeptidase inhibitor or trypsin inhibitor (proteinase inhibitor function) | GCTCTGCTTCACTCGCTCCTCTTCAAGC | not found | Solanum tuberosum L. | not found | calli | CRISPR-Cas13 |
| PCdb_5589 | 34371684 | Ta-Eif4e | Eukaryotic initiation factor 4E | GCTCCCACATTCAACTTGCT | not found | Triticum aestivum L. | not found | embryo | CRISPR-Cas9 |
| PCdb_5590 | 28676963 | OsCCD4a | Carotenoid cleavage dioxygenase (OsCCD4a) | GCTCCACAGAGCCCCAGCTA | not found | Oryza sativa L. | 1 | calli | CRISPR-Cas9 |
| PCdb_5591 | 33772993 | ZmTGA10 | TGA transcription factor 10 (jasmonic acid signaling) | GCTCACCACGACGAGATGG | not found | Zea mays L. | not found | anther | CRISPR-Cas9 |
| PCdb_5592 | 30467959 | CGF2 | Cucumber green mottle mosaic virus factor 2 (viral movement protein) | GCTCAAACAGGTGATCATCA | not found | Gossypium hirsutum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5593 | 0 | Solyc10g085990(Mai5) | Mai5 | GCTATGACTGGACGCATGTT | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5594 | 27622539 | GLV6_1 | GOLVEN peptide 6 | gctagtgcacaaagaaaga | not found | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5595 | 26891616 | GmDDM1 | Chromatin remodeling ATPase (DDM1) | GCTACTTGAAGCTAGGATAA | not found | Oryza sativa L. | not found | leaf | CRISPR-Cas9 |
| PCdb_5596 | 0 | Solyc05g005950(Solute Transporter 2) | Solute carrier transporter 2 | GCTACTGGCACTAGTATTAT | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5597 | 35485227 | GmPIN1 | regulates leaf petiole angle and plant architecture in soybean | GCTAATGGGGTTGACAAGGA | not found | Glycine max (L.) Merr. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5598 | 35890429 | RDR1 | virus susceptibility | gctaagcttagaactaaaaaaagcac | not found | Cucumis melo L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5599 | 0 | Solyc01g067400(PBL-T2) | PBS1-like kinase T2 | GCGTGTTTATAAGGGTCGGC | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5600 | 0 | Solyc10g047140 | Tomato protein Solyc10g047140 (unknown function) | GCGTGAACTACAAGTTGCGT | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5601 | 34055482 | AT1G17610 | Acetolactate synthase (branched-chain amino acid biosynthesis) | GCGTCGTACTTCGATACACG | not found | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | not found |
| PCdb_5602 | 34055482 | AT5G46450 | Serine/threonine kinase (AT5G46450, signal transduction) | GCGGTTTAAATTGAGTATAC | not found | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5603 | 33135782 | not found | not found | GCGGTTCAGGGCTCTTGTTC | not found | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5604 | 26891616 | MPK6 | Mitogen-activated protein kinase 6, stress signaling and development regulator | GCGGGTGCGGGTCAATCAAA | not found | Oryza sativa L. | not found | leaf | CRISPR-Cas9 |
| PCdb_5605 | 33024447 | TrxH | Thioredoxin H | gcggatttatgtctcggtag | not found | Zea mays L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5606 | 28379609 | ZmLG 1 | Liguleless 1 (ZmLG1, leaf architecture) | GCGGAGACTAAGTGGctgta | not found | Zea mays L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5607 | 26891616 | ROC5 | Zinc-finger transcription factor Roc5 (leaf-rolling regulator) | GCGGAGAACGACAGCCGGTC | not found | Oryza sativa L. | not found | leaf | CRISPR-Cas9 |
| PCdb_5608 | 24854982 | OsROC5 | Oryza sativa ROC5 transcription factor (OsROC5, bulliform cell development) | GCGGAGAACGACAGCCGGTC | not found | Oryza sativa L. | 21.1-66.7% | embryo | CRISPR-Cas9 |
| PCdb_5609 | 26891616 | Os04g0668400 | Cytochrome P450 86A8 [Source: RAP-DB] | GCGGAAGCCTCGACAGTCAC | not found | Oryza sativa L. | not found | leaf | CRISPR-Cas9 |
| PCdb_5610 | 23999092 | GFP | GFP (Green Fluorescent Protein, Aequorea victoria, transformation control) [Source: Addgene] | GCGCTTCAAGGTGCACATGG | not found | Nicotiana tabacum L. | 0.536 | seed | CRISPR-Cas9 |
| PCdb_5611 | 23999092 | GFP | GFP (Green Fluorescent Protein, Aequorea victoria, transformation control) [Source: Addgene] | GCGCTTCAAGGTGCACATGG | not found | Arabidopsis thaliana (L.) Heynh. | 0.48 | seed | CRISPR-Cas9 |
| PCdb_5612 | 26891616 | YSA | Chloroplast development regulator YELLOW SEEDLING ALBINISM (YSA) | GCGCGCCACCTCGGCCGAAG | not found | Oryza sativa L. | not found | leaf | CRISPR-Cas9 |
| PCdb_5613 | 24854982 | OsYSA | Oryza sativa yellow stripe-like transporter (OsYSA, iron transport) | GCGCGCCACCTCGGCCGAAG | not found | Oryza sativa L. | 21.1-66.7% | embryo | CRISPR-Cas9 |
| PCdb_5614 | 34055482 | AT1G17600 | Mitogen-activated protein kinase 13 (stress response) | GCGCATGTGTGATCTTGGGA | not found | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5615 | 0 | Solyc11g069220(MLO16) | MLO family protein (MLO16) | GCGATGACCCTCTAAGTCAC | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5616 | 26891616 | Os07g0409500-A | Retrotransposon gag protein (isoform A) [Source: RAP-DB] | GCGAGCGAGAGTCATGGAGG | not found | Oryza sativa L. | not found | leaf | CRISPR-Cas9 |
| PCdb_5617 | 26891616 | Os07g0625500-A | Putative transposase-related protein (isoform A) [Source: RAP-DB] | GCGAGATCGAGCGATGGCGA | not found | Oryza sativa L. | not found | leaf | CRISPR-Cas9 |
| PCdb_5618 | 35058949 | StLDP | Potato lipid droplet protein (StLDP, oil body formation) | GCGACTGGGTAAGTCGTACG | not found | Phaeodactylum tricornutum Bohlin | 0.74 | protoplast | SpCas9 |
| PCdb_5619 | 0 | Solyc05g005560(PGA1) | G-protein alpha subunit 1 (signal transduction, Solyc05g005560) | GCCTTGTTCAGAAGAAACCA | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5620 | 37479448 | ssIIIa | Starch synthase IIIa (ssIIIa, amylopectin synthesis) | GCCTTCTATGCCCTCGGAGC | not found | Oryza sativa L. | not found | endosperm | CRISPR-Cas9 |
| PCdb_5621 | 34360681 | not found | not found | GCCTTCCGCCTTCCTGGCA | not found | Zea mays L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5622 | 26891616 | SWEET13 | Sugar (sucrose) transporter SWEET13 | GCCTGTCCCTGCAGCATCCC | not found | Oryza sativa L. | not found | leaf | CRISPR-Cas9 |
| PCdb_5623 | 33077493 | GmDCL2a | Dicer-like endoribonuclease involved in small RNA biogenesis | GCCTGGATGAGCTTGGTGTT | not found | Glycine max (L.) Merr. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5624 | 34055482 | AT5G43470 | Protein kinase family protein (AT5G43470, signal transduction) | GCCTCACTCAGAAGCAAATT | not found | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5625 | 37312871 | Flo5 | Floral organ identity regulator | GCCTAGCACATATAGACAAG | not found | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5626 | 26891616 | NtPDS | Phytoene desaturase involved in carotenoid biosynthesis [Source: UniProt] | GCCGTTAATTTGAGAGTCCA | not found | Oryza sativa L. | not found | leaf | CRISPR-Cas9 |
| PCdb_5627 | 26891616 | NbPDS3 | Phytoene desaturase 3 (carotenoid biosynthesis) [Source: SolGenomics] | GCCGTTAATTTGAGAGTCCA | not found | Oryza sativa L. | not found | leaf | CRISPR-Cas9 |
| PCdb_5628 | 31673276 | TaABCC6 & TaNFXL1 & TansLTP9.4 | Combination: ABCC6 transporter; NFXL1 zinc-finger regulator; nsLTP9.4 lipid-transfer protein | GCCGTGCGTGGCGTACGTGA | not found | Triticum aestivum L. | 0.165 | protoplast | CRISPR-Cas9 |
| PCdb_5629 | 34055482 | AT5G66910 | bHLH family transcription factor (AT5G66910, development) | GCCGTCTATCGAACAACGTG | not found | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5630 | 30887096 | dth8-2 | Flowering time regulator, delays heading date under long days | GCCGGGTATGTCGTCTACGG | not found | Oryza sativa L. | not found | leaf | CRISPR-Cas9 |
| PCdb_5631 | 26891616 | LOC_Os12g39630 | LOC_Os12g39630 (hypothetical) | GCCGGCGGAAGCGATGGAGA | not found | Oryza sativa L. | not found | leaf | CRISPR-Cas9 |
| PCdb_5632 | 0 | Solyc11g069430(Aquaporin transporter 1) | Solyc11g069430 (Aquaporin transporter 1) | GCCGGAGGCGATATTTGCGG | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5633 | 0 | Solyc11g019910(Pectin2) | Pectin methylesterase (Pectin2) | GCCGGAGGCGATATTTGCGG | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5634 | 37467787 | not found | not found | GCCGCGCTTGCTCCTTGCCGGAT | not found | Oryza sativa L. | not found | epidermal cell,internode,plant | CRISPR-Cas9 |
| PCdb_5635 | 30796544 | Lhcb 1 | Light-harvesting chlorophyll a/b-binding protein 1 | GCCGACCTGCCGCCTAATTGTGG | not found | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5636 | 34055482 | AT5G38850 | Zinc finger protein (AT5G38850, transcriptional regulation) | GCCCATATTGTGAGAAGCAT | not found | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5637 | 33772993 | ZmbHLH122 | Basic helix-loop-helix transcription factor 122 (ZmbHLH122, stress response) | GCCATTTCGATATGATGCA | not found | Zea mays L. | not found | anther | CRISPR-Cas9 |
| PCdb_5638 | 34713245 | NbRDR6 | RNA-dependent RNA polymerase 6 (antiviral defense) [Source: SolGenomics] | GCCATGGCCTTCTCAAAGCT | not found | Nicotiana attenuata Torr. ex S.Watson | not found | protoplast | SpCas9 |
| PCdb_5639 | 30691438 | FAD2-1B | oleate desaturase (oil unsaturation) | GCCATGCCAAGAAAGAGAG | not found | Glycine max (L.) Merr. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5640 | 26891616 | LOC_Os04g35240 | LOC_Os04g35240 (hypothetical) | GCCATGAAGTACATCCCTCG | not found | Oryza sativa L. | not found | leaf | CRISPR-Cas9 |
| PCdb_5641 | 29708966 | heterotrimeric G伪 proteins | Heterotrimeric G伪 proteins, GTPases in signal transduction pathways | GCCACTCCCCTACACGCTCCCCG | not found | Zea mays L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5642 | 32117361 | Drm-3 | Domains rearranged methyltransferase 3 | GCCACTATCTGGCCGGGGAC | not found | Brassica napus L. | not found | seed | CRISPR-Cas9 |
| PCdb_5643 | 0 | Solyc01g099840(Drm-3) | Domains rearranged methyltransferase 3 | GCCACTATCTGGCCGGGGAC | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5644 | 34884880 | the Wheat Multi-Copy 伪-Gliadin Gene Family | are responsible for bread viscoelastic properties | GCCACAAGAGCAAGTTCCAT | not found | Triticum aestivum L. | 0.75 | protoplast | CRISPR-Cas9 |
| PCdb_5645 | 0 | Solyc06g069290 | Tomato ethylene-responsive factor (Solyc06g069290, ripening regulator) | GCATTGTACTCTGCTATTCA | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5646 | 29363139 | MpMyb14 | R2R3MYB activation of flavonoid production in response to abiotic stress is an ancient character in land plants | GCATTCTCTCCGACACGAGA | not found | Marchantia polymorpha L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5647 | 34055482 | AT1G50180 | Gene not detected or not annotated in the database | GCATGTGACGACTCTTGTGT | not found | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5648 | 27515683 | MADS | MADS-box transcription factor (floral organ identity) [Source: TAIR] | GCATGAAGCAGGTAATCGATCGG | not found | Zea mays L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5649 | 31159719 | Xa21 | Xa21 receptor kinase (rice bacterial blight resistance) | GCATCCGGGATCTCAATCCA | not found | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5650 | 37816147 | Gene1SE3.1 | Stress-responsive protein SE3.1 | GCATCAAGACGCTTGTAGCA | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5651 | 34713245 | NbRDR6 | RNA-dependent RNA polymerase 6 (antiviral defense) [Source: SolGenomics] | GCAGTTCTATAGAAAACCAA | not found | Nicotiana attenuata Torr. ex S.Watson | not found | protoplast | SpCas9 |
| PCdb_5652 | 0 | Solyc06g084140(Transporter gene) | Tomato sugar transporter (Solyc06g084140, carbohydrate partitioning) | GCAGTGGGAACCGTGGCTGT | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5653 | 28955376 | OsMIR528 | MicroRNA 528 | GCAGTGGAAGGGGCATGCAG | not found | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5654 | 36478403 | EPSPS | EPSPS (5-enolpyruvylshikimate-3-phosphate synthase, EC 2.5.1.19, aromatic amino acid biosynthesis) [Source: UniProt] | GCAGTAACAGCTGCTGTCAATGG | not found | Zea mays L. | not found | seed | SpCas9 |
| PCdb_5655 | 37446265 | SRL1 | SHORT ROOT LENGTH 1 (SRL1, root development) | GCAGGTGTGCCCAATTCATT | not found | Oryza sativa L. | not found | plants,plasma,flag leaf | CRISPR-Cas9 |
| PCdb_5656 | 0 | Solyc04g014900(LRRXII-RLK) | Leucineich repeat receptorike kinase | GCAGGTGACCAAGTCCATAA | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5657 | 0 | Solyc04g014890(LRRXII-RLK) | Leucineich repeat receptorike kinase | GCAGGTGACCAAGTCCATAA | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5658 | 34750721 | BEI | Bacterial extracellular invertase, involved in carbohydrate metabolism | GCAGGCACCAGCACCTTCCC | not found | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5659 | 28174584 | not found | not found | GCAGGAACCGCAGGAGTAGGA | not found | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5660 | 0 | Solyc02g091840 | Tomato NAC transcription factor (Solyc02g091840, development regulation) | GCAGACGTGTTAACTGCGAA | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5661 | 0 | Solyc12g098100 | Tomato protein Solyc12g098100 (unknown function) | GCAGAAGGATTGAATGCTGA | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5662 | 0 | Solyc06g010030(SlMlo9) | Mildew resistance locus O 9 | GCACTTGAAAAGATCAAAGC | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5663 | 36208055 | CRL1 | Putative cellulose synthase-like or cell wall-related protein (exact function unclear) | GCACTTCGCCGCCATCCACA | not found | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5664 | 31572408 | HHZ(TS2) | Thermosensitive rice line HHZ variant 2 (specific function undefined) | GCACTCTACTGCTTCTTGGC | not found | Oryza sativa L. | not found | callus | CRISPR-Cas9 |
| PCdb_5665 | 0 | Solyc05g005910(Peptide Transporter 1) | Oligopeptide transporter 1 | GCACTACTCGGAGTGGCTGA | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5666 | 28640964 | PGM | Phosphoglucomutase (PGM, carbohydrate metabolism) | GCACGGAGCUGGUGGUGGUG | not found | Panicum virgatum L. | 0.137 | calli | CRISPR-Cas9 |
| PCdb_5667 | 26891616 | Os07g0409500-B | Retrotransposon gag protein (isoform B) [Source: RAP-DB] | GCACGCCAAGGTCGACGACA | not found | Oryza sativa L. | not found | leaf | CRISPR-Cas9 |
| PCdb_5668 | 34111225 | ObDMR6 | Ornithogalum DMR6-like protein (pathogen susceptibility) | GCACATACTGCAAAGAAGTT | not found | Arabidopsis thaliana (L.) Heynh. | 0.96 | leaf | not found |
| PCdb_5669 | 35656017 | VvEPFL 9 -1 | Vitis vinifera EPIDERMAL PATTERNING FACTOR-LIKE 9 (VvEPFL9-1, stomatal development) | GCACATACAATGAATGCAAA | not found | Vitis vinifera L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5670 | 37506985 | OsLTPL18 | not found | GCACAGATCGATGGCCTCTC | not found | Oryza sativa L. | not found | spikelet,plants | CRISPR-Cas9 |
| PCdb_5671 | 0 | Solyc02g090380(NRG1) | Solyc02g090380 (NRG1, N requirement gene 1 for pathogen resistance) | GCAATGGCAGCAGCTCTCTT | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5672 | 26891616 | AtJAZ1 | Jasmonate signaling repressor (JAZ1) | GCAATAGGAAGTTCTGACAA | not found | Oryza sativa L. | not found | leaf | CRISPR-Cas9 |
| PCdb_5673 | 34055482 | AT1G53350 | Circular RNA (potential regulatory function) | GCAAGTTTCACCTGCAACTAG | not found | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5674 | 29867128 | AtALS & AtPDS & AtFT & AtLFY | Acetolactate synthase (ALS), Phytoene desaturase (PDS), Flowering locus T (FT), and Leafy (LFY) - Multiple gene targets for plant genetic studies | GCAACAAGACCAGACTGATG | not found | Arabidopsis thaliana (L.) Heynh. | 0.008 | protoplast | ABE |
| PCdb_5675 | 31572408 | LCH2 | Leaf color and height regulator 2 (plant architecture) | GCAAACTCTACTGCTTCTTGGC | not found | Oryza sativa L. | not found | callus | CRISPR-Cas9 |
| PCdb_5676 | 31370789 | 伪-gliadins | Alpha-gliadin storage protein | GATTTTGTGGCTGCAATTG | not found | Triticum aestivum L. | 0.196 | embryo | CRISPR/Cas9 |
| PCdb_5677 | 0 | Solyc05g009630(NRC3) | Solyc05g009630 (NRC3, NB-LRR disease resistance protein helper) | GATTTGATTCTCGGAATCCA | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5678 | 30467959 | CGF2 | Cucumber green mottle mosaic virus factor 2 (viral movement protein) | GATTGGAAAAGGCGACGACAG | not found | Gossypium hirsutum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5679 | 34055482 | AT2G17050 | Hygromycin phosphotransferase II (antibiotic resistance) | GATTGACAGACATGAACTAG | not found | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5680 | 0 | Solyc12g099830(BSK830) | BR-signaling kinase 830 | GATTCTGAGCCTCGTGAATG | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5681 | 35003180 | VviAIR12 | Vitis vinifera auxin-induced root protein 12 (VviAIR12, root development) | GATTCTCCATCCCCATAGG | not found | Vitis vinifera L. | not found | calli | CRISPR-Cas9 |
| PCdb_5682 | 35955778 | not found | not found | GATTCGGCCTAAACTAAATCCGAA | not found | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5683 | 0 | Solyc04g076060(TFT10) | TFIIBike transcription factor TFT10 | GATTCACTGGTAGTAGCAGA | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5684 | 30887096 | ef7-1 | Elongation factor involved in protein translation and plant development | GATTATCAGGTGAAAAAAGG | not found | Oryza sativa L. | not found | leaf | CRISPR-Cas9 |
| PCdb_5685 | 37437572 | FLYC | FLYC (Arabidopsis thaliana FLOWERING LOCUS Y COMPLEX, chromatin remodeling complex subunit) [Source: TAIR] | GATGTGGTATCCAATTCAGG | not found | Dionaea muscipula J.Ellis | not found | not found | not found |
| PCdb_5686 | 35567185 | OsbHLH024 | Improves Salt Stress Resistance in Rice | GATGTCGGAGAGGAAGAGGA | not found | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5687 | 34371684 | Ta-eIF4E | Eukaryotic initiation factor 4E | GATGGTCCATTTACCGCCAT | not found | Triticum aestivum L. | not found | embryo | CRISPR-Cas9 |
| PCdb_5688 | 0 | Solyc09g007170(Mai5-like (PBL-T1)) | PBL1ike Ser/Thr kinase | GATGGCGAGTCTGGTCAAAT | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5689 | 37810390 | PsLOX2 | Lipoxygenase (jasmonate biosynthesis) | GATGGCCTTACTGCCTTCTTAGG | not found | Glycine max (L.) Merr. | not found | not found | CRISPR-Cas9 |
| PCdb_5690 | 34055482 | AT5G04720 | RNA recognition motif protein (AT5G04720, RNA processing) | GATGGCCCATGAGGATTATA | not found | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5691 | 31673276 | TaABCC6 & TaNFXL1 & TansLTP9.4 | Combination: ABCC6 transporter; NFXL1 zinc-finger regulator; nsLTP9.4 lipid-transfer protein | GATGGAGTTGGTGTGCCGCA | not found | Triticum aestivum L. | 0.047 | protoplast | CRISPR-Cas9 |
| PCdb_5692 | 0 | Solyc05g013290(Fen) | Fen gene homolog (disease resistance, Solyc05g013290) | GATGCTTCTAACTTGAGTTA | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5693 | 34257043 | OsMLH1 | regulate synapsis and interference-sensitive crossover formation during meiosis in rice | GATGCTATCAGGAGTGTCTA | not found | Oryza sativa L. | not found | chloroplast | CRISPR-Cas9 |
| PCdb_5694 | 33772993 | ZmPHD11 | PHD-finger protein 11 (ZmPHD11, chromatin remodeling) | GATGCCGCGAGCTCCTCCA | not found | Zea mays L. | not found | anther | CRISPR-Cas9 |
| PCdb_5695 | 0 | Solyc01g090430(NRC1) | Solyc01g090430 (NRC1, NB-LRR disease resistance protein helper) | GATGATTCAATCAGCAGAGG | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5696 | 0 | Solyc04g072310(PROPEP) | Systemin precursor PROPEP peptide | GATGATGAACTTACAAGAGT | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5697 | 26891616 | AtGAI1 | DELLA transcriptional repressor (GAI) | GATGAGCTTCTAGCTGTTCT | not found | Oryza sativa L. | not found | leaf | CRISPR-Cas9 |
| PCdb_5698 | 37816147 | PIF4 | Phytochrome-interacting factor 4 | GATGAGCTAGAATCAGCTGG | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5699 | 35652435 | P3 | P3 viral silencing suppressor (RNA interference suppression) | GATGAAATATTTACACACTTAGTATTGA | not found | Solanum tuberosum L. | not found | calli | CRISPR-Cas13 |
| PCdb_5700 | 35652435 | P3 | P3 viral silencing suppressor (RNA interference suppression) | GATGAAATATTTACACACTTAGTATTGA | not found | Solanum tuberosum L. | not found | calli | CRISPR-Cas13 |
| PCdb_5701 | 35652435 | CI | Cytoplasmic inclusion protein (viral movement protein in some plant viruses) | GATGAAATATTTACACACTTAGTATTGA | not found | Solanum tuberosum L. | not found | calli | CRISPR-Cas13 |
| PCdb_5702 | 0 | Solyc01g095100(WRKY22) | WRKY transcription factor 22 | GATCTACATGCGGTGGTCAG | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5703 | 0 | Solyc03g116690(PBCP ) | Photosystem II-associated phosphatase PBCP | GATCGTACCAAGCAATAGCG | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5704 | 33193516 | CTS-12 | Mediates ABA-Dependent Stomatal Opening Modulation to Limit Water Loss Under Severe Chilling Stress | GATCGCCGGCAACTTCGCGC | not found | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5705 | 33263914 | not found | not found | GATCCTAAGATGTCTAGGCG | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5706 | 34371684 | TaBAK1-2 | BRI1-associated receptor kinase 1 | GATCCAGTCGTTGTTTCGCG | not found | Triticum aestivum L. | not found | embryo | CRISPR-Cas9 |
| PCdb_5707 | 0 | Solyc05g007510(RDRP1) | RNA-dependent RNA polymerase 1 | GATCCACATATGCCCGCAGT | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5708 | 34055482 | AT2G17060 | Xylosyltransferase (hemicellulose biosynthesis) | GATCATATGGCAAGCTCATG | not found | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5709 | 33024447 | ChlH | Magnesium-chelatase H subunit | gatcaatcgcacagttaggg | not found | Zea mays L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5710 | 34416068 | GWD1 | an ideal biotechnological target for potential improving yield and quality in rice | GATATCCATCCGGATCCCGG | not found | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5711 | 26891616 | Os07g0261200-B | Ty3-gypsy retrotransposon protein (isoform B) [Source: RGAP] | GATACTCACGATGGTGGCGC | not found | Oryza sativa L. | not found | leaf | CRISPR-Cas9 |
| PCdb_5712 | 0 | Solyc11g072910(Mal1) | Solyc11g072910 (Malate transporter, Mal1) | GATAATTTCTTAGTAGATTG | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5713 | 27622539 | GLV10_2 | GOLVEN peptide 10 | gataatctgcaaataagag | not found | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5714 | 29945871 | BdYDA2 (YODA2) MAPK kinase kinase | MAP kinase kinase kinase YODA2, regulates embryogenesis and stomatal patterning | GAGTGTTCACCAATTCCTAG | not found | Brachypodium distachyon (L.) P. Beauv. | not found | Brachypodium P.Beauv. (Bdistachyon_314_v3.0 download from phytozome) | CRISPR-Cas9 |
| PCdb_5715 | 34055482 | AT5G43470 | Protein kinase family protein (AT5G43470, signal transduction) | GAGTAGGTTTCAGTTCAGAT | not found | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5716 | 31050154 | not found | not found | GAGGTTCAGCTCCGGGTAGT | not found | Zea mays L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5717 | 34267775 | FAD2 | FAD2 (Fatty acid desaturase 2, EC 1.14.19.2, linoleic acid biosynthesis) [Source: UniProt] | GAGGTAGGAGAAAGAGCGA | not found | Camelina sativa (L.) Crantz | 0.4-84.1% | flower | CRISPR-Cas9 |
| PCdb_5718 | 37908495 | GmELF3-1 | Temporal Dynamics of the Circadian Clock and Flowering Gene Network Using Overexpression | GAGGCCCAAGAGCACCACCT | not found | Glycine max (L.) Merr. | not found | not found | CRISPR-Cas9 |
| PCdb_5719 | 34055482 | AT2G17060 | Fucosyltransferase (cell wall modification) | GAGGCCAAAATCATTATCGG | not found | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5720 | 37816147 | SdelA | Suppressor of deltA protein | GAGGAACTAGAGCTAAGATT | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5721 | 36072839 | MIR160a | MicroRNA 160a (auxin response regulation) [Source: miRBase] | GAGCTTTGCAAATGGCATAC | not found | Solanum tuberosum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5722 | 0 | Solyc11g069430(Aquaporin transporter 1) | Solyc11g069430 (Aquaporin transporter 1) | GAGCTTTAATTGCTCCGGCT | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5723 | 34055482 | AT5G45260 | Calmodulin-like protein (AT5G45260, calcium sensing) | GAGCTTACATACCCATTTGGC | not found | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5724 | 0 | Solyc02g076980(Cathepsin B1) | Cathepsin B1 cysteine protease | GAGCTGTGGATGTCACGTCA | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5725 | 26891616 | LOC_Os04g35240 | LOC_Os04g35240 (hypothetical) | GAGCGGCGGGAGGCATGGAG | not found | Oryza sativa L. | not found | leaf | CRISPR-Cas9 |
| PCdb_5726 | 26891616 | Waxy | Granule-bound starch synthase I (Waxy) | GAGCCTCGAGTGCTGCCTGC | not found | Oryza sativa L. | not found | leaf | CRISPR-Cas9 |
| PCdb_5727 | 37017106 | ZmPLA1 | Phospholipase A1 (ZmPLA1, lipid metabolism) | GAGCATCCTCGGCGAGACGAGGG | not found | Zea mays L. | not found | immature embryos | not found |
| PCdb_5728 | 0 | Solyc04g009440(NAC1) | NAM/NAC family transcription factor 1 | GAGCAGCAGGAACCGGTTAT | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5729 | 34055482 | AT1G12280 | Glycogen synthase kinase 4 (brassinosteroid signaling) | GAGCACAAATGGAGTTGCCA | not found | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5730 | 37985755 | TaLHP1 | Wheat LIKE HETEROCHROMATIN PROTEIN 1 | GAGCAAGCAGCAGGAGAGGT | not found | Triticum aestivum L. | not found | not found | CRISPR-Cas9 |
| PCdb_5731 | 35087548 | LOB1 | LATERAL ORGAN BOUNDARIES 1 (transcription factor regulating lateral organ development) [Source: TAIR] | GAGATTGTTATTGCTGGTGC | not found | Citrus 脳 sinensis (L.) Osbeck | not found | protoplast | CRISPR-Cas9 |
| PCdb_5732 | 26891616 | NtPDS | Phytoene desaturase involved in carotenoid biosynthesis [Source: UniProt] | GAGATTGTTATTGCTGGTGC | not found | Oryza sativa L. | not found | leaf | CRISPR-Cas9 |
| PCdb_5733 | 0 | Solyc07g066230 | Tomato lipoxygenase (Solyc07g066230, oxylipin biosynthesis) | GAGATTCAAATTCTGGCAGT | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5734 | 0 | Solyc03g118330(LRRXII-RLK) | Leucine-rich repeat receptor-like kinase (subfamily XII) | GAGATGCAACATCCACATCT | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5735 | 30032251 | FZP | Floral meristem identity gene, regulates spikelet development and grain yield. | GAGATACGCGACCCGACCACCA | not found | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5736 | 28955376 | OsMIR815C | Rice microRNA 815c, regulates gene expression through mRNA silencing | GAGAAGGGGATTGAGGAGAT | not found | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5737 | 28955376 | OsMIR815b | Rice microRNA 815b, regulates gene expression through mRNA silencing | GAGAAGGGGATTGAGGAGAT | not found | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5738 | 28955376 | OsMIR815a | Rice microRNA 815a, regulates gene expression through mRNA silencing | GAGAAGGGGATTGAGGAGAT | not found | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5739 | 33133118 | COMT | Caffeoyl-CoA O-methyltransferase | gagaagatcaaggtctagcg | not found | Brassica napus L. | 1 | protoplast | CRISPR-Cas9 |
| PCdb_5740 | 27622539 | GLV1_2 | GOLVEN peptide 1 | gagaaaggaggcgggcgtt | not found | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5741 | 33088191 | not found | not found | GACTTGCAAAGACCAAACAG | not found | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5742 | 34055482 | AT5G66910 | bHLH family transcription factor (AT5G66910, development) | GACTTCCACATGTCGGAATT | not found | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5743 | 29087011 | Dcl3a | DICER-LIKE 3a (siRNA processing) | GACTGTGTTGAAGCTCTGAT | not found | Glycine max (L.) Merr. | not found | hairy root | CRISPR-Cas9 |
| PCdb_5744 | 0 | Solyc06g071500(Transporter gene) | Tomato amino acid transporter (Solyc06g071500, nitrogen metabolism) | GACTGGTGCGTCTATGTACC | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5745 | 0 | Solyc03g096190(CORE) | Tomato CORE cold shock protein (Solyc03g096190, stress adaptation) | GACTGGCCTGGGGTCTCATG | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5746 | 35003180 | VviSWEET4 | Vitis vinifera SWEET sugar transporter 4 (VviSWEET4, phloem loading) | GACTGGAGCAGACACGGCT | not found | Vitis vinifera L. | not found | calli | CRISPR-Cas9 |
| PCdb_5747 | 0 | Solyc12g009020(MKK1) | Solyc12g009020 (MAP kinase kinase 1, MKK1) | GACTGAATCAGGAACATTTA | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5748 | 34055482 | AT5G45250 | Calcium-binding EF-hand protein (AT5G45250, calcium signaling) | GACTCTAACGCACACCAGTG | not found | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5749 | 0 | Solyc04g009640(FLS3) | Flagellinensing 3 receptor kinase | GACTAGAATCACTCGTAACA | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5750 | 37017106 | ZmPLA1 | Phospholipase A1 (ZmPLA1, lipid metabolism) | GACTACTTCGACTACATCGCCGG | not found | Zea mays L. | not found | immature embryos | not found |
| PCdb_5751 | 34936355 | LOC Os11g19840 | Putative protein LOC_Os11g19840 | GACGTCCAGGCACTTCGTCG | not found | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5752 | 26891616 | OsFTL5 | Flowering locus T-like protein 5 | GACGCGCGGCTTGCCGGCGA | not found | Oryza sativa L. | not found | leaf | CRISPR-Cas9 |
| PCdb_5753 | 0 | Solyc05g052050(Pti4) | Pto-interacting protein 4 | GACGACTGAAGCTTGAATTC | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5754 | 31068975 | PDS | Phytoene desaturase (PDS, carotenoid biosynthesis) | GACCTGATCGAGTAACTACTG | not found | Fragaria vesca L. | 0.8 | Fragaria L. (using Fragaria L. diploid reference v4.0.a1) | CRISPR-Cas9 |
| PCdb_5755 | 0 | Solyc06g006040(LRRXII-RLK) | Leucine-rich repeat receptor-like kinase (subfamily XII) | GACCTACAAGTATTTTATTG | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5756 | 30272679 | APOBEC1 | Cytidine deaminase enzyme involved in RNA editing and DNA mutation processes | GACCAGCCAGCGTCTGGCGC | not found | Oryza sativa L. | 0.13 | protoplast | PBE |
| PCdb_5757 | 26891616 | AtCHLI2 | Magnesium chelatase subunit I (CHLI) | GACATTCATAACAGAGACAT | not found | Oryza sativa L. | not found | leaf | CRISPR-Cas9 |
| PCdb_5758 | 34371684 | Ta-eIF(iso)4E | Eukaryotic initiation factor 4E isoform | GACAGGATAAGCTTTCATTA | not found | Triticum aestivum L. | not found | embryo | CRISPR-Cas9 |
| PCdb_5759 | 0 | Solyc04g007070(NRC4a) | Solyc04g007070 (NRC4a, NB-LRR disease resistance protein helper) | GACACACAAATAGTGAGCAG | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5760 | 33772993 | ZmbHLH51 | Basic helix-loop-helix protein 51 (ZmbHLH51, transcriptional regulation) | GACAAGAGGCCTCAACG | not found | Zea mays L. | not found | anther | CRISPR-Cas9 |
| PCdb_5761 | 37935439 | not found | not found | GAATGTTGATAGGCCCGAC | not found | Oryza sativa L. | not found | endosperm | CRISPR-Cas9 |
| PCdb_5762 | 37935439 | Zmvim 104 | Vacuolar iron transporter homolog 104 (iron homeostasis) | GAATGTTGATAGGCCCGA | not found | Zea mays L. | not found | endosperm | CRISPR-Cas9 |
| PCdb_5763 | 26891616 | MPK2 | Mitogen-activated protein kinase 2, stress response and developmental signaling | GAATGCGCAGACTCGTCAGG | not found | Oryza sativa L. | not found | leaf | CRISPR-Cas9 |
| PCdb_5764 | 34305978 | BnGTR1 | Glucosinolate transporter 1 | GAATCAACAGTTTCTTCAAC | not found | Brassica napus L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5765 | 34055482 | AT4G08450 | Peroxidase family protein (oxidative stress response) | GAATATCGTAGATCGACTGTC | not found | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5766 | 0 | Solyc11g018800(APE ) | AP endonuclease (APE) | GAATAGTGGTAAGAGCCGTA | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5767 | 26891616 | LOC_Os02g47220 | LOC_Os02g47220 (hypothetical) | GAAGTTGGTGACGGGACTTT | not found | Oryza sativa L. | not found | leaf | CRISPR-Cas9 |
| PCdb_5768 | 26891616 | LOC_Os03g55600 | LOC_Os03g55600 (hypothetical) | GAAGTTGGAGAATACACTGC | not found | Oryza sativa L. | not found | leaf | CRISPR-Cas9 |
| PCdb_5769 | 31033104 | SBE1 | Starch branching enzyme I (SBE1, amylopectin biosynthesis) | GAAGTTATTGGCGATTTCAA | not found | Solanum tuberosum L. | 0.67 | protoplast | not found |
| PCdb_5770 | 0 | Solyc11g012070(SOBER1) | Acetyl-protein deacetylase (SOBER1) | GAAGTGAACAATCCCTTGAT | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5771 | 34980227 | CaS | Calcium-sensitive protein (generic term; may refer to calcium-binding or calcium-regulated proteins) | GAAGTAACTCGTAATCCTGTACAATAGC | not found | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas13 |
| PCdb_5772 | 34371684 | Ta-eIF4E | Eukaryotic initiation factor 4E | GAAGGTGTGGATGGGGTGGA | not found | Triticum aestivum L. | not found | embryo | CRISPR-Cas9 |
| PCdb_5773 | 28955376 | OsMIR528 | MicroRNA 528 | GAAGGGGCATGCAGAGGAGC | not found | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5774 | 29692796 | ERECTA | Deciphering the Evolutionary Trajectory and Phenotypic | GAAGGCCGGTTTCGGGAACG | not found | Oryza sativa L. | not found | protoplast | not found |
| PCdb_5775 | 34371684 | Ta-eIF4E | Eukaryotic initiation factor 4E | GAAGGAGTTTCTGGACTACA | not found | Triticum aestivum L. | not found | embryo | CRISPR-Cas9 |
| PCdb_5776 | 32438486 | GhCLA | Phytoene desaturase | GAAGCTGCCTGTAAGATTTG | not found | Gossypium hirsutum L. | not found | protoplast | CRISPR-Cas9,CRISPR-Cas12 |
| PCdb_5777 | 0 | Solyc01g067900(RALF1) | Rapid alkalinization factor 1 peptide hormone | GAAGCTCCTCTCCTTGAACA | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5778 | 34055482 | AT1G17615 | Dense and erect panicle 1 (panicle architecture control) | GAAGCCTAACGGTTTACCCT | not found | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5779 | 0 | Solyc07g016010(LRRXII-RLK) | Leucine-rich repeat receptor-like kinase (subfamily XII) | GAAGATATGGTTACTCATGT | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5780 | 34055482 | AT1G27170 | Phytoene desaturase (carotenoid biosynthesis) | GAAGAGTCATGTCCGTTGTT | not found | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5781 | 0 | Solyc03g123800(MKK2) | Mitogen-activated protein kinase kinase 2 | GAAGACGGACAGAATCCTCG | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5782 | 37816147 | LOL1 | LATERAL ORGAN LOBES 1 transcription factor | GAAGAAATATGGTGGTTAGC | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5783 | 33822021 | ZmMs25 | critical for anther and pollen development | GAACTTCCTCATCACCGGC | not found | Zea mays L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5784 | 34371684 | Ta-eIF(iso)4E | Eukaryotic initiation factor 4E isoform | GAACTCTTCGACGGTGTCGA | not found | Triticum aestivum L. | not found | embryo | CRISPR-Cas9 |
| PCdb_5785 | 0 | Solyc07g040690(NPR1) | Solyc07g040690 (NPR1 homolog, systemic acquired resistance regulator) | GAACGAATCGGAAACTTCAC | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5786 | 36995618 | GmFAD 2 | Omega-6 fatty acid desaturase | GAACCCTTGAGAGAGGCTTCTTC | not found | Glycine max (L.) Merr. | not found | protoplast | CRISPR-Cas12 |
| PCdb_5787 | 26891616 | MPK2 | Mitogen-activated protein kinase 2, stress response and developmental signaling | GAACCCGGTCGCCTCAAGGA | not found | Oryza sativa L. | not found | leaf | CRISPR-Cas9 |
| PCdb_5788 | 29945871 | BdYDA1 (YODA1) MAPK kinase kinase | MAP kinase kinase kinase YODA1, regulates embryogenesis and stomatal patterning | GAACCACAAAGTCAAAACG | not found | Brachypodium distachyon (L.) P. Beauv. | not found | Brachypodium P.Beauv. (Bdistachyon_314_v3.0 download from phytozome) | CRISPR-Cas9 |
| PCdb_5789 | 0 | Solyc12g017830(Min7) | Solyc12g017830 (MIN7 ARFEF) | GAACAGGGTCTGTGGCTGTG | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5790 | 34055482 | AT5G18370 | Pentatricopeptide repeat protein (AT5G18370, organelle gene expression) | GAACAGCACACAGCTAGATT | not found | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5791 | 0 | Solyc03g123800(MKK2) | Mitogen-activated protein kinase kinase 2 | GAACAATCTTACGCCTGTGG | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5792 | 29087011 | Dcl3a | DICER-LIKE 3a (siRNA processing) | GAAATTGAATGATATCTGTG | not found | Glycine max (L.) Merr. | not found | hairy root | CRISPR-Cas9 |
| PCdb_5793 | 0 | Solyc09g098420 | Tomato protein Solyc09g098420 (uncharacterized) | GAAATTCTCTTGTCCTGAAA | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5794 | 34055482 | AT5G18370 | Pentatricopeptide repeat protein (AT5G18370, organelle gene expression) | GAAATTATTGTCGAAGTCAG | not found | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5795 | 26891616 | GmMIR | MicroRNA precursor (MIR) | GAAATCACGGTTGAGTGTGA | not found | Oryza sativa L. | not found | leaf | CRISPR-Cas9 |
| PCdb_5796 | 34782773 | Ubi2 | conferred herbicide tolerance in transgenic rice to FCD and bipyrazone | GAAATAATCACCAAACAGAT | not found | Oryza sativa L. | not found | protoplast | not found |
| PCdb_5797 | 0 | Solyc08g075550(AOX) | Alternative oxidase (AOX) | GAAACGGTTGCAGCCGTGCC | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5798 | 37816147 | RCMI | Regulator of cell cycle and meiosis I | GAAACAATTATCGAGATAAG | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5799 | 34059638 | SlRCM1 | is required for chlorophyll synthesis and chloroplast development in fruits | GAAACAATTATCGAGATAAC | not found | Glycine max (L.) Merr. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5800 | 0 | Solyc05g005940(Solute Transporter 1) | Solute carrier transporter 1 | GAAAAAGGGCAATAGCGGAA | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5801 | 31824524 | E1-SP1 | Flowering repressor transcription factor E1 (SP1) | CTTTTCAGATGAAgtGGAGCAGc | not found | Glycine max (L.) Merr. | not found | seed | CRISPR-Cas9 |
| PCdb_5802 | 35003180 | VviDEL1 | Vitis vinifera DEL1 cell cycle regulator (VviDEL1, endoreduplication) | CTTTCTACTGTAAGTGCGA | not found | Vitis vinifera L. | not found | calli | CRISPR-Cas9 |
| PCdb_5803 | 35949953 | StISAC | Solanum tuberosum invertase/sucrose synthase activator, regulates carbohydrate metabolism | CTTGTAAGTTCTTAATTTTC | not found | Solanum tuberosum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5804 | 33249237 | GmCRY1s | regulate soybean shade avoidance in response to reduced blue light | CTTGGTTGGCAGTACATATC | not found | Glycine max (L.) Merr. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5805 | 26891616 | LOC_Os07g35870 | LOC_Os07g35870 (hypothetical) | CTTGGAACTGGGTGCTGTCC | not found | Oryza sativa L. | not found | leaf | CRISPR-Cas9 |
| PCdb_5806 | 36704157 | Snn5 | Sensitivity gene for SnTox5 effector from Parastagonospora nodorum | CTTGCAAGGACTTGATGATA | not found | Triticum aestivum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5807 | 37591976 | CP | confers a broad-spectrum resistance against RNA viruses in potato | CTTGAGCCTCGTCCTCGGGGAACTCCAG | not found | Solanum tuberosum L. | not found | not found | CRISPR-Cas13 |
| PCdb_5808 | 27622539 | GLV1_1 | GOLVEN peptide 1 | cttctttggacgtcttcaa | not found | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5809 | 37504507 | CCD8, | Carotenoid cleavage dioxygenase 8 | CTTCCTGACATGTTTGATCA | not found | Solanum lycopersicum L. | not found | lateral shoots,bud,shoot,PLANT,stem nodes,plant | CRISPR-Cas9 |
| PCdb_5810 | 35485227 | GmPIN1 | regulates leaf petiole angle and plant architecture in soybean | CTTCATAGCCTCCAACAACC | not found | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5811 | 31480315 | TaPinb | Wheat puroindoline b (grain hardness protein) | CTTAGCTTCGGCCGCTCCTG | not found | Triticum aestivum L. | not found | calli | CRISPR-Cas9 |
| PCdb_5812 | 31480315 | TaDA1 | Wheat ubiquitin receptor DA1 (seed and organ size regulator) | CTTAGCTTCGGCCGCTCCTG | not found | Triticum aestivum L. | 0.542 | calli | CRISPR-Cas9 |
| PCdb_5813 | 26891616 | AtADH1 | Alcohol dehydrogenase (EC 1.1.1.1) | CTTAGCCTGGCGAAAGAGTC | not found | Oryza sativa L. | not found | leaf | CRISPR-Cas9 |
| PCdb_5814 | 26891616 | LOC_Os07g35870 | LOC_Os07g35870 (hypothetical) | CTTAATTTCTGTTAGGTTCT | not found | Oryza sativa L. | not found | leaf | CRISPR-Cas9 |
| PCdb_5815 | 33772993 | ZmMYB33 | MYB transcription factor 33 (ZmMYB33, developmental regulation) | CTGTTTCTCGGCGATGCAC | not found | Zea mays L. | not found | anther | CRISPR-Cas9 |
| PCdb_5816 | 37437572 | FLYC | FLYC (Arabidopsis thaliana FLOWERING LOCUS Y COMPLEX, chromatin remodeling complex subunit) [Source: TAIR] | CTGGGAGGCCCGTAGTGGAG | not found | Dionaea muscipula J.Ellis | not found | sensory cells,plants,plant | CRISPR-Cas9 |
| PCdb_5817 | 31872309 | OsLOGL5 | LONELY GUY-like 5 enzyme involved in cytokinin activation | CTGGGAGATGTCCACCGTAT | not found | Oryza sativa L. | not found | protoplast | not found |
| PCdb_5818 | 37816147 | HD8 | Homeobox-domain protein HD-ZIP 8 | CTGGAGGCCCTCCACATGAT | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5819 | 35168613 | GmPDS11g & GmPDS18g | Glycine max phytoene desaturase 11g & 18g (carotenoid biosynthesis) [Source: SoyBase] | CTGGAAGCAAGAGACGTTCT | not found | Glycine max (L.) Merr. | not found | leaf | CRISPR-Cas9 |
| PCdb_5820 | 31821678 | MIR | MicroRNA gene (non-coding RNA regulation) [Source: miRBase] | CTGCACTGCCTCTTCCCTGGC | not found | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9,TALEN |
| PCdb_5821 | 33154763 | SlYDA | YODA-like MAPKK kinase (SlYDA) | CTGCAAAAGGCTCCAGGAGG | not found | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5822 | 0 | Solyc12g055720 | Tomato protein Solyc12g055720 (unknown function) | CTGACAAAATGGAGTGCCAA | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5823 | 27622539 | GLV7_2 | GOLVEN peptide 7 | ctgaaacgaagatgaagag | not found | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5824 | 37591976 | CP | confers a broad-spectrum resistance against RNA viruses in potato | CTCTTGTGAGCGTTATGAGCTATCGTCT | not found | Solanum tuberosum L. | not found | not found | CRISPR-Cas13 |
| PCdb_5825 | 35817888 | OsFPN1 | Oryza sativa Ferroportin 1 (OsFPN1, iron transport) | CTCTACATGATCCGAATCTGGCCGGGCTGCT | not found | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5826 | 33249237 | GmCRY1s | regulate soybean shade avoidance in response to reduced blue light | CTCATTCCTGCATCAACCAA | not found | Glycine max (L.) Merr. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5827 | 34713245 | NbSGS3 | Suppressor of gene silencing 3 (RNAi pathway) [Source: SolGenomics] | CTCATGCCACGATGGCCTTG | not found | Nicotiana attenuata Torr. ex S.Watson | not found | protoplast | SpCas9 |
| PCdb_5828 | 26891616 | MPK5 | Mitogen-activated protein kinase 5, involved in disease resistance signaling | CTACATCGCCACGGAGCTCA | not found | Oryza sativa L. | not found | leaf | CRISPR-Cas9 |
| PCdb_5829 | 33772993 | ZmLBD27 | Lateral organ boundaries domain protein 27 (ZmLBD27, organ development) | CTACAGGTCAGGATCAGGC | not found | Zea mays L. | not found | anther | CRISPR-Cas9 |
| PCdb_5830 | 26891616 | LOC_Os02g02480 | LOC_Os02g02480 (hypothetical) | CGTCTGTTGGCAGAACTCAG | not found | Oryza sativa L. | not found | leaf | CRISPR-Cas9 |
| PCdb_5831 | 33135782 | not found | not found | CGTCCTTCAGGAACTTCCAG | not found | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5832 | 0 | Solyc02g076980(Cathepsin B1) | Cathepsin B1 cysteine protease | CGTCATGGACGCGTTTACA | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5833 | 26891616 | AtADH1 | Alcohol dehydrogenase (EC 1.1.1.1) | CGTATCTTCGGCCATGAAGC | not found | Oryza sativa L. | 0.82 | leaf | CRISPR-Cas9 |
| PCdb_5834 | 31469505 | SNB | SUPERNUMERARY BRACT gene regulating inflorescence development | CGTAGAGAATCCTGATGATGC | not found | Oryza sativa L. | 0.091 | calli | ABE |
| PCdb_5835 | 35046975 | 0sXLG 2 | Extra-large G protein alpha subunit 2 | CGGTGGGCCGTCGTACTCTA | not found | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5836 | 26891616 | OsFTL13 | Flowering locus T-like protein 13 | CGGTGCTGATGAAGGGATCC | not found | Oryza sativa L. | not found | leaf | CRISPR-Cas9 |
| PCdb_5837 | 33024447 | PDS1 | Phytoene desaturase | cgggttagcggtatatacca | not found | Zea mays L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5838 | 36478403 | ZmALS1 | Acetolactate synthase 1 (ZmALS1, branched-chain amino acid biosynthesis) | CGGGATGGTGGTGCAGTGGGAGG | not found | Zea mays L. | not found | seed | SpCas9 |
| PCdb_5839 | 26891616 | OsFTL8 | Flowering locus T-like protein 8 | CGGCGAACAGCCTGGTGCTG | not found | Oryza sativa L. | not found | leaf | CRISPR-Cas9 |
| PCdb_5840 | 34782773 | CP12 | conferred herbicide tolerance in transgenic rice to FCD and bipyrazone | CGGATTTCTGCGTGTGATGT | not found | Oryza sativa L. | not found | protoplast | not found |
| PCdb_5841 | 36921631 | not found | not found | CGGAGTCTTTGGAGCGATG | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5842 | 29392632 | AtGGAT1 | Gamma-glutamyl amino acid transferase 1, involved in amino acid metabolism | CGGAGGAAAATTCCATCCAC | not found | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5843 | 37590954 | not found | not found | CGGAGAUCCCUUCGAUCCAAA | not found | Zea mays L. | not found | not found | CRISPR-Cas9 |
| PCdb_5844 | 35642449 | CLE2 | regulates de novo shoot regeneration in Arabidopsis thaliana | CGCTGGAAGCCGCCCTCTTG | not found | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5845 | 30796544 | Lhcb 1 | Light-harvesting chlorophyll a/b-binding protein 1 | CGCGGCAGTTCGGTCCGCCAagg | not found | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5846 | 32394708 | LOC106393678 | Hypothetical protein LOC106393678 (uncharacterized) | CGCCTATGTCAATTGCCAGA | not found | Brassica napus L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5847 | 28676963 | OsCYP97A4 | Carotenoid hydroxylase (CYP97A4) | CGCCGCCGCGCTGCTCACCA | not found | Oryza sativa L. | 1 | calli | CRISPR-Cas9 |
| PCdb_5848 | 28676963 | OsCCD7 | Carotenoid cleavage dioxygenase (OsCCD7) | CGCCGCCGCCGACGACAACA | not found | Oryza sativa L. | 1 | calli | CRISPR-Cas9 |
| PCdb_5849 | 28676963 | OsDSM2 | Lipid transfer protein required for blast susceptibility (DSM2) | CGCCATCACCAACGCCGTCC | not found | Oryza sativa L. | 1 | calli | CRISPR-Cas9 |
| PCdb_5850 | 26891616 | Os03g0247300 | ABC transporter G family member 15 [Source: RGAP] | CGCAAGACAGGGCACACCGG | not found | Oryza sativa L. | not found | leaf | CRISPR-Cas9 |
| PCdb_5851 | 33154763 | SlYDA | YODA-like MAPKK kinase (SlYDA) | CGAGCTGTCAGGAGCACTGT | not found | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5852 | 36721267 | ChSK1 | confers quantitative susceptibility to maize southern leaf blight | CGAAGGTGCCGTACGAG | not found | Zea mays L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5853 | 26891616 | LOC_Os04g31290 | LOC_Os04g31290 (hypothetical) | CGAAGACGATCGTGTCGGAG | not found | Oryza sativa L. | not found | leaf | CRISPR-Cas9 |
| PCdb_5854 | 0 | Solyc09g015170 | Tomato stress-responsive protein (Solyc09g015170) | CCTTGGAAGGGATTGGGTGG | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5855 | 36478403 | ZmALS2 | Acetolactate synthase 2 (ZmALS2, branched-chain amino acid biosynthesis) | CCTTGAAAGCCCCACCACTAGGG | not found | Zea mays L. | not found | seed | SpCas9 |
| PCdb_5856 | 37312871 | Flo5 | Floral organ identity regulator | CCTTCTAATACGGTGCTGAA | not found | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5857 | 30272679 | TaLOX2 | Wheat lipoxygenase 2 | CCTTCGTCATCGGCACCAAC | not found | Triticum aestivum L. | 0.2 | protoplast | PBE |
| PCdb_5858 | 0 | Solyc03g114840 | Tomato ascorbate peroxidase (Solyc03g114840, oxidative stress response) | CCTTAAAGCAAATCAGGTCA | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5859 | 38053289 | PDAT1 | reduces hydroxy fatty acid production in transgenic Arabidopsis | CCTGTTGGAAGGGCGCGGGACGC | not found | Arabidopsis thaliana (L.) Heynh. | not found | not found | CRISPR-Cas9 |
| PCdb_5860 | 37816147 | RIN | Ripening inhibitor (RIN) transcription factor | CCTGTGAATCTGATGAAGTT | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5861 | 35003180 | VviLIN2 | Vitis vinifera lin2 nodulin-like protein (VviLIN2, nitrogen metabolism) | CCTGCTTACATCTTTGAGG | not found | Vitis vinifera L. | not found | calli | CRISPR-Cas9 |
| PCdb_5862 | 33263914 | not found | not found | CCTGATTGATTGGTTGATAC | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5863 | 37025130 | ZED1-related kinase 13 | ZED1-related kinase 13 (plant immune signaling) | CCTCTGCTGGTCTCTCAACC | not found | Arabidopsis thaliana (L.) Heynh. | not found | seed | CRISPR-Cas9 |
| PCdb_5864 | 35217878 | Rx3 | Disease resistance protein Rx3 (virus resistance) | CCTCGTGAATCTCTATAACCTAC | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5865 | 26891616 | Os10g0413900-A | Expressed protein of unknown function (isoform A) [Source: RGAP] | CCTCGCCGCCGTACGTGTAG | not found | Oryza sativa L. | not found | leaf | CRISPR-Cas9 |
| PCdb_5866 | 33666289 | GhNe1 | GhNe1 (Gossypium hirsutum necrosis-inducing protein) [Source: CottonGen] | CCTCGCCCAGTTCTTCTCTATGG | not found | Gossypium hirsutum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5867 | 26891616 | Os04g0595000 | F-box domain containing protein OsFBX310 [Source: RGAP] | CCTCGATCCTCCTCTGCAGA | not found | Oryza sativa L. | not found | leaf | CRISPR-Cas9 |
| PCdb_5868 | 31824524 | E1-SP2 | Flowering repressor transcription factor E1 (SP2) | CCTCCATATGaGAAGCCaCcAcC | not found | Glycine max (L.) Merr. | not found | seed | CRISPR-Cas9 |
| PCdb_5869 | 33772993 | ZmbHLH122 | Basic helix-loop-helix transcription factor 122 (ZmbHLH122, stress response) | CCTCATCCAACTTCAGTAT | not found | Zea mays L. | not found | anther | CRISPR-Cas9 |
| PCdb_5870 | 31203891 | GmHsp90A2 | involved in soybean heat stress as a positive regulator | CCTATGGACTGAGAAGACCACCG | not found | Glycine max (L.) Merr. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5871 | 35168613 | GmPDS18g | Glycine max phytoene desaturase 18g (carotenoid biosynthesis) [Source: SoyBase] | CCTAATGTGCAGAACCTTTT | not found | Glycine max (L.) Merr. | not found | leaf | CRISPR-Cas9 |
| PCdb_5872 | 26891616 | LOC_Os08g04390 | LOC_Os08g04390 (hypothetical) | CCTAAGTGATGCCACTCGCA | not found | Oryza sativa L. | not found | leaf | CRISPR-Cas9 |
| PCdb_5873 | 37025130 | ZED1-related kinase 13 | ZED1-related kinase 13 (plant immune signaling) | CCGTTCCTGATGAGTATCAT | not found | Arabidopsis thaliana (L.) Heynh. | not found | seed | CRISPR-Cas9 |
| PCdb_5874 | 36208055 | WOX11 | promote crown root development | CCGTCGGTGGGGATGATGAT | not found | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5875 | 28676963 | OsCCD4b | Carotenoid cleavage dioxygenase (OsCCD4b) | CCGTAATCTACAGACTCGCC | not found | Oryza sativa L. | 1 | calli | CRISPR-Cas9 |
| PCdb_5876 | 35046975 | 0sXLG 4 | Extra-large G protein alpha subunit 4 | CCGGCCGCCCTATGCAGTCC | not found | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5877 | 36995633 | the D-Hordein gene (Hor3) and starch synthase IIa gene (SSIIa) | Barley D-hordein storage protein (Hor3) & starch synthase IIa (SSIIa) | CCGGCCCACGAGGAACGCC | not found | Hordeum vulgare L. | 5.6-25.0% | protoplast | CRISPR-Cas9 |
| PCdb_5878 | 38053289 | PDAT1 | Phospholipid:DAG acyltransferase 1 (PDAT1, lipid metabolism) | CCGGAGGTAACGGGTCTGATATA | not found | Arabidopsis thaliana (L.) Heynh. | not found | not found | CRISPR-Cas9 |
| PCdb_5879 | 35946785 | PGR5 | Proton gradient regulation 5 (chloroplast cyclic electron flow) | CCGCAACAAGCCAGAGTCT | not found | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5880 | 35217878 | Rx3 | Disease resistance protein Rx3 (virus resistance) | CCGATGCTGAAATGTCCTGCAT | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5881 | 32623622 | OsGhd7 | Oryza sativa Grain number, plant height and heading date 7 (OsGhd7, flowering time regulation) | CCGATCCCCTGGCACGCACT | not found | Oryza sativa L. | not found | protoplast | not found |
| PCdb_5882 | 37810390 | PsLOX2 | Lipoxygenase 2 | CCGAGTGAAACACCGTCTCCACT | not found | Glycine max (L.) Merr. | not found | not found | CRISPR-Cas9 |
| PCdb_5883 | 30928533 | WOX11 | WUSCHEL-related homeobox 11 transcription factor | CCGAACCAGTCCGGGCACGT | not found | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5884 | 34343415 | LIGULELESS-1 | provides a rapidly scorable phenotype by altering leaf inclination angle | cccttctctgctcccaatca | not found | Hemisorghum C.E.Hubb. ex Bor | not found | protoplast | CRISPR-Cas9 |
| PCdb_5885 | 28955376 | OSMIR408 | MicroRNA 408 | CCCCTGCACTGCCTCTTCCC | not found | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5886 | 29755497 | SGR1 | Stay-green protein SGR1 | CCCCAGTGAGTGTTATGCCT | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5887 | 35737098 | LOC100381337 | Hypothetical protein LOC100381337 [Source: NCBI] | CCCATGGGTTATGGCGTGTGCTT | not found | Zea mays L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5888 | 34947996 | PtSGT4 | Populus SGT4 protein (stress response) | CCCATACCTGTTGATGAGTTC | not found | Malus x domestica Bork. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5889 | 34947996 | PtSGT1 | Populus SGT1 protein (disease resistance) | CCCATACCTGTTGATGAGTTC | not found | Malus x domestica Bork. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5890 | 34579415 | StBAM 1A | Potato beta-amylase 1A (StBAM1A, starch degradation) | CCCAGATGCTTGCCCGCCA | not found | Solanum tuberosum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5891 | 30531939 | OsNGN2 | Regulates root development and nitrogen utilization in rice | CCCAGAAGCGAGCGACGGCG | not found | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5892 | 31824524 | E1-SP1 | Flowering repressor transcription factor E1 (SP1) | CCATTaAaATGAAAGGaAGCAGc | not found | Glycine max (L.) Merr. | not found | seed | CRISPR-Cas9 |
| PCdb_5893 | 34782773 | PPO1 | conferred herbicide tolerance in transgenic rice to FCD and bipyrazone | CCATGTCCGTCGCTGACGAG | not found | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5894 | 35652435 | HC-Pro | HC-Pro (Potyvirus helper component-proteinase) [Source: ViralZone] | CCATCATAGTTGGCCAGGTTCCAAGCT | not found | Solanum tuberosum L. | not found | calli | CRISPR-Cas13 |
| PCdb_5895 | 31824524 | E1-SP2 | Flowering repressor transcription factor E1 (SP2) | CCACCATATGtGAAGCCTCcAAC | not found | Glycine max (L.) Merr. | not found | seed | CRISPR-Cas9 |
| PCdb_5896 | 37810390 | PsLOX2 | Lipoxygenase (jasmonate biosynthesis) | CCACAAGATAAGAGGGACAGTGG | not found | Glycine max (L.) Merr. | not found | not found | CRISPR-Cas9 |
| PCdb_5897 | 33401455 | 4CL and RVE7 | 4-coumarate-CoA ligase (lignin biosynthesis) + Reveille 7 (circadian clock regulator) | CCAATGAACTAGACGGTGACATA | not found | Cicer arietinum L. | 0.76 | protoplast | CRISPR-Cas9 |
| PCdb_5898 | 33666289 | GhNe1 | is required for both extrafloral and floral nectary development in Gossypium | CCAAGCGTTTTGCCTGCCACTAC | not found | Gossypium hirsutum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5899 | 33024447 | ChlH | Magnesium-chelatase H subunit | ccaagcctctgccctcgacg | not found | Zea mays L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5900 | 37810390 | PsLOX2 | Lipoxygenase 2 | CCAAATGTGACAGGACTCCTAAA | not found | Glycine max (L.) Merr. | not found | not found | CRISPR-Cas9 |
| PCdb_5901 | 32620100 | not found | not found | CATGTCTCTTCAGCATCCC | not found | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5902 | 26891616 | Os06g0142100 | Zinc finger C2H2-type family protein [Source: RGAP] | CATGGGGAACTTGGACTTGG | not found | Oryza sativa L. | not found | leaf | CRISPR-Cas9 |
| PCdb_5903 | 33277994 | SlLAM1 | controls compound leaf and floral organ development in Solanum lycopersicum | CATGCGCCTACGGCGAATCC | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5904 | 37816147 | Gene1SE3.1 | Stress-responsive protein SE3.1 | CATGCCTTGGGAGATCTCGT | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5905 | 35217878 | Rx3 | Disease resistance protein Rx3 (virus resistance) | CATGCATGAGGCTATCACCTTGG | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5906 | 33088191 | not found | not found | CATCGGTGGCCGTCCCCCCT | not found | Oryza sativa L. | not found | protoplast | not found |
| PCdb_5907 | 32887261 | IPK | Inositol polyphosphate kinase | CAGGAGTTCGTCAACCATGG | not found | Zea mays L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5908 | 33024447 | TrxH | Thioredoxin H | cagctaggtgaatgcaacca | not found | Zea mays L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5909 | 33822021 | ZmMs25 | critical for anther and pollen development | CAGCGGGAGAAGGAGGCCA | not found | Zea mays L. | not found | Plastids | CRISPR-Cas9 |
| PCdb_5910 | 34579415 | StPPO1C | Potato polyphenol oxidase 1C (StPPO1C, enzymatic browning) | CAGCACCGAAGAATTGGGA | not found | Solanum tuberosum L. | not found | leaf | CRISPR-Cas9 |
| PCdb_5911 | 37590954 | ZmMYB74 | regulate grain size and weight | CAGAGAUCCCUUCGAUCCAAA | not found | Zea mays L. | not found | not found | CRISPR-Cas9 |
| PCdb_5912 | 33767722 | GmNHX5 | Positively Regulates Salt Tolerance | CAGACACCGAGACTAATATC | not found | Glycine max (L.) Merr. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5913 | 30928533 | WOX11 | WUSCHEL-related homeobox 11 transcription factor | CAGAACCGGTTCGGTCCCGA | not found | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | ABE |
| PCdb_5914 | 36145794 | UGT76G1 | UDP-glycosyltransferase 76G1, modifies steviol glycosides in Stevia rebaudiana | CACTTCTATACAGCCCCCTT | not found | Stevia rebaudiana (Bertoni) Bertoni | 14.16-93.68 | protoplast | CRISPR-Cas9 |
| PCdb_5915 | 29881395 | not found | not found | CACTGCAGCAGGAAACCCAG | not found | Oryza sativa L. | not found | protoplast | not found |
| PCdb_5916 | 30796544 | Lhcb 1 | Light-harvesting chlorophyll a/b-binding protein 1 | CACTGCAGAGATATTGAACGagg | not found | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5917 | 37816147 | CPK28 | Calcium-dependent protein kinase 28 | CACGGCGGCGGTATTTGTGG | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5918 | 31673276 | TaABCC6 & TaNFXL1& TansLTP9.4 | Combination: ABCC6 transporter; NFXL1 zinc-finger regulator; nsLTP9.4 lipid-transfer protein | CACGCCGTCGAGATTACTGG | not found | Triticum aestivum L. | 0.072 | protoplast | CRISPR-Cas9 |
| PCdb_5919 | 31673276 | TaABCC6 & TaNFXL1& TansLTP9.4 | Combination: ABCC6 transporter; NFXL1 zinc-finger regulator; nsLTP9.4 lipid-transfer protein | CACGCCGTCGAGATTACTGG | not found | Triticum aestivum L. | 0.072 | protoplast | CRISPR-Cas9 |
| PCdb_5920 | 26891616 | PMS3 | Photoperiod-sensitive male sterility 3 (long noncoding RNA) | CACCTACATATAGGAGTGGG | not found | Oryza sativa L. | not found | leaf | CRISPR-Cas9 |
| PCdb_5921 | 24854982 | OsPMS3 | Oryza sativa post-meiotic segregation protein 3 (OsPMS3, DNA mismatch repair) | CACCTACATATAGGAGTGGG | not found | Oryza sativa L. | 21.1-66.7% | embryo | CRISPR-Cas9 |
| PCdb_5922 | 30803101 | Nib | Antiviral Responses | CACCAAATCAGGAGATTCTACTCATGGT | not found | Solanum tuberosum L. | not found | protoplast | CRISPR-Cas13 |
| PCdb_5923 | 37620620 | Nib | Nuclear inclusion b protease (potyvirus protein) [Source: UniProt] | CACCAAATCAGGAGATTCTACTCATGGT | not found | Solanum tuberosum L. | not found | not found | CRISPR-Cas13 |
| PCdb_5924 | 30272679 | APOBEC1 | Cytidine deaminase enzyme involved in RNA editing and DNA mutation processes | CACACACACACTAGTACCTC | not found | Oryza sativa L. | 0.17 | protoplast | PBE |
| PCdb_5925 | 30537089 | SlPHO1 | role in phosphate nutrition of tomato seedlings | CAAGGTCTGGATCTGGTTCC | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5926 | 0 | Solyc12g010740 | Solyc12g010740 (not found) | CAAGGGGTCGAATGCGAGAA | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5927 | 30272679 | APOBEC1 | Cytidine deaminase enzyme involved in RNA editing and DNA mutation processes | CAAGGATCCCAGCCCCGTGA | not found | Oryza sativa L. | 0.18 | protoplast | PBE |
| PCdb_5928 | 32903549 | ygl1 | caused the leaf yellowing phenotype | CAACAGGGGGATACTGTATG | not found | Triticum aestivum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5929 | 32311214 | GmFT2a | Flowering promoter FT homolog GmFT2a | CAACACTAGAGATTTTGCTG | not found | Glycine max (L.) Merr. | not found | protoplast | CRISPR-Cas9,Base editor |
| PCdb_5930 | 33135782 | not found | not found | CAACAC GGTCTCGCTCGTCT | not found | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5931 | 26946469 | AtSH3P3 | SH3 domainontaining protein 3 | CAAAAGACTGTCAATTCCCT | not found | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5932 | 26891616 | Os07g0261200-A | Ty3-gypsy retrotransposon protein (isoform A) [Source: RGAP] | ATTTATCCGTTCATGTCGAT | not found | Oryza sativa L. | not found | leaf | CRISPR-Cas9 |
| PCdb_5933 | 32362750 | not found | not found | ATTGTGTAAGGTTACTCATCAG | not found | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5934 | 26891616 | Os12g0242700 | Putative zinc finger protein [Source: RGAP] | ATTGTGAACTATGCCAAGTC | not found | Oryza sativa L. | not found | leaf | CRISPR-Cas9 |
| PCdb_5935 | 26891616 | LOC_Os03g55600 | LOC_Os03g55600 (hypothetical) | ATTGTCATGGAATATGCCTC | not found | Oryza sativa L. | not found | leaf | CRISPR-Cas9 |
| PCdb_5936 | 37810390 | PsLOX2 | Lipoxygenase (jasmonate biosynthesis) | ATTGGTGGTGGAAACGTCCATGG | not found | Glycine max (L.) Merr. | not found | not found | CRISPR-Cas9 |
| PCdb_5937 | 28936222 | Rfg1 | Restricts Nodulation by Sinorhizobium fredii USDA193 | ATTGATGAGGACTTAAAAAGCTC | not found | Glycine max (L.) Merr. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5938 | 28936222 | Rfg1 | Restricts Nodulation by Sinorhizobium fredii USDA193 | ATTGACAGTAAGC CTTACTACCT | not found | Glycine max (L.) Merr. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5939 | 35567185 | OsbHLH024 | Basic helix-loop-helix transcription factor involved in plant development [Source: RAP-DB] | ATTCCACTCACTCAACCGAA | not found | Oryza sativa L. | not found | protoplast | not found |
| PCdb_5940 | 29226588 | SAG24 | Senescence-associated gene 24 (SAG24, leaf senescence) | ATGTTGGTATGAAGAGGAA | not found | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5941 | 29226588 | SAC52 | SAC52 secretory protein (unknown function) | ATGTTGGTATGAAGAGGAA | not found | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5942 | 29226588 | RPL10B | Ribosomal protein L10B (RPL10B, translation) | ATGTTGGTATGAAGAGGAA | not found | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5943 | 31370789 | 伪-gliadins | Alpha-gliadin storage protein | ATGGTTTGTGATGGAAA | not found | Triticum aestivum L. | 0.196 | embryo | CRISPR-Cas9 |
| PCdb_5944 | 37025130 | ZED1-related kinase 13 | ZED1-related kinase 13 (plant immune signaling) | ATGGGCTTCGATCTCCATGG | not found | Arabidopsis thaliana (L.) Heynh. | not found | seed | CRISPR-Cas9 |
| PCdb_5945 | 26582727 | Rj4 | Rj4 (Rhizobium japonicum symbiosis gene in soybean) | ATGGGAAATTCAACTAAAA | not found | Glycine max (L.) Merr. | not found | hairy root | CRISPR-Cas9 |
| PCdb_5946 | 26582727 | Rj4 | Rj4 (Rhizobium japonicum symbiosis gene in soybean) | ATGGCAAGTTCGACTAAAA | not found | Glycine max (L.) Merr. | not found | hairy root | CRISPR-Cas9 |
| PCdb_5947 | 37367609 | FGSG | Fusarium gene locus prefix | ATGCTCTCGATGGTCCACTG | not found | Triticum aestivum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5948 | 35003180 | VviDEL1 | Vitis vinifera DEL1 cell cycle regulator (VviDEL1, endoreduplication) | ATGCAGCAGTCACTAACAG | not found | Vitis vinifera L. | not found | calli | CRISPR-Cas9 |
| PCdb_5949 | 36187979 | HXK2 | Hexokinase-2 (glucose sensing and signaling) [Source: TAIR] | ATGACTTGTTCCAAAATGAG | not found | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5950 | 26891616 | OsFTL6 | Flowering locus T-like protein 6 | ATCTTCACTAGCCATGTCAA | not found | Oryza sativa L. | not found | leaf | CRISPR-Cas9 |
| PCdb_5951 | 32887261 | IPK | Inositol polyphosphate kinase | ATCTTCAAGGTCTACGTCGT | not found | Zea mays L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5952 | 26891616 | Os11g0549665 | not found | ATCTGGTGGGGCTGATCGGG | not found | Oryza sativa L. | not found | leaf | CRISPR-Cas9 |
| PCdb_5953 | 26891616 | LOC_Os02g34600 | LOC_Os02g34600 (hypothetical) | ATCGTCATGGAGTACGCCGC | not found | Oryza sativa L. | not found | leaf | CRISPR-Cas9 |
| PCdb_5954 | 32152597 | WEBG | WEB protein (function not fully characterized) | ATCGGTAATTTTATATTGC | not found | Zea mays L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5955 | 26891616 | MPK1 | Mitogen-activated protein kinase 1, essential for stress and hormone signaling | ATCCAGGCGACGCTGAGCCA | not found | Oryza sativa L. | not found | leaf | CRISPR-Cas9 |
| PCdb_5956 | 33772993 | ZmTGA9 | TGA transcription factor 9 (salicylic acid signaling) | ATCCAGAAGAAGCAGCGCT | not found | Zea mays L. | not found | anther | CRISPR-Cas9 |
| PCdb_5957 | 30083222 | At3g04220 | Heat shock protein 101 (At3g04220, stress response) | ATCACACATACCATGAGAAG | not found | Arabidopsis thaliana (L.) Heynh. | 35-83% | protoplast | not found |
| PCdb_5958 | 37620620 | CI | Cytoplasmic inclusion protein (viral movement protein in some plant viruses) | ATCAATGCATCCTGTCATACATGACATT | not found | Solanum tuberosum L. | not found | not found | CRISPR-Cas13 |
| PCdb_5959 | 30803101 | CI | forms the laminate cytoplasmic inclusion bodies | ATCAATGCATCCTGTCATACATGACAT | not found | Solanum tuberosum L. | not found | protoplast | CRISPR-Cas13 |
| PCdb_5960 | 27622539 | GLV8_1 | GOLVEN peptide 8 | atcaatcccaaaaagaagaa | not found | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5961 | 37529831 | CAT1 | Catalase 1, primary hydrogen peroxide scavenger in peroxisomes (core antioxidant enzyme) | ATCAAATGCCTGTCGGATG | not found | Arabidopsis thaliana (L.) Heynh. | not found | seed | CRISPR-Cas9 |
| PCdb_5962 | 29575603 | CAT1 | Catalase 1, primary hydrogen peroxide scavenger in peroxisomes (core antioxidant enzyme) | ATCAAATGCCTGTC | not found | Arabidopsis thaliana (L.) Heynh. | not found | Peroxisomes | CRISPR-Cas9 |
| PCdb_5963 | 37529831 | CAT1 | Catalase 1, primary hydrogen peroxide scavenger in peroxisomes (core antioxidant enzyme) | ATCAAATGCC TGTCGGATG | not found | Arabidopsis thaliana (L.) Heynh. | not found | seed | CRISPR-Cas9 |
| PCdb_5964 | 37233025 | dTALe-dependent gl3 | Transcription activator-like effector (TALE)-modified GLABRA3 transcription factor | ATATAGCAAAGCTCTC | not found | Zea mays L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5965 | 26891616 | LOC_Os03g27280 | LOC_Os03g27280 (hypothetical) | ATAGTTATGGAATATGCTGC | not found | Oryza sativa L. | not found | leaf | CRISPR-Cas9 |
| PCdb_5966 | 37816147 | NOR | Non-ripening (NOR) transcription factor controlling fruit maturation | ATAGTACCAGGGAGTTCCCA | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5967 | 37367609 | FGSG | Fusarium gene locus prefix | ATAGACTCGATGGTCCACAT | not found | Triticum aestivum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5968 | 37816147 | CPK28 | Calcium-dependent protein kinase 28 | ATACATCAAGAAAACAAGAG | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5969 | 36704157 | Snn5 | Sensitivity gene for SnTox5 effector from Parastagonospora nodorum | ATACAATGGAGAACTAGTTA | not found | Triticum aestivum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5970 | 37233025 | dTALe-dependent gl3 | Transcription activator-like effector (TALE)-modified GLABRA3 transcription factor | ATAATATAACGAACCA | not found | Zea mays L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5971 | 29087011 | Hen1b | RNA methyltransferase HEN1 homolog B (small RNA stabilization) | AGTTTCTTGCTACTTCTGAA | not found | Glycine max (L.) Merr. | not found | hairy root | CRISPR-Cas9 |
| PCdb_5972 | 29087011 | Hen1a | RNA methyltransferase HEN1 homolog A (small RNA stabilization) | AGTTTCTTGCTACTTCTGAA | not found | Glycine max (L.) Merr. | not found | hairy root | CRISPR-Cas9 |
| PCdb_5973 | 31673276 | TaABCC6 & TaNFXL1 & TansLTP9.4 | Combination: ABCC6 transporter; NFXL1 zinc-finger regulator; nsLTP9.4 lipid-transfer protein | AGTGCTGCTCCGGCGTGCAG | not found | Triticum aestivum L. | 0.153 | protoplast | CRISPR-Cas9 |
| PCdb_5974 | 31469505 | SLR1 | DELLA protein repressing gibberellin signaling | AGTGCACGGTGTCCGTGGCC | not found | Oryza sativa L. | 0.175 | calli | ABE |
| PCdb_5975 | 30467959 | CGF3 | Cucumber green mottle mosaic virus factor 3 (viral pathogenicity factor) | AGTGATGGACGTGGACCGTA | not found | Gossypium hirsutum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5976 | 37816147 | NOR | Non-ripening (NOR) transcription factor controlling fruit maturation | AGTCGCCGGCGCTCCGATTC | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5977 | 37402157 | OsEPSPS | Oryza sativa 5-enolpyruvylshikimate-3-phosphate synthase (OsEPSPS, aromatic amino acid biosynthesis) | AGTCGACATTCGCACCAAGTTGT | not found | Oryza sativa L. | not found | protoplast | Base editor |
| PCdb_5978 | 35003180 | VviLIN2 | Vitis vinifera lin2 nodulin-like protein (VviLIN2, nitrogen metabolism) | AGTCATATCTTGCCACCCA | not found | Vitis vinifera L. | not found | calli | CRISPR-Cas9 |
| PCdb_5979 | 31673276 | TaABCC6 & TaNFXL1 & TansLTP9.4 | Combination: ABCC6 transporter; NFXL1 zinc-finger regulator; nsLTP9.4 lipid-transfer protein | AGTACTCACGGAGATCCAAG | not found | Triticum aestivum L. | 0.044 | protoplast | CRISPR-Cas9 |
| PCdb_5980 | 26891616 | LOC_Os07g35870 | LOC_Os07g35870 (hypothetical) | AGTACAAGTTTATTTTTTTC | not found | Oryza sativa L. | not found | leaf | CRISPR-Cas9 |
| PCdb_5981 | 37533135 | SHATTERING1 | controls activation rather than patterning of the abscission zone | AGTAATAGCATGCTGAACAT | not found | Setaria viridis (L.) P. Beauv. | not found | abscission zone,abscission,Abscission | CRISPR-Cas9 |
| PCdb_5982 | 37437572 | FLYC | FLYC (Arabidopsis thaliana FLOWERING LOCUS Y COMPLEX, chromatin remodeling complex subunit) [Source: TAIR] | AGGTTCTCGAGGGCGATGCC | not found | Dionaea muscipula J.Ellis | not found | not found | not found |
| PCdb_5983 | 34727228 | OsSPL4 | Oryza sativa SQUAMOSA promoter-binding protein-like 4 (OsSPL4, developmental regulation) | AGGTGCCAGGTGGAAGGGTG | not found | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5984 | 26891616 | CDKB2 | Cyclin-dependent kinase B (CDKB) | AGGTCGGGGAGGGGACGTAC | not found | Oryza sativa L. | not found | leaf | CRISPR-Cas9 |
| PCdb_5985 | 37985755 | TaLHP1 | Wheat LIKE HETEROCHROMATIN PROTEIN 1 | AGGTCCTATGGCAAGCGCAA | not found | Triticum aestivum L. | not found | not found | CRISPR-Cas9 |
| PCdb_5986 | 37237553 | GmAHAS 2 | Acetohydroxyacid synthase | AGGTCCCCCGGCGCATGAT | not found | Glycine max (L.) Merr. | not found | protoplast | CRISPR-Cas9,Base editor |
| PCdb_5987 | 37237553 | GmAHAS 34 | Acetohydroxyacid synthase | AGGTCCCCCGCCGCATGAT | not found | Glycine max (L.) Merr. | not found | protoplast | CRISPR-Cas9,Base editor |
| PCdb_5988 | 37302187 | OsPDR18 | ABC transporter (PDR family) | AGGTATGACAGAGGGTCGAC | not found | Oryza sativa L. | not found | shoot | CRISPR-Cas9 |
| PCdb_5989 | 34579415 | StPPO2C | Potato polyphenol oxidase 2C (StPPO2C, enzymatic browning) | AGGGCTTGAAGTTACGCCA | not found | Solanum tuberosum L. | not found | leaf | CRISPR-Cas9 |
| PCdb_5990 | 37993454 | GmSNAPO2 | Soluble NSF attachment protein (vesicle trafficking) | AGGGCCGAGGATTTTGAGAACA | not found | Glycine max (L.) Merr. | not found | not found | CRISPR-Cas9 |
| PCdb_5991 | 33772993 | ZmMYB33 | MYB transcription factor 33 (ZmMYB33, developmental regulation) | AGGCCCAACCTCAAGAAGG | not found | Zea mays L. | not found | anther | CRISPR-Cas9 |
| PCdb_5992 | 33772993 | ZmMYB33 | MYB transcription factor 33 (ZmMYB33, developmental regulation) | AGGCCCAACCTCAAGAAGG | not found | Zea mays L. | not found | anther | CRISPR-Cas9 |
| PCdb_5993 | 38005712 | MIR2118 | MicroRNA 2118 (antiviral defense) [Source: miRBase] | AGGAGCAC-CTAAGAACGAT | not found | Oryza sativa L. | not found | not found | CRISPR-Cas9 |
| PCdb_5994 | 38005712 | MIR2118 | MicroRNA 2118 | AGGAGCACCTAAGAACGAT | not found | Oryza sativa L. | not found | not found | CRISPR-Cas9 |
| PCdb_5995 | 31134125 | OsALS | Acetolactate synthase involved in branched-chain amino acid biosynthesis [Source: RiceWiki] | AGCTTCCTCATGAACATTCA | not found | Oryza sativa L. | 0.2 | calli | CBE |
| PCdb_5996 | 0 | Solyc02g076980(Cathepsin B1) | Cathepsin B1 cysteine protease | AGCTCGTGTCTCTCAGACA | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_5997 | 32887261 | IPK | inositol phosphate kinase gene | AGCTCGACCACGCCGCCGAC | not found | Zea mays L. | 0.8-5.85% | protoplast | CRISPR-Cas9 |
| PCdb_5998 | 34713247 | not found | not found | AGCTCCGGCAGCCCTAGGCG | not found | Oryza sativa L. | not found | protoplast | CRISPR-Cas9,Prime editor |
| PCdb_5999 | 33263914 | not found | not found | AGCGCACCTCAAACAAGCCT | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_6000 | 33277994 | SlLAM1 | controls compound leaf and floral organ development in Solanum lycopersicum | AGCACTGGCCATCCCCAACA | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_6001 | 37047628 | OsC1 | R2R3-MYB transcription factor C1 (anthocyanin regulator) | AGCACGCTCAGCCGCAAGAT | not found | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_6002 | 37816147 | RCMI | Regulator of cell cycle and meiosis I | AGCACCGATTTTCTCCCAAA | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_6003 | 26891616 | LOC_Os10g41490 | LOC_Os10g41490 (hypothetical) | AGATTGATGAAAATGTGCAG | not found | Oryza sativa L. | not found | leaf | CRISPR-Cas9 |
| PCdb_6004 | 26891616 | LOC_Os12g39630 | LOC_Os12g39630 (hypothetical) | AGATTGACGAGAACGTGCAG | not found | Oryza sativa L. | not found | leaf | CRISPR-Cas9 |
| PCdb_6005 | 26891616 | MPK5 | Mitogen-activated protein kinase 5, involved in disease resistance signaling | AGATGTCGTAGAGCAGGTAC | not found | Oryza sativa L. | not found | leaf | CRISPR-Cas9 |
| PCdb_6006 | 26891616 | CDKA2 | Cyclin-dependent kinase A (CDKA) | AGATCGGGGAGGGGACGTAC | not found | Oryza sativa L. | not found | leaf | CRISPR-Cas9 |
| PCdb_6007 | 26891616 | AtADH1 | Alcohol dehydrogenase (EC 1.1.1.1) | AGAGTTTTCCCAGTTCCCGT | not found | Oryza sativa L. | not found | leaf | CRISPR-Cas9 |
| PCdb_6008 | 26891616 | AtFT | Florigen (FT) | AGAGTGATTGATCTATTAAA | not found | Oryza sativa L. | not found | leaf | CRISPR-Cas9 |
| PCdb_6009 | 26891616 | Os05g0591600 | NBS-LRR disease resistance protein [Source: RAP-DB] | AGAGGATCGGCTATAATACC | not found | Oryza sativa L. | not found | leaf | CRISPR-Cas9 |
| PCdb_6010 | 37816147 | Sp5G | SQUAMOSA-promoter binding-like protein 5G | AGAGATCCATAGTTTC | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_6011 | 26891616 | TaINOX | Ovule outer integument transcription factor (TaINOX) | AGACGTACGAGTTTGTGCAG | not found | Oryza sativa L. | not found | leaf | CRISPR-Cas9 |
| PCdb_6012 | 30272679 | APOBEC1 | Cytidine deaminase enzyme involved in RNA editing and DNA mutation processes | AGACAAGCTTGGCCCTCTTT | not found | Oryza sativa L. | 0.2 | protoplast | PBE |
| PCdb_6013 | 31469505 | OsDEP1 | Dense and erect panicle gene controlling panicle architecture | AGACAAGCTTGGCCCTCTTT | not found | Oryza sativa L. | 0.8 | calli | ABE |
| PCdb_6014 | 35098208 | not found | not found | AGAATACCACAAGTTACGAAA | not found | Glycine max (L.) Merr. | not found | protoplast | CRISPR-Cas12 |
| PCdb_6015 | 38005777 | SAUR10 | Involved in the Promotion of Seedling Growth in Rice | AGAAGGAGCGGTTCGCGGTG | not found | Oryza sativa L. | not found | not found | CRISPR-Cas9 |
| PCdb_6016 | 36145794 | UGT76G1 | UDP-glycosyltransferase 76G1, modifies steviol glycosides in Stevia rebaudiana | ACTTCTATACAGCCCCCTTT | not found | Stevia rebaudiana (Bertoni) Bertoni | 14.16-93.68 | protoplast | CRISPR-Cas9 |
| PCdb_6017 | 35631786 | AhFAD2 | Arachis hypogaea fatty acid desaturase 2, converts oleic acid to linoleic acid | ACTTACTCTTCTACATTGCC | not found | Arachis hypogaea L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_6018 | 29162881 | not found | not found | ACTGCCGCCGCCACAGCCAC | not found | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_6019 | 33767722 | GmNHX5 | Positively Regulates Salt Tolerance | ACTCCTTTAGTACTCAGTCT | not found | Glycine max (L.) Merr. | not found | protoplast | CRISPR-Cas9 |
| PCdb_6020 | 30272679 | APOBEC1 | Cytidine deaminase enzyme involved in RNA editing and DNA mutation processes | ACTAGATATCTAAACCATTA | not found | Oryza sativa L. | 0.25 | protoplast | PBE |
| PCdb_6021 | 31469505 | OsNRT1.1B | Nitrate transporter regulating nitrogen use efficiency | ACTAGATATCTAAACCATTA | not found | Oryza sativa L. | 0.729 | calli | ABE |
| PCdb_6022 | 37816147 | TAGL1 | Tomato AGAMOUS-like MADS-box TAGL1 | ACGTTCTGCAAGCGTAGAAA | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_6023 | 37816147 | HD8 | Homeobox-domain protein HD-ZIP 8 | ACGGTTCCGATTCTCATCGG | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_6024 | 33772993 | ZmPHD11 | PHD-finger protein 11 (ZmPHD11, chromatin remodeling) | ACGCGCGTGTACCCGTTGC | not found | Zea mays L. | not found | anther | CRISPR-Cas9 |
| PCdb_6025 | 0 | Solyc08g081210(MKKK66) | MAP kinase kinase kinase 66 | ACGCCAGATTCACGCAGTC | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_6026 | 26891616 | Os10g0484800 | Receptor-like protein kinase [Source: RGAP] | ACCTTGGATTCGGCGATGCC | not found | Oryza sativa L. | not found | leaf | CRISPR-Cas9 |
| PCdb_6027 | 35168613 | GmPDS18g | Glycine max phytoene desaturase 18g (carotenoid biosynthesis) [Source: SoyBase] | ACCTGAACGGGTAACTGATG | not found | Glycine max (L.) Merr. | not found | leaf | CRISPR-Cas9 |
| PCdb_6028 | 26891616 | AtTT4 | Chalcone synthase (TT4) | ACCTCCGGCGTCGACATGCC | not found | Oryza sativa L. | not found | leaf | CRISPR-Cas9 |
| PCdb_6029 | 30272679 | TaLOX2 | Wheat lipoxygenase 2 | ACCTACGTCGACCTCTCTCC | not found | Triticum aestivum L. | 0.12 | protoplast | PBE |
| PCdb_6030 | 31872309 | OsLOGL5 | improves grain yield under various field conditions in rice | ACCGTATCGGAGCAGCACGC | not found | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_6031 | 35652435 | PI | PISTILLATA floral homeotic protein (PI, flower development) | ACCCTCTCTTCTCCGACATAATCTGCTT | not found | Solanum tuberosum L. | 0.5 | calli | CRISPR-Cas13 |
| PCdb_6032 | 35652435 | PI | PISTILLATA floral homeotic protein (PI, flower development) | ACCCTCTCTTCTCCGACATAATCTGCTT | not found | Solanum tuberosum L. | not found | calli | CRISPR-Cas13 |
| PCdb_6033 | 36704157 | Tsn1 | Sensitivity gene for host-selective toxin produced by wheat tan spot fungus | ACCATAAAGGGGATTTGTGA | not found | Triticum aestivum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_6034 | 33772993 | ZmLBD27 | Lateral organ boundaries domain protein 27 (ZmLBD27, organ development) | ACCACCACCAGTATGCCGC | not found | Zea mays L. | not found | anther | CRISPR-Cas9 |
| PCdb_6035 | 31134125 | OsALS | Acetolactate synthase involved in branched-chain amino acid biosynthesis [Source: RiceWiki] | ACCAACCACCTCTTCCGCCA | not found | Oryza sativa L. | 0.02 | calli | CBE |
| PCdb_6036 | 37908495 | GmELF3-1 | EARLY FLOWERING 3 homolog (circadian clock) | ACATGTAGTCTAGGGAACAT | not found | Glycine max (L.) Merr. | not found | not found | CRISPR-Cas9 |
| PCdb_6037 | 34713245 | crNtPDS-1 | Phytoene desaturase, catalyzes phytoene to 味-carotene conversion (carotenoid pathway) | ACATGGCAATGAACACCTCATCTG | not found | Nicotiana attenuata Torr. ex S.Watson | not found | protoplast | CRISPR-Cas12 |
| PCdb_6038 | 31401729 | crNtPDS | Cryptochrome Nicotiana tabacum phytoene desaturase (light-regulated carotenoid enzyme) | ACATGGCAATGAACACCTCATCTG | not found | Nicotiana tabacum L. | not found | protoplast | CRISPR-Cas9,CRISPR-Cas12,SaCas9,Target-AID |
| PCdb_6039 | 31872309 | OsLOGL5 | LONELY GUY-like 5 enzyme involved in cytokinin activation | ACATCTCCCAGGTGAGCTTC | not found | Oryza sativa L. | not found | protoplast | not found |
| PCdb_6040 | 0 | Solyc12g038510 | Solyc12g038510 (not found) | ACATATTCTTGGAGAGGATT | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_6041 | 29972722 | gl2 | glabra2 (epidermal cell fate regulator) [Source: TAIR] | ACAGAUCACAAACUUCAAAUG | not found | Zea mays L. | 0.065 | embryo | CRISPR-Cas9 |
| PCdb_6042 | 29867128 | AtALS & AtPDS & AtFT & AtLFY | Acetolactate synthase (ALS), Phytoene desaturase (PDS), Flowering locus T (FT), and Leafy (LFY) - Multiple gene targets for plant genetic studies | ACAGAAGTACTTAGCTTCCA | not found | Arabidopsis thaliana (L.) Heynh. | 0.011 | protoplast | ABE |
| PCdb_6043 | 33024447 | ChlH | Magnesium-chelatase H subunit | acactattataattatgcaa | not found | Zea mays L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_6044 | 30272679 | APOBEC1 | Cytidine deaminase enzyme involved in RNA editing and DNA mutation processes | ACACACACACTAGTACCTCT | not found | Oryza sativa L. | 0.12 | protoplast | PBE |
| PCdb_6045 | 32887261 | IPK | Inositol polyphosphate kinase | ACAAGCTCTACGGAGACGAC | not found | Zea mays L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_6046 | 36436609 | VaBAM 1 | Vigna angularis amylase 1 (VaBAM1, starch degradation) | ACAACTGGCCAGAAGATGCA | not found | Vitis vinifera L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_6047 | 36704157 | Pi21 | Blast resistance protein Pi21 (disease resistance) | ACAACAGGGTGATCGTCCGT | not found | Triticum aestivum L. | 2.5-50% | embryo | CRISPR-Cas9 |
| PCdb_6048 | 27918538 | SELF PRUNING | SELF-PRUNING flowering regulator | ACAACAGACATCTTAACACT | not found | Solanum lycopersicum L. | not found | seed | CRISPR-Cas9 |
| PCdb_6049 | 0 | Solyc06g074350 | Tomato thaumatin-like protein (Solyc06g074350, pathogenesis-related) | ACAACAGACATCTTAACACT | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_6050 | 30467959 | CGF3 | Cucumber green mottle mosaic virus factor 3 (viral pathogenicity factor) | AATTGGGGTCCAGTTTCGAG | not found | Gossypium hirsutum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_6051 | 35652435 | CI | Cytoplasmic inclusion protein (viral movement protein in some plant viruses) | AATGTCATGTATGACAGGATGCATTGAT | not found | Solanum tuberosum L. | not found | calli | CRISPR-Cas13 |
| PCdb_6052 | 31370789 | 伪-gliadins | Alpha-gliadin storage protein | AATGGTTGTGTGTGGTTGCTG | not found | Triticum aestivum L. | 0.196 | embryo | CRISPR-Cas9 |
| PCdb_6053 | 29881395 | not found | not found | AATGGCGTAGTCCTCAACAG | not found | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_6054 | 34217355 | fw2.2 | provides an excellent source of candidates for fruit size regulation in other domesticated species | AATGAGAGGGCAATATGATC | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_6055 | 34305978 | BnGTR1 | Glucosinolate transporter 1 | AATGAGACATTTGAGAAGAT | not found | Brassica napus L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_6056 | 27622539 | GLV2_2 | GOLVEN peptide 2 | aatagaacgctattggttg | not found | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_6057 | 29972722 | not found | not found | AAGUGGGCGCAGAUCCUGAG | not found | Zea mays L. | 0.103 | embryo | CRISPR-Cas9 |
| PCdb_6058 | 30610638 | F3H | f2kp2 (Fructose-6-phosphate,2-kinase/fructose-2,6-bisphosphatase 2, sugar metabolism) [Source: UniProt] | AAGTTTTGTCAGAGGCCAT | not found | Daucus carota subsp. sativus (Hoffm.) Sch眉bl. & G.Martens | not found | Bony Callus | CRISPR-Cas9 |
| PCdb_6059 | 33263914 | not found | not found | AAGTTGAAGTGGTATAGATG | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_6060 | 27622539 | GLV10_1 | GOLVEN peptide 10 | aaggatcattgaagcaaca | not found | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_6061 | 36145794 | UGT76G1 | UDP-glycosyltransferase 76G1, modifies steviol glycosides in Stevia rebaudiana | AAGCTTGTGCTTTAGGCCC | not found | Stevia rebaudiana (Bertoni) Bertoni | 14.16-93.68 | protoplast | CRISPR-Cas9 |
| PCdb_6062 | 31821678 | MIR | MicroRNA gene (non-coding RNA regulation) [Source: miRBase] | AAGCTCAGGAGGGATAGCGCC | not found | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9,TALEN |
| PCdb_6063 | 37025130 | ZED1-related kinase 13 | ZED1-related kinase 13 (plant immune signaling) | AAGCTAATATTGGAGAGAGG | not found | Arabidopsis thaliana (L.) Heynh. | not found | seed | CRISPR-Cas9 |
| PCdb_6064 | 36714709 | BrFT | FLOWERING LOCUS T homolog (BrFT) | AAGCCAAGAGTTGAGAT | not found | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_6065 | 34713245 | NbSGS3 | Suppressor of gene silencing 3 (RNAi pathway) [Source: SolGenomics] | AAGCAGTGCTGGGAAGCAAT | not found | Nicotiana attenuata Torr. ex S.Watson | not found | protoplast | SpCas9 |
| PCdb_6066 | 26891616 | Os05g0312500 | Protein kinase domain-containing protein [Source: RGAP] | AAGATCCATGAGTTCAAGAA | not found | Oryza sativa L. | not found | leaf | CRISPR-Cas9 |
| PCdb_6067 | 27622539 | GLV8_2 | GOLVEN peptide 8 | aagacaagcaataaagctg | not found | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_6068 | 34371684 | TaBAK1-2 | BRI1-associated receptor kinase 1 | AACTTGGAGGGTGCTAATAT | not found | Triticum aestivum L. | not found | embryo | CRISPR-Cas9 |
| PCdb_6069 | 26891616 | Os06g0275000-A | DUF640 domain-containing protein (isoform A) [Source: RGAP] | AACGTGTTCGACCAGGAGGT | not found | Oryza sativa L. | not found | leaf | CRISPR-Cas9 |
| PCdb_6070 | 26891616 | Os05g0543000 | Pentatricopeptide repeat-containing protein [Source: RGAP] | AACCTGATCACCAACCCACT | not found | Oryza sativa L. | not found | leaf | CRISPR-Cas9 |
| PCdb_6071 | 29692796 | ERECTA | Deciphering the Evolutionary Trajectory and Phenotypic | AACCTATCCGGGCTCAACCT | not found | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_6072 | 31015088 | not found | not found | AACAGACCCACTAGACTA | not found | Oryza sativa L. | not found | chloroplast | CRISPR-Cas9 |
| PCdb_6073 | 0 | Solyc05g053850 | Tomato gibberellin-regulated protein (Solyc05g053850) | AACAATAGGGTGGTCTATAA | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_6074 | 37816147 | Sp5G | SQUAMOSA-promoter binding-like protein 5G | AACAATAGGGTGGTCTATAA | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_6075 | 29972722 | not found | not found | AACAAGUGGGCGCAGAUCCUGAG | not found | Zea mays L. | 53-87% | embryo | CRISPR-Cas12 |
| PCdb_6076 | 32094641 | not found | not found | AAATTCCCACGTCCGTTACA | not found | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_6077 | 0 | Solyc07g066230 | Tomato lipoxygenase (Solyc07g066230, oxylipin biosynthesis) | AAATTAACTCTGAGCAAAGT | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_6078 | 26891616 | Os03g0126800 | Serine/threonine-protein kinase SAPK7 [Source: RGAP] | AAATCCCAACTGCAAATACA | not found | Oryza sativa L. | not found | leaf | CRISPR-Cas9 |
| PCdb_6079 | 29087011 | Hen1b | RNA methyltransferase HEN1 homolog B (small RNA stabilization) | AAAGGGATCTCTGAATGTAA | not found | Glycine max (L.) Merr. | not found | hairy root | CRISPR-Cas9 |
| PCdb_6080 | 29087011 | Hen1a | RNA methyltransferase HEN1 homolog A (small RNA stabilization) | AAAGGGATCTCTGAATGTAA | not found | Glycine max (L.) Merr. | not found | hairy root | CRISPR-Cas9 |
| PCdb_6081 | 26365384 | not found | not found | AAAGAAAAAGTTGGAGAC | not found | Zea mays L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_6082 | 35955778 | not found | not found | AAACTTCGGATTTAGTTTAGGCCG | not found | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_6083 | 32508865 | PDS | a crucial enzyme in the chlorophyll biosynthesis pathway | AAACTGAGACCTTGGTCTCT | not found | Brachypodium distachyon (L.) P.Beauv. | not found | protoplast | CRISPR-Cas9 |
| PCdb_6084 | 36743495 | CpSRP54b N | Chloroplast signal recognition particle 54 subunit b (CpSRP54b) | aaacTCGCTTTCCAGTACCAGCGGc | not found | Oryza sativa L. | not found | leaf | CRISPR-Cas9 |
| PCdb_6085 | 36743495 | CpSRP54b C | Chloroplast signal recognition particle 54 subunit b (CpSRP54b) | aaacTCGCTTTCCAGTACCAGCGGc | not found | Oryza sativa L. | not found | leaf | CRISPR-Cas9 |
| PCdb_6086 | 36743495 | CpSRP54b | Photosynthesis in rice | aaacTCGCTTTCCAGTACCAGCGGc | not found | Panicum miliaceum L. | not found | leaf | CRISPR-Cas9 |
| PCdb_6087 | 36743495 | CpSRP54a | Photosynthesis in rice | aaacGTCGGACTCCTCTTATAAGAc | not found | Panicum miliaceum L. | not found | leaf | CRISPR-Cas9 |
| PCdb_6088 | 36743495 | CpSRP54a | Chloroplast signal recognition particle 54 kDa alpha subunit | aaacGTCGGACTCCTCTTATAAGAc | not found | Oryza sativa L. | not found | leaf | CRISPR-Cas9 |
| PCdb_6089 | 36743495 | CpSRP54a | Photosynthesis in rice | aaacGTCGGACTCCTCTTATAAGAc | not found | Panicum miliaceum L. | not found | leaf | CRISPR-Cas9 |
| PCdb_6090 | 36743495 | CpSRP 54 aN | Chloroplast signal recognition particle 54 kDa alpha subunit | aaacGTCGGACTCCTCTTATAAGAc | not found | Oryza sativa L. | not found | leaf | CRISPR-Cas9 |
| PCdb_6091 | 36061810 | GmHdz4 | Glycine max homeodomain leucine zipper 4 (developmental regulation) [Source: SoyBase] | AAACGTCCGAAAGAAAGGATAGGCCA | not found | Glycine max (L.) Merr. | not found | protoplast | CRISPR-Cas9 |
| PCdb_6092 | 28936222 | Rfg1 | Restricts Nodulation by Sinorhizobium fredii USDA193 | AAACGAGCTTTTTAAGTCCTCAT | not found | Glycine max (L.) Merr. | not found | protoplast | CRISPR-Cas9 |
| PCdb_6093 | 36743495 | CpSRP54b N | Chloroplast signal recognition particle 54 subunit b (CpSRP54b) | aaacCGTGGAACAAGCTGCGGGGAc | not found | Oryza sativa L. | not found | leaf | CRISPR-Cas9 |
| PCdb_6094 | 36743495 | CpSRP54b | Photosynthesis in rice | aaacCGTGGAACAAGCTGCGGGGAc | not found | Panicum miliaceum L. | not found | leaf | CRISPR-Cas9 |
| PCdb_6095 | 36743495 | CpSRP43N | Chloroplast signal recognition particle 43 kDa subunit | aaacCGGAGTACCTCGTCGAGTGGc | not found | Oryza sativa L. | not found | leaf | CRISPR-Cas9 |
| PCdb_6096 | 36743495 | CpSRP43 | Photosynthesis in rice | aaacCGGAGTACCTCGTCGAGTGGc | not found | Panicum miliaceum L. | not found | leaf | CRISPR-Cas9 |
| PCdb_6097 | 36743495 | CpSRP43C | Chloroplast signal recognition particle 43 kDa subunit | aaacCGGAGAACGTCGACGCCGAAc | not found | Oryza sativa L. | not found | leaf | CRISPR-Cas9 |
| PCdb_6098 | 36743495 | CpSRP43 | Photosynthesis in rice | aaacCGGAGAACGTCGACGCCGAAc | not found | Panicum miliaceum L. | not found | leaf | CRISPR-Cas9 |
| PCdb_6099 | 36743495 | CpSRP54b | Chloroplast signal recognition particle 54 subunit b (CpSRP54b) | aaacCGAATCACATCAGTGCCTACc | not found | Oryza sativa L. | not found | leaf | CRISPR-Cas9 |
| PCdb_6100 | 36743495 | CpSRP54b | Photosynthesis in rice | aaacCGAATCACATCAGTGCCTACc | not found | Panicum miliaceum L. | not found | leaf | CRISPR-Cas9 |
| PCdb_6101 | 36743495 | CpSRP54a | Chloroplast signal recognition particle 54 subunit a (CpSRP54a) | aaacCCTGGAACAAGCTGCGTGGCc | not found | Oryza sativa L. | not found | leaf | CRISPR-Cas9 |
| PCdb_6102 | 36743495 | CpSRP54a | Photosynthesis in rice | aaacCCTGGAACAAGCTGCGTGGCc | not found | Panicum miliaceum L. | not found | leaf | CRISPR-Cas9 |
| PCdb_6103 | 36743495 | CpSRP43 | Photosynthesis in rice | aaacCCGGGATCCACGAAGGCTCGc | not found | Panicum miliaceum L. | not found | leaf | CRISPR-Cas9 |
| PCdb_6104 | 37620620 | CP | Chloroplast protein (generic abbreviation; exact function context-dependent) | AAACCAATCGTTGAGAATGCAAAACCAA | not found | Solanum tuberosum L. | not found | not found | CRISPR-Cas13 |
| PCdb_6105 | 30803101 | CP | systemic movement and aphid transmission | AAACCAATCGTTCAGAATGCAAAACCAA | not found | Solanum tuberosum L. | not found | protoplast | CRISPR-Cas13 |
| PCdb_6106 | 36743495 | CpSRP54a C | Chloroplast signal recognition particle 54 subunit a (CpSRP54a) | aaacATGCGGGATATCAGAAGAGCC | not found | Oryza sativa L. | not found | leaf | CRISPR-Cas9 |
| PCdb_6107 | 36743495 | CpSRP54a | Photosynthesis in rice | aaacATGCGGGATATCAGAAGAGCc | not found | Panicum miliaceum L. | not found | leaf | CRISPR-Cas9 |
| PCdb_6108 | 28936222 | Rfg1 | Restricts Nodulation by Sinorhizobium fredii USDA193 | AAACAGGTAGTAAGGCTTACTGT | not found | Glycine max (L.) Merr. | not found | protoplast | CRISPR-Cas9 |
| PCdb_6109 | 36743495 | CpSRP54a | Photosynthesis in rice | aaacACCATCATATCTACAAATGCc | not found | Panicum miliaceum L. | not found | leaf | CRISPR-Cas9 |
| PCdb_6110 | 29867128 | AtALS & AtPDS & AtFT & AtLFY | Acetolactate synthase (ALS), Phytoene desaturase (PDS), Flowering locus T (FT), and Leafy (LFY) - Multiple gene targets for plant genetic studies | AAACAACCAGCATCTTGGCA | not found | Arabidopsis thaliana (L.) Heynh. | 0.0161 | protoplast | ABE |
| PCdb_6111 | 31742855 | NLR | confers partial resistance to Magnaporthe oryzae in rice | AAAAGACGGTCCGGGATATG | not found | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_6112 | 27622539 | CLE18_2 | CLAVATA3/ESR-related peptide 18 | aaaacaatatcgaccggtct | not found | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_6113 | 35506331 | AtC2GnT | AtC2GnT | 6-N-acetylglucosaminyltransferase (core 2 glycan branching) | not found | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_6114 | 34579415 | StBAM1A | Potato beta-amylase 1A (StBAM1A, starch degradation) | TGAGTCTGCCACACCAGAT | not found | Solanum tuberosum L. | not found | leaf | CRISPR-Cas9 |
| PCdb_6115 | 24854982 | OsMYB5 | Oryza sativa MYB5 transcription factor (OsMYB5, secondary metabolism) | GTAGCCCTGCTGTTGAAGAA | not found | Oryza sativa L. | 21.1-66.7% | embryo | CRISPR-Cas9 |
| PCdb_6116 | 35394503 | CmCTR1-like | the importance of ROS1-mediated DNA demethylation for triggering fruit ripening in melon. | GGGGTCGACTGTACACTATA | not found | Solanum lycopersicum L. | 0.25 | protoplast | CRISPR-Cas9 |
| PCdb_6117 | 0 | Solyc08g074760 | Tomato polygalacturonase (Solyc08g074760, fruit softening enzyme) | GGAAGGTTTCCCAACTCATC | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_6118 | 35982368 | hinT1 | increase grain hardness and reduce grain width in barley | CGTGGGTCTGCTTGCTTTGG | not found | Hordeum vulgare L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_6119 | 35394503 | CmROS1 | the importance of ROS1-mediated DNA demethylation for triggering fruit ripening in melon. | AACATCTAGTCCAGCTAGTC | not found | Solanum lycopersicum L. | 0.75 | protoplast | CRISPR-Cas9 |
| PCdb_6120 | 35394503 | CmROS1 | the importance of ROS1-mediated DNA demethylation for triggering fruit ripening in melon. | AACAGGCGCATCGACTGATA | not found | Solanum lycopersicum L. | 0.75 | protoplast | CRISPR-Cas9 |
| PCdb_6121 | 39995605 | SRFR1 | Adaptor protein negatively regulating effector triggered immunity (ETI)-associated transcriptional immune responses | not found | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_6122 | 39995605 | SlWak1 | Flagellin-mediated pattern triggered immunity (PTI) | not found | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_6123 | 39995605 | SlPMR4 | Callose synthesis at infection sites; repress salicylic acid (SA)-associated defense pathway | not found | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_6124 | 39995605 | SlPMR | Callose synthesis at infection sites; repress SA-associated defense pathway | not found | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_6125 | 39995605 | SlPLC2 | Susceptibility gene facilitating pathogen infection and proliferation | not found | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_6126 | 39995605 | SlPelo | Messenger RNA surveillance factor involved in ribosome recycling | not found | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_6127 | 39995605 | SlNRX1 | Nucleoredoxin modulating the redox states of immune signaling proteins and negatively regulating plant immunity | not found | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_6128 | 39995605 | SlMlo1 | Susceptibility factor of fungal PM | not found | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_6129 | 39995605 | SlJAZ2 | Co-receptor of coronatine in stomatal guard cells | not found | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_6130 | 39995605 | SlHyPRP1 | Hybrid proline-rich protein involved in cell-wall signaling, plant development, and stress responses | not found | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_6131 | 39995605 | SlDMR6-1 | SA-5 hydroxylase involved in the SA catabolic pathway | not found | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_6132 | 39995605 | SlBBX20 | Suppressing Jasmonic acid (JA) signaling | not found | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_6133 | 39995605 | PL | Pectate lyase involved in cell wall degradation during fruit ripening | not found | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_6134 | 39995605 | LeEIX1 | Cell-surface receptor binding to fungal elicitor EIX; attenuating EIX induced immune response | not found | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_6135 | 39995605 | eIF4E1 | Aids the initiation of protein translation | not found | not found | Solanum lycopersicum L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_6136 | 38351739 | TaGW2 | E3 ubiquitin ligase that negatively regulates wheat grain size and thousand-grain weight via modulation of cell proliferation during grain development. | not found | not found | Triticum aestivum L. | not found | protoplast | CRISPR/Cas桅2 |
| PCdb_6137 | 39914488 | OsCOMT | Caffeic acid O-methyltransferase catalyzing methylation of caffeic acid in lignin biosynthesis and secondary cell wall formation in rice. | not found | not found | Oryza sativa L. | not found | seed | CRISPR/Cas9 |
| PCdb_6138 | 39693337 | JAZ10 | Resolves the growth versus defense dilemma | not found | not found | Oryza sativa L. | not found | seed | CRISPR/Cas9 |
| PCdb_6139 | 38968842 | SlWRKY37 | Regulates seed germination vigor | not found | not found | Solanum lycopersicum L. | not found | seed | CRISPR/Cas9 |
| PCdb_6140 | 38242376 | OsZIP16 | Cd sensitivity | not found | not found | Oryza sativa L. | not found | seed | CRISPR/Cas9 |
| PCdb_6141 | 40650151 | OsbZIP76 | ABA-Associated Immune | not found | not found | Oryza sativa L. | not found | protoplast | CRISPR/Cas9 |
| PCdb_6142 | 40647070 | ssIIa | Starch synthase IIa enzyme responsible for elongation of 伪-1,4 glucan chains during amylopectin biosynthesis in cereal endosperm. | not found | not found | Hordeum vulgare L. | not found | protoplast | CRISPR/Cas9 |
| PCdb_6143 | 40347261 | V-Ppase | plant architecture and early flowering | not found | not found | Oryza sativa L. | not found | protoplast | CRISPR/Cas9 |
| PCdb_6144 | 37792967 | ZmTKPR1鈥? and ZmTKPR1鈥? | Tetraketide pyrone reductases participating in sporopollenin biosynthesis and pollen exine formation in maize. | not found | not found | Zea mays L. | not found | protoplast | CRISPR/Cas9 |
| PCdb_6145 | 40534110 | BnaC01.CCT8 | Affecting auxin and jasmonic acid signalling | not found | not found | Brassica napus L. | not found | callus | CRISPR/Cas9 |
| PCdb_6146 | 39402219 | OsCYCB1 | Regulates Seed Callus Induction | not found | not found | Oryza sativa L. | not found | callus | CRISPR/Cas9 |
| PCdb_6147 | 39771236 | OsIAA19 | Encodes an Aux/IAA family transcriptional repressor regulating seed-specific traits such as grain shape, chalkiness, and seed germination. | not found | not found | Oryza sativa L. | not found | callus | CRISPR/Cas9 |
| PCdb_6148 | 39083143 | OsABA3 | Encodes a molybdenum cofactor sulfurase that catalyzes the sulfurization of molybdenum cofactor in the final step of abscisic acid (ABA) biosynthesis, regulating seed dormancy and preharvest sprouting resistance. | not found | not found | Oryza sativa L. | not found | callus | CRISPR/Cas9 |
| PCdb_6149 | 38804089 | BnaAPX1 | Ascorbate peroxidase 1 catalyzes Hdetoxification to maintain ROS homeostasis | not found | not found | Brassica napus L. | not found | callus | CRISPR/Cas9 |
| PCdb_6150 | 38276765 | OsHsp20-25 | Small heat shock protein OsHsp20-25, from long-lived mRNA, regulates seed size and germination rate | not found | not found | Oryza sativa L. | not found | callus | CRISPR/Cas9 |
| PCdb_6151 | 40609909 | ClNAC100 | NAC family transcription factor implicated in abiotic stress responses, senescence, and developmental regulation. | not found | not found | Citrullus lanatus (Thunb.) Matsum. & Nakai | not found | calli | CRISPR/Cas9 |
| PCdb_6152 | 40344303 | OsPRK1/2/3 | These pollenreferred receptorke kinases mediate ROS signaling for pollen hydration and tube germination, redundantly regulating pollen germination and fertilization in rice . | not found | not found | Oryza sativa L. | not found | calli | CRISPR/Cas9 |
| PCdb_6153 | 40076994 | OsRNE | Required for chloroplast development and seedling growth | not found | not found | Oryza sativa L. | not found | calli | CRISPR/Cas9 |
| PCdb_6154 | 39810027 | OsLOX1 | Positively regulates seed vigor and drought tolerance in rice. | not found | not found | Oryza sativa L. | not found | calli | CRISPR/Cas9 |
| PCdb_6155 | 39273285 | SlHB8 | Regulates tapetal PCD to modulate pollen cold tolerance. | not found | not found | Oryza sativa L. | not found | calli | CRISPR/Cas9 |
| PCdb_6156 | 38396893 | OsLRR-RLP2 | Encodes an LRR-domain receptor-like protein that mediates pattern-triggered immunity (PTI) and ROS/MAPK signaling to enhance resistance against rice blast disease | not found | not found | Oryza sativa L. | not found | calli | CRISPR/Cas9 |
| PCdb_6157 | 38345432 | GmGDPD2 | Glycerophosphodiester phosphodiesterase that hydrolyzes glycerophosphodiesters to glycerol-3-phosphate; participates in phosphate mobilization and membrane lipid remodeling under phosphate starvation. | not found | not found | Glycine max (L.) Merr. | not found | calli | CRISPR/Cas9 |
| PCdb_6158 | 39690508 | TaSBEIIa | Starch branching enzyme IIa catalyzing 伪-1,6 branch formation in amylopectin, impacting starch structure and grain quality in wheat. | not found | not found | Triticum aestivum L. | 63.25-88.99% | protoplast | Cas12i3, Cas12i3鈥?M, T5E鈥怌as12i3鈥?M |
| PCdb_6159 | 39690508 | TaPsIPK1 | Inositol-polyphosphate kinase 1 involved in phytic acid biosynthesis and phosphate storage in wheat seeds. | not found | not found | Triticum aestivum L. | 63.25-88.99% | protoplast | Cas12i3, Cas12i3鈥?M, T5E鈥怌as12i3鈥?M |
| PCdb_6160 | 39690508 | TaHRC鈥怐 | Wheat HRC homolog with currently uncharacterized function; may participate in defense or developmental regulation. | not found | not found | Triticum aestivum L. | 63.25-88.99% | protoplast | Cas12i3, Cas12i3鈥?M, T5E鈥怌as12i3鈥?M |
| PCdb_6161 | 39690508 | TaARE1鈥怉/B/D | Wheat ARE1 homologs with uncharacterized roles; likely involved in regulatory or stress-responsive pathways depending on gene family context. | not found | not found | Triticum aestivum L. | 63.25-88.99% | protoplast | Cas12i3, Cas12i3鈥?M, T5E鈥怌as12i3鈥?M |
| PCdb_6162 | 33346897 | Pp3c25_2610V1.1 (PHY1) | Physcomitrella phytochrome 1 (Pp3c25_2610V1.1, light sensing) | GACCCTCACACTATGCGCCT | TGG | Physcomitrella patens (Hedw.) Bruch & Schimp. | not found | protoplast | CRISPR-Cas9 |
| PCdb_6163 | 33015536 | AGO4 & NRPD1a & NRPE1 & RDR2 & RDR4 & RDR6 & CHLI1 & PIE1 | Multi-gene complex: RNA-directed DNA methylation machinery (small RNA biogenesis and chromatin modification) | TGCAAGAGGAACGTGTGAGG | TGG | Arabidopsis thaliana (L.) Heynh. | 0.05 | seed | CRISPR-Cas9 |
| PCdb_6164 | 33015536 | AGO4 & NRPD1a & NRPE1 & RDR2 & RDR4 & RDR6 & CHLI1 & PIE1 | Multi-gene complex: RNA-directed DNA methylation machinery (small RNA biogenesis and chromatin modification) | TGAAGTTGTCTGTTTCTCAG | TGG | Arabidopsis thaliana (L.) Heynh. | 0.08 | seed | CRISPR-Cas9 |
| PCdb_6165 | 33015536 | AGO4 & NRPD1a & NRPE1 & RDR2 & RDR4 & RDR6 & CHLI1 & PIE1 | Multi-gene complex: RNA-directed DNA methylation machinery (small RNA biogenesis and chromatin modification) | GTGGCTCTATTCTATGATGA | TGG | Arabidopsis thaliana (L.) Heynh. | 0.14 | seed | CRISPR-Cas9 |
| PCdb_6166 | 35604091 | BAHD acyltransferases | promotes tetracoumaroyl spermine accumulation in chicory | GACAGAAAATGTCTGCGAGC | TGG | Cichorium intybus L. | not found | hairy root | CRISPR-Cas9 |
| PCdb_6167 | 26839579 | Niben101Scf04551g02001 (XT2) | Xyloglucan endotransglucosylase/hydrolase protein 2 (cell wall modification) [Source: SolGenomics] | GAAAATTGGGAAAAAACTAG | TGG | Nicotiana attenuata Torr. ex S.Watson | not found | protoplast | CRISPR-Cas9 |
| PCdb_6168 | 25146436 | Hsp70b | the heat shock regulation | TCAAATCGGCTGAATTCTCC | GGG | Arabidopsis thaliana (L.) Heynh. | not found | protoplast | CRISPR-Cas9 |
| PCdb_6169 | 34899806 | GmAITR4 | Enhanced Salinity Stress Tolerance | GTGAAAGCTGCGCTCAGTTT | GGG | Glycine max (L.) Merr. | not found | protoplast | CRISPR-Cas9 |
| PCdb_6170 | 37032710 | not found | not found | GCGAGCTTGGTATTAATGAT | CGG | Oryza sativa L. | not found | protoplast | CRISPR-Cas9,CRISPR-Cas12,SaCas9 |
| PCdb_6171 | 35604091 | BAHD acyltransferases | Plant acyl-CoA-dependent acyltransferases, involved in secondary metabolite biosynthesis | GTTGAAATTAACAGCAACCC | AGG | Cichorium intybus L. | not found | hairy root | CRISPR-Cas9 |
| PCdb_6172 | 33015536 | AGO4 & NRPD1a & NRPE1 & RDR2 & RDR4 & RDR6 & CHLI1 & PIE1 | Multi-gene complex: RNA-directed DNA methylation machinery (small RNA biogenesis and chromatin modification) | CGGCAACCAAGAATCAGGCG | AGG | Arabidopsis thaliana (L.) Heynh. | 0.36 | seed | CRISPR-Cas9 |
| PCdb_6173 | 31349852 | / | not found | ACGCAAACGAATCGAGGAGT | AGG | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_6174 | 31349852 | LOC_Os09g34000 | not found | ATCGCCATCGCCATCGCCGC | AGG | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_6175 | 31349852 | LOC_Os01g03070 | not found | CGAAGGCGGCGGCGGCGATC | TGG | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_6176 | 31349852 | LOC_Os01g02960 | not found | TCTTCTTCTAATCTTGCTGT | TGG | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_6177 | 31349852 | LOC_Os01g04110 | not found | GTTGCTGCTGCTGCTGCGA | TGG | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_6178 | 31349852 | / | not found | ACGCAAACGAATCGAGGAGT | AGG | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_6179 | 31349852 | LOC_Os01g41180 | not found | ATCGCCATCGCCATCGCCGC | CGG | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_6180 | 31349852 | LOC_Os07g37990 | not found | CGAAGGCGGCGGCGGCGATC | CGG | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_6181 | 31349852 | / | not found | TCTTCTTCTAATCTTGCTGT | TGG | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_6182 | 31349852 | LOC_Os01g01390 | not found | GTTGCTGCTGCTGCTGCGA | CGG | Oryza sativa L. | not found | protoplast | CRISPR-Cas9 |
| PCdb_6183 | 35689624 | MCsite | not found | AAACAAATCGTGCAACAGAG | TGG | Arabidopsis thaliana | not found | protoplast | CRISPR-Cas9 |
| PCdb_6184 | 35689624 | MCsite | not found | GTGAAATAGAGCCTTCTGAT | TGG | Arabidopsis thaliana | not found | protoplast | CRISPR-Cas9 |
| PCdb_6185 | 35689624 | MCsite | not found | GTTTAAGCCGGTATTGTCGG | AGG | Arabidopsis thaliana | not found | protoplast | CRISPR-Cas9 |